1.Association between fibroblast growth factor 21 and chronic kidney disease in individuals with prediabetes:a prospective cohort study
Chulin HUANG ; Diaozhu LIN ; Lili YOU ; Wanting FENG ; Meng REN ; Li YAN ; Kan SUN
Journal of Chongqing Medical University 2025;50(11):1493-1499
Objective:To investigate the association between fibroblast growth factor 21(FGF21)and chronic kidney disease(CKD)in a prediabetic population by conducting a 4-year prospective cohort study among community-dwelling residents aged≥40 years in Guangzhou,China.Methods:A total of 1505 subjects who met the criteria for prediabetes and had complete baseline data were col-lected from the 2012 REACTION cohort,and they were followed up for 4 years to observe newly-onset CKD and the changes in urinary albumin-to-creatinine ratio(UACR)and estimated glomerular filtration rate(eGFR).Results:Among the 1 505 subjects with predia-betes,142 reached the diagnostic criteria for CKD during follow-up,yielding an overall incidence rate of 9.43%(95%CI=7.895%-10.902%).According to baseline serum FGF21 level,the subjects were divided into Q1-Q4 groups,with the lowest level of FGF21 in the Q1 group,and the Q4 group had a significantly higher eGFR than the other groups(P<0.05).After a mean follow-up time of 4 years,UACR was increased by 0.87 mg/g(P<0.001)and eGFR was reduced by 4.8 mL/(min·1.73 m2)(P<0.001).After stratification by FGF21 quartiles,there were differences in the declines of eGFR across groups,with the lowest degree of reduction in the Q2 group.In the multivariate regression model,the serum level of FGF21 was significantly negatively associated with the onset of CKD.When FGF21 was analyzed as a continuous variable in the multivariate lo-gistic regression analysis,FGF21 was still significantly negatively associated with the risk of CKD,which was consistent with the re-sults of the quartile-based analysis.However,restricted cubic spline curves showed an L-shaped non-linear relationship between FGF21 level and the risk of CKD,i.e.,the incidence rate of CKD de-creased with the increase in FGF21 level,but when FGF21 level reached a certain threshold,the risk of CKD no longer changed with FGF21.The linear regression analysis showed that FGF21 was positively associated with UACR and eGFR.Conclusion:In this pro-spective cohort study,FGF21 level might be potentially associated with the future risk of CKD among adults with prediabetes,while fur-ther studies are needed to clarify related mechanisms and clinical value.
2.Analysis of clinical characteristics and etiologies of hospitalized patients with spike-and-wave activation in sleep
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Applied Clinical Pediatrics 2025;40(6):426-433
Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.
3.Two cases of developmental and epileptic encephalopathy related to the EEF1A2 gene and a literature review
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Neurology 2025;58(4):404-413
Objective:To investigate the clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene. Methods:The clinical data and whole exome sequencing results of 2 patients who were diagnosed as developmental and epileptic encephalopathy related to the EEF1A2 gene in the Children′s Hospital, Capital Institute of Pediatrics in June 2016 and August 2018 were retrospectively analyzed. Relevant literatures were retrieved using " EEF1A2" and "epileptic encephalopathy" or "epilepsy" as key words in Online Mendelian Inheritance in Man, PubMed, CNKI and Wanfang databases (literatures searching from establishment of these databases to June 2024). The clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene were summarized based on literature reports and the data of these 2 patients. Results:Patient 1 was a 9 months old male infant. He presented with global developmental delay. He developed myoclonic seizures at 4 months old. Valproic acid, clonazepam, topiramate and vagus nerve stimulation were all ineffective. Both of his hands had transverse palmar crease. The de novo c.364G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Patient 2 was a 2 years and 2 months old boy. He presented with global developmental delay. Myoclonic seizures occurred when he was 2 years and 3 months old, and various anti-epileptic drugs were ineffective. He had left eye esotropia and low muscle tone in the extremities. He died at the age of 4. The de novo c.208G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Eight literatures on developmental and epileptic encephalopathy related to the EEF1A2 gene (all in English) were retrieved, reporting 28 cases (totally 30 patients, including 2 cases in this study). The main clinical manifestations were psychomotor developmental delay (30/30, 100.0%), facial dysmorphism (15/30, 50.0%), refractory epilepsy (14/26, 53.8%), myoclonic seizures (19/26, 73.1%), and movement disorders (8/16). A total of 15 mutation sites in the EEF1A2 gene were reported, all of which were missense mutations. Conclusions:Developmental and epileptic encephalopathy related to the EEF1A2 gene is primarily characterized by delayed psychomotor development, distinctive facial features, drug-resistant epilepsy, myoclonic seizures, and movement disorders. Variants in the EEF1A2 gene are predominantly missense mutations, and identifying these variants plays a crucial role in accurate diagnosis of the disease.
