Vascular endothelial growth factor (VEGF) inhibitors are drugs that target and inhibit tumor angiogenesis. By blocking the signaling pathway of VEGF and its receptor, they suppress tumor proliferation and play a crucial role in tumor treatment. However, their side effects, such as hypertension, proteinuria, hand-foot skin reactions, and myelosuppression, during treatment seriously affect patients' treatment compliance and quality of life. The development of intervention strategies for the side effects of VEGF inhibitors is of great importance for tumor treatment. This article reviews the clinical characteristics and toxic mechanisms of common side effects caused by VEGF inhibitors during tumor treatment and summarizes intervention strategies that combine traditional Chinese and Western medicines. Drug dosages were precisely monitored and adjusted to achieve antitumor treatment. Patients' discomfort symptoms are improved through prescriptions that act by tonifying qi and promoting blood circulation, strengthening the spleen, and tonifying the kidney. The combination of traditional Chinese and Western medicines is used to treat patients, thus providing a safe and effective treatment plan for patients with cancer.

[Objective]To explore the scientific connotation of ZHANG Zhongjing's stomach Qi theory with gut microbiota theory and to provide a basis for its clinical application.[Methods]Relevant records on the spleen and stomach,and their functions were collected from traditional Chinese medical classics such as Huangdi Neijing,Shanghan Lun and Jingui Yaolue.Based on the theory of gut microbiota and gut microecology,the scientific connotation of ZHANG Zhongjing's stomach Qi theory was explored from both physiological and pathological perspectives.Furthermore,the scientific basis of this theory in preventing disease transmission and predicting prognosis in clinical practice was preliminarily analyzed.[Results]The modern connotation of ZHANG Zhongjing's theory of stomach Qi can be explained from the roles of gut microbiota and the gut microecological environment in human physiology and their mechanisms of influence in pathological processes.The gut microbiota converts food and maintains normal metabolism,corresponding to stomach Qi's role in generating biochemical fluids.It also promotes the development of the intestinal mucosal immune barrier and inhibits pathogenic bacteria,reflecting stomach Qi's defensive role.Furthermore,the microbiota maintains intestinal barrier integrity,aligning with stomach Qi's regulation in the lower-Jiao,and influences cognition through the gut-brain axis,which corresponds to the calming aspects of stomach Qi.At the level of pathological states,gut microecological imbalance,primarily characterized by dysbiosis,exemplifies the pathological features of Taiyin disease related to stomach deficiency and cold,Yangming disease associated with stomach excess and heat,and Jueyin disease marked by mixed cold,heat,deficiency and excess,as described in the Zhongjing system.It is acknowledged that gut microbial imbalance is both a cause of diseases,which can further exacerbate disease progression,and a consequence of diseases.This highlights the impact of the pathological state of stomach Qi on disease characteristics,transmission and prognosis,underscoring the significance of ZHANG Zhongjing's academic thought on"preserving stomach Qi."[Conclusion]Taking the theory of gut microecology as an entry point,this study explores the scientific connotation of stomach Qi theory,aligning it with modern biological understanding.The gut microbiota and gut microecology theory can serve as a bridge between Zhongjing's academic thought of"preserving stomach Qi"and modern medicine,providing theoretical basis and new research ideas for enhancing the clinical efficacy and interpretability of classical prescriptions.

