1.VEGF Inhibitor–Associated Side Effects in Antitumor Therapy and Intervention Strategies
Lu LIU ; Wanting SUN ; Shuning YAO ; Zhenyu CHEN ; Yuefei WANG ; Jing YANG
Cancer Research on Prevention and Treatment 2026;53(4):289-300
Vascular endothelial growth factor (VEGF) inhibitors are drugs that target and inhibit tumor angiogenesis. By blocking the signaling pathway of VEGF and its receptor, they suppress tumor proliferation and play a crucial role in tumor treatment. However, their side effects, such as hypertension, proteinuria, hand-foot skin reactions, and myelosuppression, during treatment seriously affect patients' treatment compliance and quality of life. The development of intervention strategies for the side effects of VEGF inhibitors is of great importance for tumor treatment. This article reviews the clinical characteristics and toxic mechanisms of common side effects caused by VEGF inhibitors during tumor treatment and summarizes intervention strategies that combine traditional Chinese and Western medicines. Drug dosages were precisely monitored and adjusted to achieve antitumor treatment. Patients' discomfort symptoms are improved through prescriptions that act by tonifying qi and promoting blood circulation, strengthening the spleen, and tonifying the kidney. The combination of traditional Chinese and Western medicines is used to treat patients, thus providing a safe and effective treatment plan for patients with cancer.
2.Pharmacoeconomic evaluation of dapagliflozin and empagliflozin in the treatment of type 2 diabetic kidney disease
Xu YANG ; Yifan ZHAO ; Wanting LI ; Yongjun LIU
China Pharmacy 2025;36(18):2285-2290
OBJECTIVE To evaluate the cost-effectiveness of dapagliflozin and empagliflozin in the treatment of type 2 diabetic kidney disease from the perspective of healthcare system in China. METHODS Based on the data from the two multicenter clinical trials, DECLARE-TIMI 58 and EMPA-REG OUTCOME, a Markov model was constructed according to the urinary albumin-to-creatinine ratio (UACR) of the patients with type 2 diabetic kidney disease with a cycle of 1 year, simulating until 99% of patients died. The model outputs were total costs and quality-adjusted life year (QALY). The cost-effectiveness of the two treatment regimens was assessed by comparing their incremental cost-effectiveness ratio (ICER) and the willingness-to-pay threshold (WTP,set at three times China’s 2023 per capita gross domestic product, i.e., 268 074 yuan/QALY). Additionally, oneway sensitivity analysis and probabilistic sensitivity analysis were performed to test the robustness of the base analysis results. RESULTS Compared with dapagliflozin, the ICER for empagliflozin regimen was 44 334.82 yuan/QALY, which was below the WTP , indicating its cost-effectiveness. The results of the oneway sensitivity analysis indicated that the incidence of non-fatal myocardial infarction in both groups and the utility values associated with the microalbuminuria state had the most significant impact on the outcomes, but did not change the base-case conclusion. The probabilistic sensitivity analysis indicated that the results of the base-case analysis were robust. CONCLUSIONS With a WTP of three times China’s per capita gross domestic product in 2023, empagliflozin is more cost-effective than dapagliflozin in treating type 2 diabetic kidney disease.