4.The effectiveness of applying different tip positions of midline catheters:a Meta-analysis
Wanting SHENG ; Rui WANG ; Yuxiao ZHAO ; Pengfei QI ; Silong GAO ; Juan FENG ; Bohan LÜ ; Qun NIU ; Gang WANG
Chinese Journal of Nursing 2025;60(8):990-997
Objective To evaluate the effectiveness of different tip positions applied to midline catheters(MC)and provide evidence-based evidence for venous catheter tip positioning in clinical practice.Methods Computerized searches of PubMed,Web of Science,Embase,Cochrane Library,CINAHL,CNKI,Wanfang Database,VIP,and CBM for studies on the effectiveness of applying MC with different tip positions were performed from the time of database construction to July 2024.Meta-analysis was performed using Rev Man 5.3 software after 2 investigators independently screened the studies,extracted the information and evaluated the quality of the included studies.Results A total of 9 studies with 2 302 hospitalized patients were included.The quality evaluation results of the included studies are all B-level.Meta-analysis showed that when the tip of the MC was located in the subclavian vein compared with the tip of the MC in the axillary vein,the rate of total catheter-related complications,phlebitis,blood leakage,infiltration,catheter occlusion,catheter dislocation,and catheter-associated thrombosis were lower,with a statistically significant difference(P<0.05).When the tip of the MC was located in the subclavian vein compared with the tip of the MC in the axillary vein,the catheter retention time was longer,with a statistically significant difference(P=0.007).The descriptive analysis showed a lower rate of extubation due to complications when the tip of the MC was located in the subclavian vein compared with when the tip was located in the axillary vein(P<0.05).Conclusion When the tip of the MC is located in the subclavian vein compared to when it is located in the axillary vein,the incidence of total catheter-related complications,phlebitis,blood leakage,infiltration,catheter occlusion,catheter dislocation,catheter-associated thrombosis,and the rate of catheter extractions due to complications were lower,and the catheter was left in place for a longer period of time.Due to the limitations of the quantity and quality of the included studies,more large-sample,high-quality studies are needed to further validate the effectiveness of different tip positions of MC.
5.The effectiveness of applying different tip positions of midline catheters:a Meta-analysis
Wanting SHENG ; Rui WANG ; Yuxiao ZHAO ; Pengfei QI ; Silong GAO ; Juan FENG ; Bohan LÜ ; Qun NIU ; Gang WANG
Chinese Journal of Nursing 2025;60(8):990-997
Objective To evaluate the effectiveness of different tip positions applied to midline catheters(MC)and provide evidence-based evidence for venous catheter tip positioning in clinical practice.Methods Computerized searches of PubMed,Web of Science,Embase,Cochrane Library,CINAHL,CNKI,Wanfang Database,VIP,and CBM for studies on the effectiveness of applying MC with different tip positions were performed from the time of database construction to July 2024.Meta-analysis was performed using Rev Man 5.3 software after 2 investigators independently screened the studies,extracted the information and evaluated the quality of the included studies.Results A total of 9 studies with 2 302 hospitalized patients were included.The quality evaluation results of the included studies are all B-level.Meta-analysis showed that when the tip of the MC was located in the subclavian vein compared with the tip of the MC in the axillary vein,the rate of total catheter-related complications,phlebitis,blood leakage,infiltration,catheter occlusion,catheter dislocation,and catheter-associated thrombosis were lower,with a statistically significant difference(P<0.05).When the tip of the MC was located in the subclavian vein compared with the tip of the MC in the axillary vein,the catheter retention time was longer,with a statistically significant difference(P=0.007).The descriptive analysis showed a lower rate of extubation due to complications when the tip of the MC was located in the subclavian vein compared with when the tip was located in the axillary vein(P<0.05).Conclusion When the tip of the MC is located in the subclavian vein compared to when it is located in the axillary vein,the incidence of total catheter-related complications,phlebitis,blood leakage,infiltration,catheter occlusion,catheter dislocation,catheter-associated thrombosis,and the rate of catheter extractions due to complications were lower,and the catheter was left in place for a longer period of time.Due to the limitations of the quantity and quality of the included studies,more large-sample,high-quality studies are needed to further validate the effectiveness of different tip positions of MC.