Objective:To investigate the correlation between vitamin D levels and thyroid hormone sensitivity in euthyroid individuals.Methods:This cross-sectional study included 5 894 euthyroid individuals who underwent health examinations at the Department of Health Management, Peking Union Medical College Hospital, from December 2023 to February 2024. Thyroid feedback quantile-based index (TFQI), TSH index (TSHI), thyrotroph thyroxine resistance index (TT4RI), and the ratio of free triiodothyronine (FT3)/free thyroxine (FT4) were calculated to assess thyroid hormone sensitivity. Participants were categorized into vitamin D deficiency and non-deficiency groups based on serum 25(OH)D levels. The differences in thyroid hormone sensitivity indices and other clinical characteristics between the two groups were compared. Multivariate logistic regression models were used to analyze the association between vitamin D levels and thyroid hormone sensitivity, and stratified analysis was conducted to explore the association in different genders.Results:Among the study participants, 4 731 (80.3%) had vitamin D deficiency. Compared with the non-deficient group, the deficient group had a lower TFQI (-0.03(-0.31, 0.23) and -0.01(-0.28, 0.27)) ( Z=-2.130, P=0.033) and a higher FT3/FT4 ratio ((0.36±0.04) and (0.35±0.04)) ( t=-4.592, P<0.001). After adjusting for confounding factors including gender and age, the risk of impaired central and peripheral thyroid hormone sensitivity significantly increased in the non-deficient group (TFQI ( OR=1.16, 95% CI: 1.01-1.34); FT3/FT4 ( OR=1.23, 95% CI: 1.05-1.45)) (all, P<0.05). Conclusion:In euthyroid individuals, people with higher vitamin D levels have a higher risk of impaired thyroid hormone sensitivity.

Objective:To construct a sizeable naive human Fab phage display antibody library to screen high-affinity specific antibodies in vitro. Methods:Total RNA was extracted from peripheral blood mononuclear cells (PBMCs) of 126 healthy individuals, subsequently reverse-transcribed into cDNA, and used as a template. PCR amplification was performed to obtain the V H from IgG, IgM and light chain κ, λ, separately, with the initial PCR products serving as templates for a second round of PCR. Overlap extension PCR was employed to generate fragments of the κ and λ light chains. These fragments were ligated with the phage vector pNC3, which harbors the variable region 1 of the heavy chain, to construct a recombinant phage plasmid. This plasmid was then electroporated into competent Escherichia Coli TG1 cells to establish a naive human Fab phage display antibody library. One hundred clones were randomly selected for identification and sequencing, and antibody gene polymorphisms were analyzed using the IMGT database and MAFFT software. Recombinant α-hemolysin from Staphylococcus aureus was utilized to screen Fab antibody fragments through biopanning of the antibody library, followed by random selection of phage ELISA-identified clones. The positive clones (antigen A450∶blank control A450≥2.1) were sequenced. Results:Two large naive Fab phage display antibody libraries were successfully constructed, in which the capacity of κ and λ chain antibody libraries were 1.25×10 11 and 1.54×10 11, respectively. The titers for two antibody libraries were 6.04×10 13 CFU/ml and 3.50×10 13 CFU/ml. The positive transformation insertion rates for κ and λ chain antibody libraries were 96% (96/100) and 100% (100/100), respectively. Sequence analysis revealed that all antibody sequences were unique. The amino acid sequences in the skeletal region were relatively conserved. In contrast, significant variations in the length of the complementarity determining region (CDR) were found, and the diversity of amino acid sequence of the complementary determining region was high, especially the CDR3. Analysis using the IMGT database indicated that the sequences exhibited a broad distribution across variable-diversity-joining gene families. After six rounds of panning, specific phage antibodies enrichment targeting α-hemolysin were achieved. A total of 142 monoclonal antibodies were sequenced, yielding 8 distinct Fab antibody sequences. Conclusion:This study successfully constructed two naive human Fab phage display antibody libraries with large capacity and good diversity, which can be used for screening human antibodies for serum epidemiology.

