ObjectiveTo observe the effect of Qishao capsules on renal injury in db/db mice with diabetic kidney disease （DKD），and explore its mechanism of protecting the kidney by inhibiting podocyte apoptosis. Methodsdb/m mice （7 mice） were used as the normal group，and db/db mice （35 mice） were randomly divided into a model group，a dapagliflozin group （0.001 g·kg^-1·d^-1），and low-，medium-，and high-dose groups of Qishao capsules （0.341 3，0.682 5，and 1.365 g·kg^-1·d^-1，respectively）. Drug intervention lasted for 8 consecutive weeks. After sampling，the serum renal function indicators ［creatinine（SCr），and urea nitrogen（BUN）］，fasting blood glucose （FBG），24 h urinary protein quantification （24 h-UTP）， and other indicators of the mice were measured. The pathological tissue morphology of the kidney was observed by periodic acid-silver methenamine （PASM） and Masson's trichrome （Masson） staining. Immunohistochemical detection of cysteine-dependent aspartate-specific protease （Caspase）-3 and B-cell lymphoma 2 （Bcl-2） was performed. Western blot was used to detect the protein expression of Caspase-8，Caspase-7，Caspase-3， and other molecules. Terminal deoxynucleotidyl transferase dUTP nick End labeling （TUNEL） staining was used to observe apoptosis in renal tissue. Immunofluorescence staining of Wilms tumor suppressor gene-1 （WT-1） was used to observe podocyte injury. Real-time polymerase chain reaction （Real-time PCR） was employed to detect Caspase-8 and Caspase-3 mRNA expression in the kidneys of experimental mice. Data analysis was conducted using statistical software GraphPad Prism 10. ResultsCompared with the normal group，the model group showed significantly increased 24 h-UTP，SCr，BUN，and FBG （P<0.01）. Additionally， PASM staining of renal tissue showed increased glycogen deposition，glomerular hypertrophy，and thickening of the basement membrane. Masson staining showed collagen fiber proliferation in renal tissue. Transmission electron microscopy showed thickening of the renal tissue basement membrane and fusion or loss of foot processes in the model group. The immunohistochemical results showed that Caspase-3 in the kidneys of the mice in the model group significantly increased （P<0.01），while the Bcl-2 protein expression level decreased significantly （P<0.01）. The number of TUNEL positive cells in renal tissue significantly increased （P<0.01）. The positive expression of WT-1 in podocytes was significantly reduced （P<0.01）. Western blot analysis showed significant upregulation of Caspase-8，Caspase-7，and Caspase-3 protein expression in renal tissue （P<0.01）. The mRNA expression levels of Caspase-8 and Caspase-3 in the kidneys increased significantly （P<0.01）. Compared with the model group，the Qishao capsules groups can significantly reduce the levels of 24 h-UTP，SCr，BUN，and FBG （P<0.01）. The pathological damage of renal tissue and podocyte injury were improved to some extent. Immunohistochemistry in the kidney showed a significant decrease in Caspase-3 （P<0.01） and a significant increase in Bcl-2 protein expression level （P<0.01）. Additionally， there were a significant decrease in the number of TUNEL positive cells in renal tissue （P<0.01），a significant increase in WT-1 positive expression in podocytes （P<0.01），marked downregulation of Caspase-8，Caspase-7，and Caspase-3 protein expression in renal tissue （P<0.05，P<0.01），and a significant decrease in Caspase-8 and Caspase-3 mRNA expression levels （P<0.01）. ConclusionQishao capsules can inhibit podocyte apoptosis by regulating the expression of Caspase-8，Caspase-7， and Caspase-3，thereby improving the diabetic renal injury in db/db mice.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo evaluate the impact of yang-reinforcing and blood-activating therapy on the long-term prognosis for patients with dilated cardiomyopathy （DCM） of yang deficiency and blood stasis syndrome. MethodsA retrospective cohort study was conducted involving 371 DCM patients with yang deficiency and blood stasis syndrome. The yang-reinforcing and blood-activating therapy was defined as the exposure factor. Patients were categorized into exposure group （186 cases） and non-exposure group （185 cases） according to whether they received yang-reinforcing and blood-activating therapy combined with conventional western medicine for 6 months or longer. The follow-up period was set at 48 months， and the Kaplan-Meier survival analysis was used to assess the cumulative incidence of major adverse cardiovascular events （MACE） in both groups. Cox regression analysis was used to explore the impact of yang-reinforcing and blood-activating therapy on the risk of MACE， and subgroup analysis was performed. Changes in traditional Chinese medicine （TCM） syndrome score， left ventricular ejection fraction （LVEF）， left ventricular fractional shortening （LVFS）， left ventricular end-diastolic diameter （LVEDD）， and Minnesota Living with Heart Failure Questionnaire （MLHFQ） score were compared between groups at the time of first combined use of yang-reinforcing and blood-activating therapy （before treatment） and 1 year after receiving the therapy （after treatment）. ResultsMACE occurred in 31 cases （16.67%） in the exposure group and 47 cases （25.41%） in the non-exposure group. The cumulative incidence of MACE in the exposure group was significantly lower