3.Mechanism of Naoxintong Capsules Against Ischemia-reperfusion Injury in Rats via Inhibiting Pericyte Contraction Based on RHOA/ROCK1 Pathway
Yinlian WEN ; Jinfeng SHANG ; Bohong WANG ; Wanting WEI ; Xiaolu ZHANG ; Guijinfeng HUANG ; Xin LIU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(12):159-167
ObjectiveTo investigate the mechanism of Naoxintong capsules on ischemia-reperfusion (I/R) injury in rats based on the changes of pericytes mediated by Ras homolog family member A (RHOA)/Rho-associated coiled-coil containing protein kinase 1 (ROCK1) pathway. MethodsNinety rats (15 rats for each group) were randomly divided into a sham operation group, a model group, a positive control group receiving Ginkgo biloba extract (21.6 mg·kg-1), and groups receiving Naoxintong capsules at low, medium, and high doses of 55, 110, and 220 mg·kg-1 (NXT-L, NXT-M, and NXT-H groups), respectively. Except for those in the sham operation group, all rats were subjected to transient middle cerebral artery occlusion (tMCAO) to establish the experiment model. Nerve function was assessed using a neurological function score. Cerebral blood flow was detected using a laser speckle contrast imager, and the cerebral infarction rate was calculated using 2,3,5-Triphenyl tetrazolium chloride (TTC) staining. Pathological changes were observed by hematoxylin-eosin (HE) staining and Nissl staining, while pericyte morphology was observed via transmission electron microscopy. Blood-brain barrier destruction was observed by Evans blue staining. Albumin and ischemia-modified albumin levels were measured using assay kits. Real-time fluorescence quantitative polymerase chain reaction (Real-time PCR) and Western blot were used to detect the mRNA and protein expression levels of RHOA, ROCK1, platelet-derived growth factor receptor β (PDGFRB), α-smooth muscle actin (α-SMA), tight junction protein (ZO-1), matrix metalloproteinase-2 (MMP-2), and matrix metalloproteinase-9 (MMP-9). ResultsCompared with the sham operation group, the model group exhibited decreased neurological function scores, higher percentage reduction in blood flow, and increased cerebral infarction rates (P<0.01). Additionally, cortical neuronal nucleus shrinkage, edema, a decreased number of Nissl bodies, reduced pericyte area, elevated albumin content in the cortex (P<0.05), and increased ischemic modified albumin levels (P<0.01) were observed. The mRNA and protein expression levels of RHOA, ROCK1, PDGFRB, α-SMA, MMP-2, and MMP-9 were increased (P<0.01), while those of ZO-1 were decreased. Compared with the model group, all treatment groups showed improved neurological function scores, lower percentage reduction in blood flow, reduced cerebral infarction rates (P<0.01), alleviated cortical histological changes, increased number of Nissl bodies, expanded pericyte area, decreased albumin content in the cortex, and reduced ischemia-modified albumin levels (P<0.01). The mRNA and protein expression levels of RHOA, ROCK1, PDGFRB, α-SMA, MMP-2, and MMP-9 were decreased (P<0.01), while those of ZO-1 were increased. Among the treatment groups, the NXT-M group showed the most pronounced improvement in cerebral I/R injury. ConclusionNaoxintong capsules can restore cerebral blood supply, reduce microcirculation disturbance, and protect blood-brain barrier in rats with I/R injury. Its mechanism of action may be related to the inhibition of the RHOA/ROCK1 signaling pathway and reduced pericyte contraction.
4.Mechanism of Naoxintong Capsules Against Ischemia-reperfusion Injury in Rats via Inhibiting Pericyte Contraction Based on RHOA/ROCK1 Pathway
Yinlian WEN ; Jinfeng SHANG ; Bohong WANG ; Wanting WEI ; Xiaolu ZHANG ; Guijinfeng HUANG ; Xin LIU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(12):159-167