Objective To analyze risk factors of acute cardio-cerebrovascular accidents in elderly patients with lower extremity fracture,and to construct a risk prediction diagram model.Methods A retrospective analysis was conducted on the clinical data of 510 elderly patients with lower extremity fractures,and the patients were divided into the occurrence group and the non-occurrence group based on the occurrence of acute cardiovascular and cerebrovascular accidents during the postoperative hospitalization.Univariate and multivariate Logistic regression analysis was used to analyze risk factors affecting acute cardiovascular and cerebrovascular accidents in elderly patients with lower extremity fracture,and the risk prediction model was constructed and verified.Results A total of 52 cases of acute cardio-cerebrovascular accidents occurred during hospitalization in 510 patients(10.20%).Age,ASA grade Ⅲ ratio,preoperative concurrent cerebrovascular disease,postoperative pneumonia ratio and postoperative bed time≥5 days ratio were higher in the occurrence group than those in the non-occurrence group(P＜0.05).Multivariate Logistic regression analysis showed that age,ASA grade Ⅲ,preoperative concurrent cardiovascular and cerebrovascular disease,and postoperative pneumonia were risk factors for acute cardio-cerebrovascular accidents in elderly patients with lower limb fracture(P＜0.05).Multivariate Logistic regression analysis was used to screen risk factors as predictive variables to build a risk early warning histogram model for acute cardio-cerebrovascular accidents.The total score ranged from 103 to 168 points,corresponding to a risk range of 0.1 to 0.9 points.Receiver operating characteristic curve(ROC)curve results showed that the area under the curve(AUC)of this model for predicting acute cardiovascular and cerebrovascular accidents was 0.980(95%CI:0.964-1.000),and discrete choice approach(DCA)showed that when the risk threshold was 0.2-0.6,the prediction model of this column graph had a good clinical advantage.Conclusion The risk diagram model constructed based on risk factors has good predictive value for the occurrence of acute cardio-cerebrovascular accidents after lower extremity fracture in elderly patients.

Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.

Objective:To construct a sizeable naive human Fab phage display antibody library to screen high-affinity specific antibodies in vitro. Methods:Total RNA was extracted from peripheral blood mononuclear cells (PBMCs) of 126 healthy individuals, subsequently reverse-transcribed into cDNA, and used as a template. PCR amplification was performed to obtain the V H from IgG, IgM and light chain κ, λ, separately, with the initial PCR products serving as templates for a second round of PCR. Overlap extension PCR was employed to generate fragments of the κ and λ light chains. These fragments were ligated with the phage vector pNC3, which harbors the variable region 1 of the heavy chain, to construct a recombinant phage plasmid. This plasmid was then electroporated into competent Escherichia Coli TG1 cells to establish a naive human Fab phage display antibody library. One hundred clones were randomly selected for identification and sequencing, and antibody gene polymorphisms were analyzed using the IMGT database and MAFFT software. Recombinant α-hemolysin from Staphylococcus aureus was utilized to screen Fab antibody fragments through biopanning of the antibody library, followed by random selection of phage ELISA-identified clones. The positive clones (antigen A450∶blank control A450≥2.1) were sequenced. Results:Two large naive Fab phage display antibody libraries were successfully constructed, in which the capacity of κ and λ chain antibody libraries were 1.25×10 11 and 1.54×10 11, respectively. The titers for two antibody libraries were 6.04×10 13 CFU/ml and 3.50×10 13 CFU/ml. The positive transformation insertion rates for κ and λ chain antibody libraries were 96% (96/100) and 100% (100/100), respectively. Sequence analysis revealed that all antibody sequences were unique. The amino acid sequences in the skeletal region were relatively conserved. In contrast, significant variations in the length of the complementarity determining region (CDR) were found, and the diversity of amino acid sequence of the complementary determining region was high, especially the CDR3. Analysis using the IMGT database indicated that the sequences exhibited a broad distribution across variable-diversity-joining gene families. After six rounds of panning, specific phage antibodies enrichment targeting α-hemolysin were achieved. A total of 142 monoclonal antibodies were sequenced, yielding 8 distinct Fab antibody sequences. Conclusion:This study successfully constructed two naive human Fab phage display antibody libraries with large capacity and good diversity, which can be used for screening human antibodies for serum epidemiology.