than that in the non-exposure group ［HR=0.559， 95%CI（0.361，0.895）， P=0.014］. Cox regression analysis showed that yang-reinforcing and blood-activating therapy was an independent factor for reducing the risk of MACE in DCM patients ［HR=0.623， 95%CI（0.396，0.980）， P=0.041］， and consistent results were observed in different subgroups. Compared with pre-treatment， the exposure group showed decreased TCM syndrome score and MLHFQ score， reduced LVEDD， and increased LVEF and LVFS after treatment （P＜0.05）； in the non-exposure group， TCM syndrome score decreased， LVEF and LVFS increased， and LVEDD reduced after treatment （P＜0.05）. After treatment， the exposure group had higher LVEF and LVFS， smaller LVEDD， and lower TCM syndrome score and MLHFQ score compared with the non-exposure group （P＜0.05）. ConclusionCombining yang-reinforcing and blood-activating therapy with conventional western medicine can reduce the risk of MACE in DCM patients with yang deficiency and blood stasis syndrome， meanwhile improving their clinical symptoms， cardiac function， and quality of life.

Surgical treatment is one of the key approaches for non-small cell lung cancer (NSCLC). Regular postoperative follow-up is crucial for early detection and timely management of tumor recurrence, metastasis, or second primary tumors. A scientifically sound and reasonable follow-up strategy not only extends patient survival but also significantly improves quality of life, thereby enhancing overall prognosis. This consensus aims to build upon the previous version by incorporating the latest clinical research advancements and refining postoperative follow-up protocols for early-stage NSCLC patients based on different treatment modalities. It provides a scientific and practical reference for clinicians involved in the postoperative follow-up management of NSCLC. By optimizing follow-up strategies, this consensus seeks to promote the standardization and normalization of lung cancer diagnosis and treatment in China, helping more patients receive high-quality care and long-term management. Additionally, the release of this consensus is expected to provide insights for related research and clinical practice both domestically and internationally, driving continuous development and innovation in the field of postoperative management for NSCLC.

BACKGROUND:Various proteins,signaling pathways,and inflammatory mediators are involved in the pathophysiological process of osteoarthritis.The development of small molecule drugs targeting these proteins,signaling pathways,and inflammatory mediators can effectively delay the progression of osteoarthritis and ameliorate its clinical manifestations. OBJECTIVE:To review the research progress of small molecule drugs in the treatment of osteoarthritis based on the pathogenesis of osteoarthritis. METHODS:PubMed,CNKI,and WanFang databases were searched with English search terms"osteoarthritis,arthritis,osteoarthrosis,degenerative,arthritides,deformans,small molecule drugs,small molecule inhibitors,small molecule agents"and Chinese search terms"osteoarthritis,small molecule drugs,small molecule inhibitors."A total of 68 articles were included for review according to the inclusion and exclusion criteria. RESULTS AND CONCLUSION:(1)Currently,studies concerning the pathogenesis of osteoarthritis remain unclear.The occurrence and development of osteoarthritis are strongly associated with proteins,cytokines,and signal transduction pathways,so its therapeutic mechanism is relatively complex.Currently,targeting proteins,cytokines,and signal transduction pathways related to osteoarthritis with small molecule drugs has become a major research focus.(2)Small molecule drugs frequently possess visible intracellular or extracellular targets and efficacy,containing enhancing cartilage repair,resisting joint degradation,attenuating inflammation,and relieving pain.Other anti-osteoarthritis small molecule drugs have shown promise in promoting stem cell chondrogenic differentiation and cartilage matrix reconstruction.(3)At present,small molecule drugs targeting the pathophysiological process of osteoarthritis to delay the progression of osteoarthritis are still in the experimental stage,but most of these small molecule drugs have shown the expected results in the experimental process,and there are no relevant studies to illustrate the efficacy of small molecule drugs in the treatment of osteoarthritis.(4)Small molecule drugs for the treatment of osteoarthritis have reached the expected experimental results in the basic experimental stage.Numerous studies have exhibited that small molecule drugs can target the suppression of specific proteins,cytokines,and signal transduction pathways that cause osteoarthritis,so as to treat osteoarthritis.Nevertheless,its safety and effectiveness still need to be identified by further basic and clinical studies.This process needs to be investigated and studied by more scholars.(5)At present,many scholars in and outside China have made contributions to the treatment of osteoarthritis.Compared with traditional treatment methods,small molecule drugs reveal better efficacy and safety in the basic experimental stage,and it is expected to become an emerging method for the treatment of osteoarthritis in the future to rid patients of pain.