ObjectiveTo investigate the mechanism of Naoxintong capsules on ischemia-reperfusion (I/R) injury in rats based on the changes of pericytes mediated by Ras homolog family member A (RHOA)/Rho-associated coiled-coil containing protein kinase 1 (ROCK1) pathway. MethodsNinety rats (15 rats for each group) were randomly divided into a sham operation group, a model group, a positive control group receiving Ginkgo biloba extract (21.6 mg·kg-1), and groups receiving Naoxintong capsules at low, medium, and high doses of 55, 110, and 220 mg·kg-1 (NXT-L, NXT-M, and NXT-H groups), respectively. Except for those in the sham operation group, all rats were subjected to transient middle cerebral artery occlusion (tMCAO) to establish the experiment model. Nerve function was assessed using a neurological function score. Cerebral blood flow was detected using a laser speckle contrast imager, and the cerebral infarction rate was calculated using 2,3,5-Triphenyl tetrazolium chloride (TTC) staining. Pathological changes were observed by hematoxylin-eosin (HE) staining and Nissl staining, while pericyte morphology was observed via transmission electron microscopy. Blood-brain barrier destruction was observed by Evans blue staining. Albumin and ischemia-modified albumin levels were measured using assay kits. Real-time fluorescence quantitative polymerase chain reaction (Real-time PCR) and Western blot were used to detect the mRNA and protein expression levels of RHOA, ROCK1, platelet-derived growth factor receptor β (PDGFRB), α-smooth muscle actin (α-SMA), tight junction protein (ZO-1), matrix metalloproteinase-2 (MMP-2), and matrix metalloproteinase-9 (MMP-9). ResultsCompared with the sham operation group, the model group exhibited decreased neurological function scores, higher percentage reduction in blood flow, and increased cerebral infarction rates (P<0.01). Additionally, cortical neuronal nucleus shrinkage, edema, a decreased number of Nissl bodies, reduced pericyte area, elevated albumin content in the cortex (P<0.05), and increased ischemic modified albumin levels (P<0.01) were observed. The mRNA and protein expression levels of RHOA, ROCK1, PDGFRB, α-SMA, MMP-2, and MMP-9 were increased (P<0.01), while those of ZO-1 were decreased. Compared with the model group, all treatment groups showed improved neurological function scores, lower percentage reduction in blood flow, reduced cerebral infarction rates (P<0.01), alleviated cortical histological changes, increased number of Nissl bodies, expanded pericyte area, decreased albumin content in the cortex, and reduced ischemia-modified albumin levels (P<0.01). The mRNA and protein expression levels of RHOA, ROCK1, PDGFRB, α-SMA, MMP-2, and MMP-9 were decreased (P<0.01), while those of ZO-1 were increased. Among the treatment groups, the NXT-M group showed the most pronounced improvement in cerebral I/R injury. ConclusionNaoxintong capsules can restore cerebral blood supply, reduce microcirculation disturbance, and protect blood-brain barrier in rats with I/R injury. Its mechanism of action may be related to the inhibition of the RHOA/ROCK1 signaling pathway and reduced pericyte contraction.
5.Impact of dairy farming on gut microbiota structure and diversity of practitioners
Zhaojie WANG ; Xixiao MA ; Xianxia LIU ; Yanggui CHEN ; Xueying XIANG ; Wanting XU ; Jiguo JIN ; Fan WU ; Xiangnan WEI ; Jianyong WU ; Fuye LI
Journal of Environmental and Occupational Medicine 2025;42(6):668-673
Background Animal farming may affect the structure and diversity of gut microbiota of farm workers, but it needs more studies to provide solid evidence. Objective To analyze the diversity characteristics of gut microbiota in dairy farm workers, dairy cows, and the control population (non-animal contact occupational group), and to assess the impact of dairy farming on the gut microbiota of workers. Methods The 16S rRNA full-length amplicon sequencing technology was used to sequence 60 fecal samples from dairy farm workers, 89 from dairy cows, and 50 from the general population. The gut microbiota structure characteristics, including operational taxonomic units (OTUs), alpha diversity, beta diversity, and the composition of species at the phylum, family, and genus levels were analyzed. The differences in gut microbiota among the three groups of samples were compared to explore the impact of occupational exposure on the gut microbiota structure of dairy farm workers. Results A total of
6.Based on Intestinal Microecology Theory to Analyze Scientific Connotation and Clinical Application in ZHANG Zhongjing's Stomach Qi Theory
Wanting LIU ; Shuyuan LIN ; Panjie LIN
Journal of Zhejiang Chinese Medical University 2025;49(3):376-381,390
