ObjectiveTo investigate the association between immunoglobulin G （IgG）/immunoglobulin M （IgM） ratio and prognosis in patients with initially unresectable hepatocellular carcinoma （iuHCC） receiving TTP triple therapy with transcatheter arterial chemoembolization （TACE）， tyrosine kinase inhibitor （TKI）， and programmed cell death protein-1 （PD-1） inhibitors. MethodsA retrospective analysis was performed for the clinical data of 151 iuHCC patients who received TTP triple therapy in Department of Hepatobiliary Surgery， Guangxi Medical University Cancer Hospital， from November 2019 to December 2022， and according to IgG/IgM ratio， they were divided into high IgG/IgM group （IgG/IgM ratio >13.23） and low IgG/IgM group （IgG/IgM ratio ≤13.23）. The t-test was used for comparison of continuous data between groups， and the chi-square test was used for comparison of categorical data between groups. The Kaplan-Meier method and the log-rank test were used for survival analysis， and the Cox proportional hazards model was used to investigate the potential influencing factors for overall survival （OS）. ResultsThe 151 patients had a median OS of 26.7 months （95% confidence interval ［CI］： 19.8-not reached） and a median progression-free survival of 12.5 months （95%CI： 10.4 — 15.8）. The objective response rate was 83.4% and the disease control rate was 94.0%. There were no significant differences in baseline data between the high IgG/IgM group and the low IgG/IgM group （all P>0.05）. There was a significant difference in median OS between the high IgG/IgM group and the low IgG/IgM group （20.6 months vs not reached， P=0.016）. In both the high IgG/IgM group and the low IgG/IgM group， salvage hepatectomy was significantly associated with the improvement in OS （χ²=8.297 and 10.307， both P<0.05）. The multivariate analysis showed that high IgG/IgM ratio （hazard ratio ［HR］=1.799， 95%CI： 1.077 — 3.006， P=0.025）， baseline alpha-fetoprotein >400 ng/mL （HR=1.762， 95%CI： 1.017 — 3.050， P=0.043）， and BCLC stage （HR=2.265， 95%CI： 1.212 — 4.232， P=0.010） were independent influencing factors for OS. ConclusionHigh IgG/IgM ratio is associated with a poorer prognosis in iuHCC patients receiving TTP triple therapy， and salvage hepatectomy has a potential value in improving the prognosis of patients with a high IgG/IGM ratio.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

This consensus will introduce the characteristics of fillers used in the surgical cavities of domestic nasal surgery patients based on relevant literature and expert opinions. It will also provide recommendations for the selection of cavity fillers for different nasal diseases, with chronic sinusitis as a representative example.
Humans ; Nasal Cavity/surgery* ; Nasal Surgical Procedures ; China ; Consensus ; Sinusitis/surgery* ; Dermal Fillers

Allergen-specific immunotherapy（AIT） remains the only therapeutic approach with the potential to modify the natural course of allergic rhinitis（AR）. Nevertheless, considerable inter-individual variability exists in patients'responses to AIT. To facilitate more reliable assessment of treatment efficacy, the China Rhinopathy Research Cooperation Group（CRRCG） convened young and middle-aged nasal experts in China to formulate the present consensus. The recommended subjective outcome measures for AIT comprise symptom scores, medication scores, combined symptom and medication scores, quality-of-life assessments, evaluation of disease control, and assessment of comorbidities. Objective indicators may supplement these measures. Currently available objective approaches include skin prick testing, nasal provocation testing, and allergen exposure chambers. However, these methods remain constrained by practical limitations and are not yet appropriate for routine implementation in clinical efficacy evaluation. In addition, several biomarkers, including sIgE and the sIgE/tIgE ratio, sIgG4, serum IgE-blocking activity, IgA, cytokines and chemokines, as well as immune cell surface molecules and their functional activity, have been shown to have associations with AIT outcomes. While these biomarkers may complement subjective assessments, they are subject to significant limitations. Consequently, large-scale multicenter trials and real-world evidence are required to strengthen the evidence base. The present consensus underscores the necessity of integrating patients'subjective experiences with objective testing throughout the treatment process, thereby providing a more comprehensive and accurate framework for efficacy evaluation. Looking forward, future investigations should prioritize the incorporation of multi-omics data and artificial intelligence methodologies, which hold promise for overcoming current limitations in assessment strategies and for advancing both the standardization and personalization of AIT.
Humans ; Allergens/immunology* ; China ; Consensus ; Desensitization, Immunologic ; Immunoglobulin E ; Quality of Life ; Rhinitis, Allergic/therapy* ; Treatment Outcome ; East Asian People

