1.Value of immunoglobulin G/immunoglobulin M ratio in predicting the prognosis of patients with initially unresectable hepatocellular carcinoma treated by transcatheter arterial chemoembolization combined with tyrosine kinase inhibitor and programmed cell death protein-1 inhibitor
Xingzhi LI ; Wei LUO ; Yuan FENG ; Yu CAI ; Xiaohong LIU ; Feixiang WU ; Yong PENG
Journal of Clinical Hepatology 2026;42(1):117-124
ObjectiveTo investigate the association between immunoglobulin G (IgG)/immunoglobulin M (IgM) ratio and prognosis in patients with initially unresectable hepatocellular carcinoma (iuHCC) receiving TTP triple therapy with transcatheter arterial chemoembolization (TACE), tyrosine kinase inhibitor (TKI), and programmed cell death protein-1 (PD-1) inhibitors. MethodsA retrospective analysis was performed for the clinical data of 151 iuHCC patients who received TTP triple therapy in Department of Hepatobiliary Surgery, Guangxi Medical University Cancer Hospital, from November 2019 to December 2022, and according to IgG/IgM ratio, they were divided into high IgG/IgM group (IgG/IgM ratio >13.23) and low IgG/IgM group (IgG/IgM ratio ≤13.23). The t-test was used for comparison of continuous data between groups, and the chi-square test was used for comparison of categorical data between groups. The Kaplan-Meier method and the log-rank test were used for survival analysis, and the Cox proportional hazards model was used to investigate the potential influencing factors for overall survival (OS). ResultsThe 151 patients had a median OS of 26.7 months (95% confidence interval [CI]: 19.8-not reached) and a median progression-free survival of 12.5 months (95%CI: 10.4 — 15.8). The objective response rate was 83.4% and the disease control rate was 94.0%. There were no significant differences in baseline data between the high IgG/IgM group and the low IgG/IgM group (all P>0.05). There was a significant difference in median OS between the high IgG/IgM group and the low IgG/IgM group (20.6 months vs not reached, P=0.016). In both the high IgG/IgM group and the low IgG/IgM group, salvage hepatectomy was significantly associated with the improvement in OS (χ2=8.297 and 10.307, both P<0.05). The multivariate analysis showed that high IgG/IgM ratio (hazard ratio [HR]=1.799, 95%CI: 1.077 — 3.006, P=0.025), baseline alpha-fetoprotein >400 ng/mL (HR=1.762, 95%CI: 1.017 — 3.050, P=0.043), and BCLC stage (HR=2.265, 95%CI: 1.212 — 4.232, P=0.010) were independent influencing factors for OS. ConclusionHigh IgG/IgM ratio is associated with a poorer prognosis in iuHCC patients receiving TTP triple therapy, and salvage hepatectomy has a potential value in improving the prognosis of patients with a high IgG/IGM ratio.
2.Development and validation of a prediction score for subtype diagnosis of primary aldosteronism.
Ping LIU ; Wei ZHANG ; Jiao WANG ; Hongfei JI ; Haibin WANG ; Lin ZHAO ; Jinbo HU ; Hang SHEN ; Yi LI ; Chunhua SONG ; Feng GUO ; Xiaojun MA ; Qingzhu WANG ; Zhankui JIA ; Xuepei ZHANG ; Mingwei SHAO ; Yi SONG ; Xunjie FAN ; Yuanyuan LUO ; Fangyi WEI ; Xiaotong WANG ; Yanyan ZHAO ; Guijun QIN
Chinese Medical Journal 2025;138(23):3206-3208
3.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
4.Expert consensus on the application of nasal cavity filling substances in nasal surgery patients(2025, Shanghai).
Keqing ZHAO ; Shaoqing YU ; Hongquan WEI ; Chenjie YU ; Guangke WANG ; Shijie QIU ; Yanjun WANG ; Hongtao ZHEN ; Yucheng YANG ; Yurong GU ; Tao GUO ; Feng LIU ; Meiping LU ; Bin SUN ; Yanli YANG ; Yuzhu WAN ; Cuida MENG ; Yanan SUN ; Yi ZHAO ; Qun LI ; An LI ; Luo BA ; Linli TIAN ; Guodong YU ; Xin FENG ; Wen LIU ; Yongtuan LI ; Jian WU ; De HUAI ; Dongsheng GU ; Hanqiang LU ; Xinyi SHI ; Huiping YE ; Yan JIANG ; Weitian ZHANG ; Yu XU ; Zhenxiao HUANG ; Huabin LI
Journal of Clinical Otorhinolaryngology Head and Neck Surgery 2025;39(4):285-291
This consensus will introduce the characteristics of fillers used in the surgical cavities of domestic nasal surgery patients based on relevant literature and expert opinions. It will also provide recommendations for the selection of cavity fillers for different nasal diseases, with chronic sinusitis as a representative example.