Aim To investigates whether sphingosine-1-phosphate(S1P)regulates the expression of mitochon-drial calcium uniporter(MCU)via the sphingosine-1-phosphate receptor/proline-rich tyrosine kinase 2(S1PR/Pyk2)sig-naling pathway,thereby reducing oxidative stress-induced mitochondrial damage and inhibiting mitochondria-related apopto-sis.Methods Human umbilical vein endothelial cells(HUVEC)were subjected to oxidative damage using hydrogen peroxide(H2O2)as a model.Different concentrations of S1P were applied to the oxidative damaged HUVEC.Addi-tionally,the S1PR1 agonist SEW2871,the S1PR1 inhibitor W146,and the Pyk2 inhibitor PF-562271 were used to explore the specific mechanism of S1P action.Results S1P treatment significantly alleviated oxidative damage in HUVEC and was accompanied by an increase in S1PR1 expression(P<0.05),while S1PR3 expression remained unchanged.Mean-while,the expression levels of Pyk2 and MCU decreased(P<0.05).SEW2871 further reduced mitochondrial damage,whereas W146 exacerbated it(P<0.05).Furthermore,the application of the Pyk2 inhibitor PF-562271 also reduced H2O2-induced mitochondrial damage(P<0.05),further confirming the role of Pyk2 in this process.Conclusion S1P reduces H2O2-induced mitochondrial damage and inhibits mitochondria-related apoptosis in HUVEC by suppressing Pyk2 expression via S1PR1.

Objective To investigate the effects of high-frequency repetitive transcranial magnetic stimulation(HF-rTMS)applied to the supplementary motor area(SMA)or primary motor cortex(M1)on upper limb function in stroke patients in terms of motor sequence learning.Methods From April,2024 to February,2025,60 inpatients were recruited from the First Affiliated Hospital with Nan-jing Medical University.They were randomly assigned into the control group,SMA group and M1 group,with 20 patients in each group.All the groups received medication and conventional rehabilitation.On this basis,SMA group underwent HF-rTMS on the affected side's SMA,while M1 group received HF-rTMS on the affected side's M1 for two weeks.All the groups were measured with motor evoked potentials(MEP),the serial reaction time(RT)task,Fugl-Meyer Assessment-Upper Extremities(FMA-UE)and modified Barthel Index(MBI)before and after intervention.Results The SMA and M1 groups dropped one case respectively.MEP elicitation rate of the affected side's increased in SMA and M1 groups(P<0.05),and it was better than that in the control group(χ2>4.792,P<0.05).The intra-group effects of RTsequential sequence,FMA-UE and MBI scores were significant(|F|>81.546,P<0.05).The inter-group effects of RTrandom sequence,RTsequential sequence,?RT,and MBI scores were significant(F>3.228,P<0.05).The in-teractive effects of RTrandom sequence,RTsequential sequence,?RT,FMA-UE and MBI scores were significant(|F|>3.520,P>0.05).After intervention,RTsequential sequence,?RT,FMA-UE and MBI scores improved(P<0.05).RTrandom sequence was lower in SMA group than in the control group(P<0.017),RTsequential sequence,?RT,FMA-UE and MBI scores im-proved more in SMA and M1 groups than in the control group(P<0.05),but no significant difference was found between the SMA group and the M1 group(P>0.05).Conclusion HF-rTMS applied to the affected SMA or M1 can activate motor sequence learning and promote the recov-ery of upper limb function in stroke patients.

Purpose To investigate the functional connectivity(FC)pattern between the bilateral lower limb sensorimotor cortex(LSM)and the whole brain in type 2 diabetic peripheral neuropathy(DPN).Materials and Methods A total of 44 DPN patients and 43 healthy controls admitted to Shaanxi Provincial People's Hospital from February 2021 to December 2022 were enrolled prospectively and underwent neuropsychological assessment and resting-state fMRI scans.Using bilateral LSM as the regions of interest,the differences of bilateral LSM and whole brain FC between DPN patients and healthy controls were compared.FC in different brain areas were extracted and correlated with clinical/neuropsychological scores.Results Compared with healthy controls,DPN patients had reduced FC of the LSM with the right cerebellar lobule Ⅵ,the right lateral occipitotemporal cortex,the bilateral rostral prefrontal cortex and the bilateral anterior cingulate gyrus.The FC between LSM and right cerebellar Ⅵ in DPN patients were significantly negatively correlated with fasting blood glucose(r=-0.490,P=0.001).The FC between LSM and bilateral anterior cingulate gyrus in DPN patients were significantly positively correlated with Montreal cognitive assessment scores(r=0.479,P=0.001).Conclusion Abnormal FC between LSM and multiple brain regions,suggesting that DPN may have extensive effects on brain regions that maintain motion and motor control function in type 2 diabetes mellitus patients.