Objective:To assess the efficacy and safety profile of antaitasvir phosphate combined with yiqibuvir in the treatment of chronic hepatitis C (CHC) of various genotypes, without cirrhosis or with compensated cirrhosis.Methods:394 cases with CHC from 22 centers were collected from October 2021 to April 2023. They were randomly assigned to receive either the experimental drugs (antaitasvir phosphate 100 mg+yiqibuvir 600 mg) or placebo treatment in a 3∶1 ratio. The patients were administered drugs once a day for 12 consecutive weeks, and then followed up for 24 weeks after treatment cessation. All subjects were unblinded at the four-week follow-up following drug discontinuation, with the experimental drug group continuing to complete subsequent post-discontinuation follow-up. The placebo group was switched to receive the experimental drugs for a repeated 12-week treatment period and followed up for another 24 weeks after discontinuation of the drug (placebo delayed treatment phase).The sustained virologic response rate (SVR12) was observed for subjects in the double-blind phase and the placebo delayed-treatment phase at 12 weeks after treatment cessation.Virological resistance analysis was performed on subjects who failed treatment. The primary efficacy endpoint was SVR12. The number and percentage of subjects who achieved "HCV RNA

Objective To establish two osteoarthritis models of destabilization of the medial meniscus(DMM)and chronic ankle instability(CAI)in mice,and compare the effects of knee osteoarthritis with varus deformity on ipsilateral ankle cartilage degeneration.Methods Thirty 6-week-old C57BL/6J male mice were randomly divided into a control group and two surgical groups(DMM group and CAI group),respectively.The progression of ankle joint degeneration was quantitatively evaluated through behavioral observation,imaging techniques and histopathology analysis in each group of mice over a 12-week period.Results A decline in gait stability and balance was observed in two surgical groups.Compared to the control group,the time required to cross the balance beam was increased by 23.20％,and the number of slips was increased by 43.26％at 12th week postoperatively in the DMM group.The bone volume fraction and bone mineral density of ankle joints also increased.Meanwhile,wear and tear of the ankle cartilage were found,with the formation of osteophytes,and OARSI score was increased by 88.89％.These changes in ankle joint were more pronounced in the CAI group.Conclusions This mouse model-based study revealed a coupling relationship between the knee and ankle motion.Knee osteoarthritis with varus deformity could lead to a significant ankle joint degeneration,while the damage was less severe than that observed in CAI.

Objective:To explore the clinicopathological features of rectal neuroendocrine tumor (R-NET) G2, identify prognostic factors, and summarize treatment experience.Methods:The clinical data of patients diagnosed with R-NET G2 by pathological diagnosis admitted to Cancer Hospital of the Chinese Academy of Medical Sciences from January 2003 to September 2023 were retrospectively analyzed. The Fisher's exact test and Kaplan-Meier curves were performed to analyze the association between pathological features and prognosis.Results:A total of 22 patients were enrolled in this study and 21 patients were followed up for a period of 6-98 months with a median follow-up time of 42 months. 5 patients died due to tumor progression during the follow-up period. The 1-, 3-, and 5-year cancer-specific survival (CSS) of the whole group were 100.0%, 92.9%, and 69.6%, respectively. Of the 22 patients, 20 underwent surgical treatment, of which 15 underwent postoperative adjuvant therapy; 2 underwent medical treatment for liver and bone multiple metastases. The 5-year survival rates of patients with tumours ≥2 cm in length, T2-3 stage, lymph node metastasis, and distant metastasis (57.1%, 68.8%, 66.7%, and 63.6%, respectively) were shorter than those of patients with tumours <2 cm in length, T1 stage, no lymph node metastasis, and no distant metastasis (all 100.0%, P＜0.001). In addition, patients with liver metastases had larger primary tumor diameters and higher T-stages compared with those without distant metastasis ( P＜0.05). Conclusions:R-NET G2 has a high degree of malignancy compared with G1 and a high propensity for metastasis. Clinicians should formulate appropriate diagnostic and treatment strategies based on factors such as tumor size, depth of invasion, lymph node status, presence of distant metastasis, and the location and extent of distant metastasis.