BACKGROUND:Treadmill training is one of the effective ways to promote the recovery of motor function after spinal cord injury.Treadmill training can promote neurogenesis,but the effect of different intensities of treadmill training on the activation of endogenous stem cells is still unclear. OBJECTIVE:To analyze the activation effect of different intensities of treadmill training on endogenous neural stem cells in the spinal cord of mice after spinal cord injury. METHODS:Fifty female C57BL/6J mice were divided into control group,spinal cord injury group,low-,moderate-,and high-intensity exercise groups with 10 mice in each group by random number table method.T10 segment spinal cord injury model was constructed by the clamp method in spinal cord injury group,low-,moderate-,and high-intensity exercise groups.On day 7 after spinal cord injury,mice in the low-,moderate-,and high-intensity exercise groups were respectively trained on the treadmill with corresponding intensity,3 times/d,10 min/times,6 times a week for 28 consecutive days.At 3,7,14,21,and 28 days after treadmill training,the hind limb motor function was evaluated by BMS score.At 28 days after treadmill training,the spinal cord tissue of the injured area was obtained,and the expression of epidermal growth factor receptor,glial fibrillary acidic protein,and 5-Ethynyl-2'-deoxyuridine(EdU),a proliferative marker,was detected.Hematoxylin-eosin staining was used to observe the morphology of spinal cord. RESULTS AND CONCLUSION:(1)The BMS score of mice in the spinal cord injury group was lower than that in the control group(P<0.05).With the extension of treadmill training time,the BMS scores of mice with spinal cord injury gradually increased,and the BMS scores of mice in moderate-intensity exercise group on days 14 and 21 after treadmill training were higher than those in spinal cord injury group and low-and high-intensity exercise groups(P<0.05).The BMS score of mice in moderate-and high-intensity exercise group was higher than that in spinal cord injury group and low-intensity exercise group at 28 days after treadmill training(P<0.05).(2)Compared with the control group,the proportion of epidermal growth factor receptor and EdU positive cells was increased in spinal cord injury group(P<0.05).Compared with spinal cord injury group,the proportion of epidermal growth factor receptor and EdU positive cells was increased in low-,moderate-,and high-intensity exercise groups(P<0.05),and the highest was found in moderate-intensity exercise group.Compared with control group,the proportion of glial fibrillary acidic protein positive cells was increased in spinal cord injury group(P<0.05).Compared with spinal cord injury group,the proportion of glial fibrillary acidic protein positive cells was lower in low-,moderate-,and high-intensity exercise groups(P<0.05),and the moderate-intensity exercise group was the lowest.(3)Hematoxylin-eosin staining showed that a large cavity was formed in the injured area of mice with spinal cord injury,and the cavity in the injured area of mice with spinal cord injury decreased after different intensities of treadmill training,and the decrease was most obvious in the moderate-intensity exercise group.(4)These results indicate that low-,moderate-,and high-intensity treadmill training can promote the recovery of motor function of mice with spinal cord injury by activating endogenous neural stem cells,and the effect of moderate-intensity exercise training is the most obvious.