[Objective]To explore the scientific connotation of ZHANG Zhongjing's stomach Qi theory with gut microbiota theory and to provide a basis for its clinical application.[Methods]Relevant records on the spleen and stomach,and their functions were collected from traditional Chinese medical classics such as Huangdi Neijing,Shanghan Lun and Jingui Yaolue.Based on the theory of gut microbiota and gut microecology,the scientific connotation of ZHANG Zhongjing's stomach Qi theory was explored from both physiological and pathological perspectives.Furthermore,the scientific basis of this theory in preventing disease transmission and predicting prognosis in clinical practice was preliminarily analyzed.[Results]The modern connotation of ZHANG Zhongjing's theory of stomach Qi can be explained from the roles of gut microbiota and the gut microecological environment in human physiology and their mechanisms of influence in pathological processes.The gut microbiota converts food and maintains normal metabolism,corresponding to stomach Qi's role in generating biochemical fluids.It also promotes the development of the intestinal mucosal immune barrier and inhibits pathogenic bacteria,reflecting stomach Qi's defensive role.Furthermore,the microbiota maintains intestinal barrier integrity,aligning with stomach Qi's regulation in the lower-Jiao,and influences cognition through the gut-brain axis,which corresponds to the calming aspects of stomach Qi.At the level of pathological states,gut microecological imbalance,primarily characterized by dysbiosis,exemplifies the pathological features of Taiyin disease related to stomach deficiency and cold,Yangming disease associated with stomach excess and heat,and Jueyin disease marked by mixed cold,heat,deficiency and excess,as described in the Zhongjing system.It is acknowledged that gut microbial imbalance is both a cause of diseases,which can further exacerbate disease progression,and a consequence of diseases.This highlights the impact of the pathological state of stomach Qi on disease characteristics,transmission and prognosis,underscoring the significance of ZHANG Zhongjing's academic thought on"preserving stomach Qi."[Conclusion]Taking the theory of gut microecology as an entry point,this study explores the scientific connotation of stomach Qi theory,aligning it with modern biological understanding.The gut microbiota and gut microecology theory can serve as a bridge between Zhongjing's academic thought of"preserving stomach Qi"and modern medicine,providing theoretical basis and new research ideas for enhancing the clinical efficacy and interpretability of classical prescriptions.
7.Analysis of clinical characteristics and etiologies of hospitalized patients with spike-and-wave activation in sleep
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Applied Clinical Pediatrics 2025;40(6):426-433
Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.
8.S1P/S1PR1 attenuates H2O2-induced mitochondrial damage in vascular endothelial cells by inhibiting Pyk2
Chaoquan LI ; Hui YAO ; Wanting LIU ; Yuxin XIE ; Haotian YANG ; Aoni FU ; Jing LI ; Guanghui YI
Chinese Journal of Arteriosclerosis 2025;33(6):481-492
Aim To investigates whether sphingosine-1-phosphate(S1P)regulates the expression of mitochon-drial calcium uniporter(MCU)via the sphingosine-1-phosphate receptor/proline-rich tyrosine kinase 2(S1PR/Pyk2)sig-naling pathway,thereby reducing oxidative stress-induced mitochondrial damage and inhibiting mitochondria-related apopto-sis.Methods Human umbilical vein endothelial cells(HUVEC)were subjected to oxidative damage using hydrogen peroxide(H2O2)as a model.Different concentrations of S1P were applied to the oxidative damaged HUVEC.Addi-tionally,the S1PR1 agonist SEW2871,the S1PR1 inhibitor W146,and the Pyk2 inhibitor PF-562271 were used to explore the specific mechanism of S1P action.Results S1P treatment significantly alleviated oxidative damage in HUVEC and was accompanied by an increase in S1PR1 expression(P<0.05),while S1PR3 expression remained unchanged.Mean-while,the expression levels of Pyk2 and MCU decreased(P<0.05).SEW2871 further reduced mitochondrial damage,whereas W146 exacerbated it(P<0.05).Furthermore,the application of the Pyk2 inhibitor PF-562271 also reduced H2O2-induced mitochondrial damage(P<0.05),further confirming the role of Pyk2 in this process.Conclusion S1P reduces H2O2-induced mitochondrial damage and inhibits mitochondria-related apoptosis in HUVEC by suppressing Pyk2 expression via S1PR1.