6.Analysis of clinical characteristics and etiologies of hospitalized patients with spike-and-wave activation in sleep
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Applied Clinical Pediatrics 2025;40(6):426-433
Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.
7.Two cases of developmental and epileptic encephalopathy related to the EEF1A2 gene and a literature review
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Neurology 2025;58(4):404-413
Objective:To investigate the clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene. Methods:The clinical data and whole exome sequencing results of 2 patients who were diagnosed as developmental and epileptic encephalopathy related to the EEF1A2 gene in the Children′s Hospital, Capital Institute of Pediatrics in June 2016 and August 2018 were retrospectively analyzed. Relevant literatures were retrieved using " EEF1A2" and "epileptic encephalopathy" or "epilepsy" as key words in Online Mendelian Inheritance in Man, PubMed, CNKI and Wanfang databases (literatures searching from establishment of these databases to June 2024). The clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene were summarized based on literature reports and the data of these 2 patients. Results:Patient 1 was a 9 months old male infant. He presented with global developmental delay. He developed myoclonic seizures at 4 months old. Valproic acid, clonazepam, topiramate and vagus nerve stimulation were all ineffective. Both of his hands had transverse palmar crease. The de novo c.364G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Patient 2 was a 2 years and 2 months old boy. He presented with global developmental delay. Myoclonic seizures occurred when he was 2 years and 3 months old, and various anti-epileptic drugs were ineffective. He had left eye esotropia and low muscle tone in the extremities. He died at the age of 4. The de novo c.208G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Eight literatures on developmental and epileptic encephalopathy related to the EEF1A2 gene (all in English) were retrieved, reporting 28 cases (totally 30 patients, including 2 cases in this study). The main clinical manifestations were psychomotor developmental delay (30/30, 100.0%), facial dysmorphism (15/30, 50.0%), refractory epilepsy (14/26, 53.8%), myoclonic seizures (19/26, 73.1%), and movement disorders (8/16). A total of 15 mutation sites in the EEF1A2 gene were reported, all of which were missense mutations. Conclusions:Developmental and epileptic encephalopathy related to the EEF1A2 gene is primarily characterized by delayed psychomotor development, distinctive facial features, drug-resistant epilepsy, myoclonic seizures, and movement disorders. Variants in the EEF1A2 gene are predominantly missense mutations, and identifying these variants plays a crucial role in accurate diagnosis of the disease.
8.BCMA chimeric antigen receptor T cells therapy re-treatment of a patient with recurrent/refractory IgD multiple myeloma: A case report and literature review
Sinan GU ; Wanting QIANG ; Jing LU ; Zhongyuan FENG ; Juan DU
Chinese Journal of Hematology 2024;45(10):951-955
Multiple myeloma (MM) is a malignant plasma cell disease that currently cannot be cured. Several new drugs have continuously been introduced in the recent years. New drugs targeting B-cell maturation antigen (BCMA) have greatly improved the efficacy and prognosis of MM compared with traditional treatments. This article reports the case of an IgD type relapsed and refractory MM patient with poor efficacy of BCMA×CD3 bispecific antibody. The patient achieved deep remission after receiving BCMA-targeted CAR-T cell therapy after initial seven lines of treatment. Literature review was also conducted to improve the clinical physicians’ understanding of BCMA target therapy for relapsed and refractory MM patients.