Malignant tumors are one of the major diseases that endanger human life and health. Chinese medicine has unique advantages in clinical anti-tumor treatment. However， how to translate the anti-tumor effects of Chinese medicine into clinical practice is the core issue that must be addressed in the process of treating malignant tumors with traditional Chinese medicine （TCM）. Unlike modern chemical drugs， the compatibility application of Chinese medicine is the key factor that determines whether Chinese medicine can achieve optimal anti-tumor efficacy and realize the goal of "enhancing efficacy and reducing toxicity". The formulation structure based on this compatibility is the basic form for the safe， efficient， and rational clinical use of anti-tumor Chinese medicine， and it mainly includes three categories： herb pairs， tri-herbal combinations， and compound compatibility. Although herb pairs have the characteristics of a simple structure and strong targeting （enhancing efficacy and reducing toxicity）， they often have a single effect and cannot fully address the complex pathogenesis of tumors. As a result， herb pairs are rarely used alone in practice. Compared to herb pairs， tri-herbal combinations broaden the application scope of herbs in clinical treatment， but their therapeutic range remains limited. The traditional "sovereign， minister， assistant， and guide" compound prescription， which includes herb pairs and tri-herbal combinations， improves the efficacy of herbs in treating serious diseases， hypochondriasis， chronic diseases， and miscellaneous disorders. However， due to the limitations of its historical background， it has not been integrated with modern clinical practice and modern pharmacological research， which restricts the development of compound compatibility theory. With the emergence of modern medical technology， it has been combined with traditional compatibility theory of Chinese medicine to create an innovative modern compatibility theory. This includes the "aid medicine" theory derived from modern Chinese medicine pharmacology， which compensates for the inability of the "sovereign， minister， assistant， and guide" theory to accurately apply medicine. Additionally， the "state-targeted treatment based on syndrome differentiation" theory， developed from pharmacology and modern medicine， addresses the deficiency in disease cognition in the "sovereign， minister， assistant， and guide" theory. Under the guidance of these compatibility forms and theories， clinical anti-tumor Chinese medicine can exert its maximum anti-tumor efficacy， which is of great significance for the application of Chinese medicine in clinical tumor treatment.

Objective To investigate the effect of pneumoperitoneum pressure during robotic-assisted kidney transplantation (RAKT) on the function of the transplant kidney. Methods The data of 243 kidney transplant recipients were retrospectively analyzed and divided into open kidney transplantation (OKT) group (n=105) and RAKT group (n=138). The RAKT group was further divided into 13 mmHg group (n=67) and 7 mmHg group (n=71) based on pneumoperitoneum pressure. The donor information, recipient's preoperative general data, intraoperative data, and postoperative recovery of the three groups were compared. In the RAKT group, the renal artery, segmental artery, interlobar artery, and venous flow velocity of the transplant kidney were measured using laparoscopic ultrasound. Results There was a statistically significant difference in donor types among the groups (P<0.05), while other donor information and recipient's preoperative general data showed no statistically significant differences (all P>0.05). There were no statistically significant differences in serum creatinine and complications at 30 days and 1 year postoperatively among the groups (all P>0.05). The OKT group and 7 mmHg group had more intraoperative urine output than the 13 mmHg group. Both RAKT groups had less intraoperative blood loss and shorter hospital stays than the OKT group, and longer operation times than the OKT group (all P<0.05). There were no statistically significant differences in operation time, intraoperative blood loss, and hospital stay between the two RAKT groups (all P>0.05). The vascular flow velocity of the transplant kidney decreased at 13 mmHg compared to 7 mmHg pneumoperitoneum pressure, but the differences were not statistically significant (all P>0.05). Conclusions Controllable pneumoperitoneum pressure has a limited impact on the vascular flow velocity of the transplanted kidney. RAKT is a safe and effective surgical method under appropriate pneumoperitoneum pressure, and choosing a lower pneumoperitoneum pressure is more conducive to the early recovery of renal function postoperatively.