Humans
;
Nasal Cavity/surgery*
;
Nasal Surgical Procedures
;
China
;
Consensus
;
Sinusitis/surgery*
;
Dermal Fillers
5.Chinese expert consensus on the evaluation of allergen-specific immunotherapy outcomes(Wuhan, 2025).
Yuqin DENG ; Xi LUO ; Zhuofu LIU ; Shuguang SUN ; Jing YE ; Tiansheng WANG ; Jianjun CHEN ; Meiping LU ; Yin YAO ; Ying WANG ; Wei ZHOU ; Bei LIU ; Qingxiang ZENG ; Yuanteng XU ; Qintai YANG ; Yucheng YANG ; Feng LIU ; Chengli XU ; Yanan SUN ; Haiyu HONG ; Haibo YE ; Liqiang ZHANG ; Fenghong CHEN ; Huabin LI ; Hongtian WANG ; Yuncheng LI ; Wenlong LIU ; Yu XU ; Hongfei LOU
Journal of Clinical Otorhinolaryngology Head and Neck Surgery 2025;39(11):1075-1085
Allergen-specific immunotherapy(AIT) remains the only therapeutic approach with the potential to modify the natural course of allergic rhinitis(AR). Nevertheless, considerable inter-individual variability exists in patients'responses to AIT. To facilitate more reliable assessment of treatment efficacy, the China Rhinopathy Research Cooperation Group(CRRCG) convened young and middle-aged nasal experts in China to formulate the present consensus. The recommended subjective outcome measures for AIT comprise symptom scores, medication scores, combined symptom and medication scores, quality-of-life assessments, evaluation of disease control, and assessment of comorbidities. Objective indicators may supplement these measures. Currently available objective approaches include skin prick testing, nasal provocation testing, and allergen exposure chambers. However, these methods remain constrained by practical limitations and are not yet appropriate for routine implementation in clinical efficacy evaluation. In addition, several biomarkers, including sIgE and the sIgE/tIgE ratio, sIgG4, serum IgE-blocking activity, IgA, cytokines and chemokines, as well as immune cell surface molecules and their functional activity, have been shown to have associations with AIT outcomes. While these biomarkers may complement subjective assessments, they are subject to significant limitations. Consequently, large-scale multicenter trials and real-world evidence are required to strengthen the evidence base. The present consensus underscores the necessity of integrating patients'subjective experiences with objective testing throughout the treatment process, thereby providing a more comprehensive and accurate framework for efficacy evaluation. Looking forward, future investigations should prioritize the incorporation of multi-omics data and artificial intelligence methodologies, which hold promise for overcoming current limitations in assessment strategies and for advancing both the standardization and personalization of AIT.
Humans
;
Allergens/immunology*
;
China
;
Consensus
;
Desensitization, Immunologic
;
Immunoglobulin E
;
Quality of Life
;
Rhinitis, Allergic/therapy*
;
Treatment Outcome
;
East Asian People
6.Laboratory Diagnosis and Molecular Epidemiological Characterization of the First Imported Case of Lassa Fever in China.
Yu Liang FENG ; Wei LI ; Ming Feng JIANG ; Hong Rong ZHONG ; Wei WU ; Lyu Bo TIAN ; Guo CHEN ; Zhen Hua CHEN ; Can LUO ; Rong Mei YUAN ; Xing Yu ZHOU ; Jian Dong LI ; Xiao Rong YANG ; Ming PAN
Biomedical and Environmental Sciences 2025;38(3):279-289
OBJECTIVE:
This study reports the first imported case of Lassa fever (LF) in China. Laboratory detection and molecular epidemiological analysis of the Lassa virus (LASV) from this case offer valuable insights for the prevention and control of LF.