9.Effect of high-frequency repetitive transcranial magnetic stimulation on upper limb function of stroke patients based on motor sequence learning
Wanting SUN ; Ailipinai YASEN ; Xiang GONG ; Yue XIAO ; Zhaodan GAN ; Mingjie LIU ; Lanting ZENG ; Shuyue MA ; Jun LU ; Guangxu XU
Chinese Journal of Rehabilitation Theory and Practice 2025;31(7):812-821
Objective To investigate the effects of high-frequency repetitive transcranial magnetic stimulation(HF-rTMS)applied to the supplementary motor area(SMA)or primary motor cortex(M1)on upper limb function in stroke patients in terms of motor sequence learning.Methods From April,2024 to February,2025,60 inpatients were recruited from the First Affiliated Hospital with Nan-jing Medical University.They were randomly assigned into the control group,SMA group and M1 group,with 20 patients in each group.All the groups received medication and conventional rehabilitation.On this basis,SMA group underwent HF-rTMS on the affected side's SMA,while M1 group received HF-rTMS on the affected side's M1 for two weeks.All the groups were measured with motor evoked potentials(MEP),the serial reaction time(RT)task,Fugl-Meyer Assessment-Upper Extremities(FMA-UE)and modified Barthel Index(MBI)before and after intervention.Results The SMA and M1 groups dropped one case respectively.MEP elicitation rate of the affected side's increased in SMA and M1 groups(P<0.05),and it was better than that in the control group(χ2>4.792,P<0.05).The intra-group effects of RTsequential sequence,FMA-UE and MBI scores were significant(|F|>81.546,P<0.05).The inter-group effects of RTrandom sequence,RTsequential sequence,?RT,and MBI scores were significant(F>3.228,P<0.05).The in-teractive effects of RTrandom sequence,RTsequential sequence,?RT,FMA-UE and MBI scores were significant(|F|>3.520,P>0.05).After intervention,RTsequential sequence,?RT,FMA-UE and MBI scores improved(P<0.05).RTrandom sequence was lower in SMA group than in the control group(P<0.017),RTsequential sequence,?RT,FMA-UE and MBI scores im-proved more in SMA and M1 groups than in the control group(P<0.05),but no significant difference was found between the SMA group and the M1 group(P>0.05).Conclusion HF-rTMS applied to the affected SMA or M1 can activate motor sequence learning and promote the recov-ery of upper limb function in stroke patients.
10.Analysis of influencing factors of acute cardiovascular and cerebrovascular accidents after surgery in elderly patients with lower extremity fracture
Wanting LI ; Hongyang LIU ; Jing SANG ; Yufeng RUAN ; Li XU ; Dongmei LI
Tianjin Medical Journal 2025;53(6):648-653
Objective To analyze risk factors of acute cardio-cerebrovascular accidents in elderly patients with lower extremity fracture,and to construct a risk prediction diagram model.Methods A retrospective analysis was conducted on the clinical data of 510 elderly patients with lower extremity fractures,and the patients were divided into the occurrence group and the non-occurrence group based on the occurrence of acute cardiovascular and cerebrovascular accidents during the postoperative hospitalization.Univariate and multivariate Logistic regression analysis was used to analyze risk factors affecting acute cardiovascular and cerebrovascular accidents in elderly patients with lower extremity fracture,and the risk prediction model was constructed and verified.Results A total of 52 cases of acute cardio-cerebrovascular accidents occurred during hospitalization in 510 patients(10.20%).Age,ASA grade Ⅲ ratio,preoperative concurrent cerebrovascular disease,postoperative pneumonia ratio and postoperative bed time≥5 days ratio were higher in the occurrence group than those in the non-occurrence group(P<0.05).Multivariate Logistic regression analysis showed that age,ASA grade Ⅲ,preoperative concurrent cardiovascular and cerebrovascular disease,and postoperative pneumonia were risk factors for acute cardio-cerebrovascular accidents in elderly patients with lower limb fracture(P<0.05).Multivariate Logistic regression analysis was used to screen risk factors as predictive variables to build a risk early warning histogram model for acute cardio-cerebrovascular accidents.The total score ranged from 103 to 168 points,corresponding to a risk range of 0.1 to 0.9 points.Receiver operating characteristic curve(ROC)curve results showed that the area under the curve(AUC)of this model for predicting acute cardiovascular and cerebrovascular accidents was 0.980(95%CI:0.964-1.000),and discrete choice approach(DCA)showed that when the risk threshold was 0.2-0.6,the prediction model of this column graph had a good clinical advantage.Conclusion The risk diagram model constructed based on risk factors has good predictive value for the occurrence of acute cardio-cerebrovascular accidents after lower extremity fracture in elderly patients.

Result Analysis
Print
Save
E-mail