Objective: To understand the changing trends and related factors of knowledge, attitude and practice (KAP) regarding the three major infectious diseases (acquired immunodeficiency syndrome, tuberculosis, hepatitis B) among freshmen in Jiangsu from 2019 to 2022, so as to provide a reference basis for the health education of infectious diseases in schools. Methods: From 2019 to 2022, a total of 33 944 freshmen from 20 universities in Jiangsu Province were randomly selected for four consecutive years to investigate their KAP levels online through self designed questionnaires on three major infectious diseases. The multiple linear regression model was used to analyze the changing trends of students KAP levels of the three major infectious diseases, and to explore the influencing factors of KAP. Results: From 2019 to 2022, the knowledge scores(18.0±3.1,18.4±3.2,18.7±3.2,18.8±3.2), related to the three major infectious diseases showed an upward trend ( F=436.50, P <0.01), and the positive attitude reporting rates were 81.77%, 81.46%, 82.68% and 81.74%, respectively. The reporting rates of positive practice were 80.11%, 79.25%, 79.08 % and 79.04%, respectively. Multiple linear regression showed that school type, parental education level, mother s occupation, average income per person in family and living arrangements during high school all had an impact on the knowledge ( β = -1.510 -0.559), attitudes ( β =-0.043-0.065) and practice ( β =-0.028-0.027) of the three major infectious diseases ( P < 0.05 ). The family residence areas only affected the reporting rate of positive attitude scores ( β =0.002-0.065), and whether only children or not affected the reporting rate of positive practice scores ( β =0.009)( P <0.05). The knowledge score showed an upward trend ( β= 0.297, P <0.01), the positive attitude reporting rate showed no statistically significant change ( β=0.001, P =0.22), and the positive practice reporting rate showed a downward trend ( β=-0.005, P <0.01). Conclusions Freshman in Jiangsu Province from 2019 to 2022 have shown a separation in KAP scores regarding the three major infectious diseases. Targeted measures should be taken to improve their health practice level.

OBJECTIVE To investigate the effects and mechanism of asperuloside （Asp） on the pyroptosis of intestinal epithelial cells in rats with ulcerative colitis （UC）. METHODS The male SD rats were randomly divided into Control group， model group （UC group）， ASP low-dose and high-dose groups [Asp-L， Asp-H groups， Asp 35， 70 mg/（kg·d）]， ASP high-dose group+AMPK inhibitor Compound C group [Asp-H+Compound C group， Asp 70 mg/（kg·d）+Compound C 0.2 mg/（kg·d）]， with 12 rats in each group. Except for Control group， the other groups were injected with 50% ethanol （0.25 mL）+5% 2，4， 6- trinitrobenzene sulfonic acid solution （2 mL/kg） into the intestinal cavity to construct UC model. After modeling， the rats in each drug group were given corresponding drug solution by gavage or （and） tail vein injection， once a day， for 14 consecutive days. After the last administration， the weight of rats in each group was measured， and the length of their colons was measured； disease activity index （DAI） score and colonic mucosal damage index （CMDI） score were performed， and the serum levels of inflammatory factors （interleukin-18， -1β， -6） were detected. The pathological changes of the colon tissue were observed. The expressions of pyroptosis-related proteins [caspase-1， gasdermin D （GSDMD）] in colon tissue， and pathway-related proteins such as adenosine monophosphate-activated protein kinase （AMPK）， thioredoxin-interacting protein （TXNIP）， NOD-like receptor protein 3 （NLRP3） and apoptosis-associated speck-like protein containing a CARD （ASC） were all detected. RESULTS Compared with Control group， the colon tissue structure of rats in UC group was damaged， with obvious infiltration of inflammatory cells and edema. Their body weight， colon length and phosphorylation level of AMPK protein were significantly reduced or shortened； DAI and CMDI scores， serum levels of inflammatory factors， and the protein expressions of caspase-1， GSDMD， TXNIP， NLRP3 and ASC in colon tissue were increased or upregulated significantly （P＜0.05）. Compared with UC group， the pathological damage of colon tissue in rats was relieved in Asp-L and Asp-H groups， and all quantitative indicators were significantly improved （P＜0.05）； the improvement effect of Asp-H group was more significant （P＜0.05）. Compound C could significantly reverse the improvement effect of high-dose of Asp on the above indicators in UC rats （P＜0.05）. CONCLUSIONS Asp can improve inflammatory damage in colon tissue and inhibit pyroptosis of intestinal epithelial cells in UC rats， which is associated with the activation of AMPK and inhibition of TXNIP/NLRP3 signaling pathway.