METHODS:
Samples of cerebrospinal fluid (CSF), blood, urine, saliva, and environmental materials were collected from the patient and their close contacts for LASV nucleotide detection. Whole-genome sequencing was performed on positive samples to analyze the genetic characteristics of the virus.
RESULTS:
LASV was detected in the patient's CSF, blood, and urine, while all samples from close contacts and the environment tested negative. The virus belongs to the lineage IV strain and shares the highest homology with strains from Sierra Leone. The variability in the glycoprotein complex (GPC) among different strains ranged from 3.9% to 15.1%, higher than previously reported for the seven known lineages. Amino acid mutation analysis revealed multiple mutations within the GPC immunogenic epitopes, increasing strain diversity and potentially impacting immune response.
CONCLUSION
The case was confirmed through nucleotide detection, with no evidence of secondary transmission or viral spread. The LASV strain identified belongs to lineage IV, with broader GPC variability than previously reported. Mutations in the immune-related sites of GPC may affect immune responses, necessitating heightened vigilance regarding the virus.
Humans
;
China/epidemiology*
;
Genome, Viral
;
Lassa Fever/virology*
;
Lassa virus/classification*
;
Molecular Epidemiology
;
Phylogeny
7.Exploration of New Susceptible Genes associated with Non-Alcoholic Fatty Liver Disease among Children with Obesity Using Whole Exome Sequencing.
Xiong Feng PAN ; Cai Lian WEI ; Jia You LUO ; Jun Xia YAN ; Xiang XIAO ; Jie WANG ; Yan ZHONG ; Mi Yang LUO
Biomedical and Environmental Sciences 2025;38(6):727-739
OBJECTIVE:
This study aimed to evaluate the association between susceptibility genes and non-alcoholic fatty liver disease (NAFLD) in children with obesity.
METHODS:
We conducted a two-step case-control study. Ninety-three participants were subjected to whole-exome sequencing (exploratory set). Differential genes identified in the small sample were validated in 1,022 participants using multiplex polymerase chain reaction and high-throughput sequencing (validation set).
RESULTS:
In the exploratory set, 14 genes from the NAFLD-associated pathways were identified. In the validation set, after adjusting for sex, age, and body mass index, ECI2 rs2326408 (dominant model: OR = 1.33, 95% CI: 1.02-1.72; additive model: OR = 1.22, 95% CI: 1.01-1.47), C6orf201 rs659305 (dominant model: OR = 1.30, 95% CI: 1.01-1.69; additive model: OR = 1.21, 95% CI: 1.00-1.45), CALML5 rs10904516 (pre-ad dominant model: OR = 1.36, 95% CI: 1.01-1.83; adjusted dominant model: OR = 1.40, 95% CI: 1.03-1.91; and pre-ad additive model: OR = 1.26, 95% CI: 1.04-1.66) polymorphisms were significantly associated with NAFLD in children with obesity ( P < 0.05). Interaction analysis revealed that the gene-gene interaction model of CALML5 rs10904516, COX11 rs17209882, and SCD5 rs3733228 was optional ( P < 0.05), demonstrating a negative interaction between the three genes.
CONCLUSION
In the Chinese population, the CALML5 rs10904516, C6orf201 rs659305, and ECI2 rs2326408 variants could be genetic markers for NAFLD susceptibility.