OBJECTIVE: This study reports the first imported case of Lassa fever (LF) in China. Laboratory detection and molecular epidemiological analysis of the Lassa virus (LASV) from this case offer valuable insights for the prevention and control of LF. METHODS: Samples of cerebrospinal fluid (CSF), blood, urine, saliva, and environmental materials were collected from the patient and their close contacts for LASV nucleotide detection. Whole-genome sequencing was performed on positive samples to analyze the genetic characteristics of the virus. RESULTS: LASV was detected in the patient's CSF, blood, and urine, while all samples from close contacts and the environment tested negative. The virus belongs to the lineage IV strain and shares the highest homology with strains from Sierra Leone. The variability in the glycoprotein complex (GPC) among different strains ranged from 3.9% to 15.1%, higher than previously reported for the seven known lineages. Amino acid mutation analysis revealed multiple mutations within the GPC immunogenic epitopes, increasing strain diversity and potentially impacting immune response. CONCLUSION The case was confirmed through nucleotide detection, with no evidence of secondary transmission or viral spread. The LASV strain identified belongs to lineage IV, with broader GPC variability than previously reported. Mutations in the immune-related sites of GPC may affect immune responses, necessitating heightened vigilance regarding the virus.
Humans ; China/epidemiology* ; Genome, Viral ; Lassa Fever/virology* ; Lassa virus/classification* ; Molecular Epidemiology ; Phylogeny

OBJECTIVE: This study aimed to evaluate the association between susceptibility genes and non-alcoholic fatty liver disease (NAFLD) in children with obesity. METHODS: We conducted a two-step case-control study. Ninety-three participants were subjected to whole-exome sequencing (exploratory set). Differential genes identified in the small sample were validated in 1,022 participants using multiplex polymerase chain reaction and high-throughput sequencing (validation set). RESULTS: In the exploratory set, 14 genes from the NAFLD-associated pathways were identified. In the validation set, after adjusting for sex, age, and body mass index, ECI2 rs2326408 (dominant model: OR = 1.33, 95% CI: 1.02-1.72; additive model: OR = 1.22, 95% CI: 1.01-1.47), C6orf201 rs659305 (dominant model: OR = 1.30, 95% CI: 1.01-1.69; additive model: OR = 1.21, 95% CI: 1.00-1.45), CALML5 rs10904516 (pre-ad dominant model: OR = 1.36, 95% CI: 1.01-1.83; adjusted dominant model: OR = 1.40, 95% CI: 1.03-1.91; and pre-ad additive model: OR = 1.26, 95% CI: 1.04-1.66) polymorphisms were significantly associated with NAFLD in children with obesity ( P < 0.05). Interaction analysis revealed that the gene-gene interaction model of CALML5 rs10904516, COX11 rs17209882, and SCD5 rs3733228 was optional ( P < 0.05), demonstrating a negative interaction between the three genes. CONCLUSION In the Chinese population, the CALML5 rs10904516, C6orf201 rs659305, and ECI2 rs2326408 variants could be genetic markers for NAFLD susceptibility.
Humans ; Non-alcoholic Fatty Liver Disease/genetics* ; Child ; Male ; Female ; Genetic Predisposition to Disease ; Case-Control Studies ; Exome Sequencing ; Adolescent ; Polymorphism, Single Nucleotide ; Obesity/complications* ; Pediatric Obesity/complications* ; China