9.Expert consensus on the management of auditory hallucinations in inpatients with mental illness
Yanhua QU ; Dongmei XU ; Jing SHAO ; Shan ZHANG ; Mengqian ZHANG ; Jianing GU ; Xiaolu YE ; Feifei LI ; Wei LUO ; Wanting LI ; Li WANG ; Fangzhu SHI ; Xiaoyu FENG ; Qian ZHOU ; Juan ZHAO
Chinese Journal of Practical Nursing 2024;40(14):1080-1090
Objective:To standardize the management of auditory hallucination symptoms in inpatients with mental illness and develop an expert consensus on the management of auditory hallucinations in hospitalized psychiatric patients.Methods:From March 2023 to July 2023, the Mental Health Committee of the Chinese Nursing Association focused on the key issues in the management of auditory hallucinations symptoms in inpatients with mental illness, based on clinical practice, using literature analysis combined with the work experience of mental health experts, and formed the first draft of the expert consensus on the management of auditory hallucinations in inpatients with mental illness (hereinafter referred to as the consensus). Through 3 rounds of expert consultation and 3 rounds of expert demonstration meeting, the draft was adjusted, revised, and improved.Results:37 experts were included in the Delphi expert consultation, 1 male and 36 females with 39-67(51.48 ± 6.61) years old. The positive coefficients of experts in 3 rounds of Delphi expert consultations were all 100%, and the degrees of expert authority were 0.924, 0.938 and 0.949, respectively. The average importance value of each item was higher than 4.00, the variation coefficient of each item was less than 0.25. The Kendall harmony coefficient of the experts were 0.179, 0.195 and 0.198, respectively (all P<0.05). There were 15, 12, 12 experts in the first, seeond, third rounds of expert demonstration meeting. Finally, a consensus was reached on the recommendation of 4 parts, included auditory hallucination assessment, management format, symptom management implementation, and precautions. Conclusions:The consensus covers all parts of the management of auditory hallucination symptoms in hospitalized patients with mental disorders, which is practical and scientific. It is helpful to guide mental health professionals to standardize the management of auditory hallucination symptoms, improve the quality of nursing and ensure the safety of patients.
10.Construction of a Predictive Model for Diabetes Mellitus Type 2 in Middle-Aged and Elderly Populations Based on the Medical Checkup Data of National Basic Public Health Service
Huifang YANG ; Lu YUAN ; Jiefeng WU ; Xingyue LI ; Lu LONG ; Yilin TENG ; Wanting FENG ; Liang LYU ; Bin XU ; Tianpei MA ; Jinyu XIAO ; Dingzi ZHOU ; Jiayuan LI
Journal of Sichuan University (Medical Sciences) 2024;55(3):662-670
Objective To establish a universally applicable logistic risk prediction model for diabetes mellitus type 2(T2DM)in the middle-aged and elderly populations based on the results of a Meta-analysis,and to validate and confirm the efficacy of the model using the follow-up data of medical check-ups of National Basic Public Health Service.Methods Cohort studies evaluating T2DM risks were identified in Chinese and English databases.The logistic model utilized Meta-combined effect values such as the odds ratio(OR)to derive β,the partial regression coefficient,of the logistic model.The Meta-combined incidence rate of T2DM was used to obtain the parameter α of the logistic model.Validation of the predictive performance of the model was conducted with the follow-up data of medical checkups of National Basic Public Health Service.The follow-up data came from a community health center in Chengdu and were collected between 2017 and 2022 from 7 602 individuals who did not have T2DM at their baseline medical checkups done at the community health center.This community health center was located in an urban-rural fringe area with a large population of middle-aged and elderly people.Results A total of 40 cohort studies were included and 10 items covered in the medical checkups of National Basic Public Health Service were identified in the Meta-analysis as statistically significant risk factors for T2DM,including age,central obesity,smoking,physical inactivity,impaired fasting glucose,a reduced level of high-density lipoprotein cholesterol(HDL-C),hypertension,body mass index(BMI),triglyceride glucose(TYG)index,and a family history of diabetes,with the OR values and 95% confidence interval(CI)being 1.04(1.03,1.05),1.55(1.29,1.88),1.36(1.11,1.66),1.26(1.07,1.49),3.93(2.94,5.24),1.14(1.06,1.23),1.47(1.34,1.61),1.11(1.05,1.18),2.15(1.75,2.62),and 1.66(1.55,1.78),respectively,and the combined β values being 0.039,0.438,0.307,0.231,1.369,0.131,0.385,0.104,0.765,and 0.507,respectively.A total of 37 studies reported the incidence rate,with the combined incidence being 0.08(0.07,0.09)and the parameter α being-2.442 for the logistic model.The logistic risk prediction model constructed based on Meta-analysis was externally validated with the data of 7 602 individuals who had medical checkups and were followed up for at least once.External validation results showed that the predictive model had an area under curve(AUC)of 0.794(0.771,0.816),accuracy of 74.5%,sensitivity of 71.0%,and specificity of 74.7% in the 7 602 individuals.Conclusion The T2DM risk prediction model based on Meta-analysis has good predictive performance and can be used as a practical tool for T2DM risk prediction in middle-aged and elderly populations.

Result Analysis
Print
Save
E-mail