Humans
;
Non-alcoholic Fatty Liver Disease/genetics*
;
Child
;
Male
;
Female
;
Genetic Predisposition to Disease
;
Case-Control Studies
;
Exome Sequencing
;
Adolescent
;
Polymorphism, Single Nucleotide
;
Obesity/complications*
;
Pediatric Obesity/complications*
;
China
8.Exploration on the Effects of Bushen Huoxue Prescription on Rabbit Intervertebral Disc Degeneration Based on the RIPK1/RIPK3/MLKL Signaling Pathway
Wei PENG ; Liguo ZHU ; Xunlu YIN ; Jie LUO ; Kexin YANG ; Minshan FENG ; Jie YU ; Long LIANG ; Linghui LI ; Jiawen ZHAN ; Tao HAN ; Mingyi LUO ; Dian ZHANG
Chinese Journal of Information on Traditional Chinese Medicine 2025;32(2):71-77
Objective To observe the effects of Bushen Huoxue Prescription on the pathway related to necroptosis of nucleus pulposus cells in a model rabbit of intervertebral disc degeneration;To explore its mechanisms in delaying intervertebral disc degeneration.Methods A intervertebral disc degeneration rabbit model was established using the spinal instability method.Totally 40 model rabbits were randomly divided into model group,ibuprofen group and Bushen Huoxue Prescription low-,medium-and high-dosage groups.Additionally,a normal control group and a sham-operation group were set up,with 8 rabbits in each group.Each treatment groups received the corresponding drugs via gavage for two consecutive weeks.HE staining was used to observe morphology of nucleus pulposus tissue,transmission electron microscopy was used to observe ultrastructure in nucleus pulposus cells,immunohistochemical staining was used to assess the expressions of Aggrecan and Collagen Ⅱ in nucleus pulposus tissue,Western blot was used to detect the expressions of p-RIPK1,p-RIPK3 and p-MLKL protein in nucleus pulposus tissue.Results Compared with the sham-operation group,the model group showed a significant decrease in nucleus pulposus cells,disordered cell arrangement,reduced extracellular matrix,interrupted cell membrane continuity under transmission electron microscopy,organelle swelling,nuclear membrane disruption,partial chromatin loss,and positive expression of Aggrecan and Collagen Ⅱ in nucleus pulposus tissue decreased(P<0.01),while the expressions of p-RIPK1,p-RIPK3 and p-MLKL protein significantly increased(P<0.01).Compared with the model group,the treatment groups showed an increased number of nucleus pulposus cells with orderly arrangement and more extracellular matrix,the ultrastructural damage of the cell membrane,organelle and nucleus in nucleus pulposus cells was partially restored under transmission electron microscopy,the positive expressions of Aggrecan and Collagen Ⅱ significantly increased in Bushen Huoxue Prescription medium-and high-dosage groups and the ibuprofen group(P<0.05,P<0.01),while the expressions of p-RIPK1,p-RIPK3 and p-MLKL protein significantly decreased(P<0.05,P<0.01).Conclusion Bushen Huoxue Prescription may delay intervertebral disc degeneration of the model rabbit by inhibiting the expressions of p-RIPK1,p-RIPK3 and p-MLKL protein in nucleus pulposus cells,and promoting the generation of extracellular matrix components Aggrecan and Collagen Ⅱ.
9.Exploration on the Effect of Bushen Huoxue Prescription on Necroptosis in Human Nucleus Pulposus Cells Based on RIPK1/RIPK3/MLKL Pathway
Wei PENG ; Liguo ZHU ; Xunlu YIN ; Kexin YANG ; Jie LUO ; Minshan FENG ; Jie YU ; Linghui LI ; Jiawen ZHAN ; Tao HAN ; Long LIANG ; Mingyi LUO ; Dian ZHANG
Chinese Journal of Information on Traditional Chinese Medicine 2025;32(3):69-75
Objective To observe the effects of Bushen Huoxue Prescription on pressure-induced necroptosis in human nucleus pulposus cells and the expressions of RIPK1/RIPK3/MLKL pathway;To explore its potential mechanism in delaying intervertebral disc degeneration.Methods Human primary nucleus pulposus cells were cultured in vitro,and a model of nucleus pulposus cell degeneration was established using continuous load pressure method.After modeling,the nucleus pulposus cells were divided into model group,Bushen Huoxue Prescription group and inhibitor group,blank serum,Bushen Huoxue Prescription containing serum and necroptotic apoptosis inhibitor(Nec-1)intervention were administered,respectively.Normal group nucleus pulposus cells were cultured routinely.AO/EB fluorescence dual staining method was used for detecting cell apoptosis,flow cytometry was used to detect the necroptosis rate of nucleus pulposus cells,Western blot was used to detect the protein expressions of p-receptor interacting protein kinase(RIPK)1,p-RIPK3 and p-mixed lineage kinase domain like protein(MLKL),RT-qPCR was used to detect the mRNA expressions of RIPK1,RIPK3 and MLKL.Results Compared with the normal group,the model group showed more red fluorescence under AO/EB staining of nucleus pulposus cells,which were round and condensed,the necroptosis rate of nucleus pulposus cells increased(P<0.05),the protein expressions of p-RIPK1,p-RIPK3 and p-MLKL increased(P<0.05,P<0.01),while there was no significant difference in RIPK1 mRNA expression(P>0.05),and RIPK3 and MLKL mRNA expression increased(P<0.01).Compared with the model group,Bushen Huoxue Prescription group and the inhibitor group had less red condensed chromatin in the nucleus pulposus cells,Bushen Huoxue Prescription group had a lower rate of necroptosis(P<0.05),while the inhibitor group showed a decreasing trend in necroptosis rate(P>0.05),the protein expressions of p-RIPK1,p-RIPK3 and p-MLKL decreased in Bushen Huoxue Prescription group and the inhibitor group(P<0.05,P<0.01),while there was no significant difference in RIPK1 mRNA expression(P>0.05),and RIPK3 and MLKL mRNA expressions decreased(P<0.01).Conclusion Bushen Huoxue Prescription can alleviate pressure-induced damage to nucleus pulposus cells and inhibit necroptosis,thereby slowing the progression of intervertebral disc degeneration.Its mechanism may be related to the RIPK1/RIPK3/MLKL pathway mediated necroptosis.
10.Guideline for the prevention of intraoperative acquired pressure injury in paraplegic patients with spinal cord injury (version 2025)
Aijun XU ; Shuixia LI ; Bo CHEN ; Mengyuan YE ; Lejiao LANG ; Ning NING ; Lin ZHANG ; Changqing LIU ; Zhonglan CHEN ; Weihu MA ; Weishi LI ; Xiaoning WANG ; Dongmei BIAN ; Jiancheng ZENG ; Xin WANG ; Yuan GAO ; Yaping CHEN ; Jiali CHEN ; Yun HAN ; Xiuting LI ; Yang ZHOU ; Xiaojing SU ; Qiong ZHANG ; Tianwen HUANG ; Ping ZHANG ; Hua LIN ; Xingling XIAO ; Ruifeng XU ; Fanghui DONG ; Bing HAN ; Luo FAN ; Yanling PEI ; Suyun LI ; Xiaoju TAN ; Rongchen GUO ; Yefang ZOU ; Xiaoyun HAN ; Junqin DING ; Yi WANG ; Shuhua DENG ; Jinli GUO ; Yinhua LIANG ; Yuan CEN ; Xiaoqin LIU ; Junru CHEN ; Haiyang YU ; Lunlan LI ; Ying REN ; Yunxia LI ; Jianli LU ; Ying YING ; Lan WEI ; Yin WANG ; Qinhong XU ; Yanqin ZHANG ; Yang LYU ; Shijun ZHANG ; Sui WENJIE ; Sanlian HU ; Shuhong YANG ; Guoqing LI ; Jingjing AN ; Baorong HE ; Leling FENG
Chinese Journal of Trauma 2025;41(6):530-541
Paraplegia caused by spinal cord injury is a serious neurological complication, for which surgery is currently the main treatment method. Due to different surgical approaches, patients are usually expected to maintain a passive prone position for a long time or switch between the supine and prone positions. Affected by multiple factors such as neurogenic sensory disorders, pathological changes in muscle tone and operative duration, the risk of intraoperative acquired pressure injury (IAPI) is significantly increased. Current clinical prevention strategies for IAPI in these patients predominantly focus on localized pressure relief during positioning, lacking systematic, standardized comprehensive prevention protocols or evidence-based guidelines. To address it, Department of Nursing, Orthopedics Branch, China International Exchange and Promotive Association for Medical and Health Care, Spinal Trauma Professional Committee, Orthopedics Branch, Chinese Medical Doctor Association, Nursing Group of Spine and Spinal Cord Professional Committee of Chinese Association of Rehabilitation Medicine organized experts in relevant fields to formulate Guideline for the prevention of intraoperative acquired pressure injury in paraplegic patients with spinal cord injury ( version 2025), based on evidence-based medical evidence and latest research results and clinical practice at home and abroad. Eleven recommendations were put forward from the aspects of preoperative risk assessment, intraoperative prevention strategies, postoperative handover and monitoring, and supportive mechanisms for IAPI prevention, aiming to standardize the prevention measures and management strategies of IAPI in paraplegic patients with spinal cord injury and accelerate the recovery of patients and improve the therapeutic effect.

Result Analysis
Print
Save
E-mail