Stroke is one of the leading causes of disability and mortality worldwide. Research into its mechanisms and the development of therapeutic strategies heavily rely on animal models that accurately replicate the pathological features of human disease. An ideal animal model for stroke should not only reproduce the neurological deficits and pathological changes observed in clinical patients but also demonstrate good reproducibility and translational value. This review focuses on the preparation and evaluation methods of ischemic stroke animal models. Firstly, it elaborates on the selection criteria, advantages, and disadvantages of experimental animals, including rodents (rats, mice) and non-rodents (non-human primates, miniature pigs, rabbits, zebrafish). Secondly, it provides a detailed overview of the modeling principles, key procedures, and application scopes for ischemic stroke models and hemorrhagic stroke models. Furthermore, the review summarizes advances in the applications of emerging technologies—including gene editing [e.g., clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) gene editing], multimodal imaging (e.g., two-photon microscopy, photoacoustic imaging), artificial intelligence, optogenetics, 3D bioprinting, organoid models, and multi-omics–in model optimization, precise assessment, and mechanistic investigation. Finally, based on a systematic analysis of relevant domestic and international literature from 2019 to 2024, this review discusses model selection strategies based on research objectives, a multidimensional evaluation system encompassing behavioral, imaging, and molecular pathological assessments, and envisions future directions involving technological integration to achieve model precision and individualization. This article aims to provide a comprehensive methodological reference to help researchers select appropriate animal models of stroke according to specific scientific questions.

Stroke is the leading cause of death and disability among adults in China， and its common complications include digestive system abnormalities， cognitive impairment， depression， stroke-associated pneumonia， and hemiplegia. The combination of traditional Chinese and Western medicine has great potential in treating post-stroke complications. Xinglou Chengqitang （XLCQT） is a representative prescription of alleviating the disease in the upper part by treating the lower part. It has definite therapeutic effect and high safety. Clinically， XLCQT is often used to treat stroke and its complications. However， the quantity and quality of clinical trials of XLCQT in treating post-stroke complications need to be improved. Additionally， since the basic research is weak， the material basis and multi-target mechanism for the efficacy of this prescription are unknown. This article reviews XLCQT in terms of the pharmacodynamic basis， medicinal properties， safety evaluation， and progress in clinical research and mechanisms in treating post-stroke complications. This article summarizes 22 key active ingredients of XLCQT in treating acute stroke complicated with syndrome of phlegm heat and fu-organ excess. Among these key active ingredients， resveratrol， kaempferol， luteolin， chrysoeriol， apigenin， （+）-catechin， and adenosine have good pharmacokinetic properties and high bioavailability. The mechanisms of XLCQT in treating post-stroke complications are complex， including inflammatory response， brain-gut axis， hypothalamic-pituitary-adrenal （HPA） axis， intestinal flora， neurotrophic factors， autophagy， oxidative stress， and free radical damage. This review helps to deeply understand the pharmacodynamic basis and mechanisms of XLCQT in treating post-stroke complications and provides a theoretical basis for the clinical application of XLCQT against post-stroke complications and the development of drugs.

ObjectiveTo investigate the potential mechanism of Danggui Buxuetang （DBT） in the treatment of vascular dementia （VAD）. MethodsSixty male SD rats were randomly assigned to the sham-operated group， model group， DBT low-， medium-， and high-dose groups， and the donepezil group. Except for the sham-operated group， rats in all other groups underwent bilateral common carotid artery ligation. After successful modeling， DBT was administered at doses of 9.2， 18.4， 36.8 g·kg^-1 for the low-， medium-， and high-dose groups， respectively， while the donepezil group received 3 mg·kg^-1 donepezil solution by gavage once daily. After 4 consecutive weeks of drug treatment， rats underwent the Morris water maze test， novel object recognition test， Nissl staining to observe hippocampal neurons， and immunofluorescence staining to detect the expression of neuronal nuclear protein （NeuN） in the hippocampus. Western blot was used to assess the expression of PTEN-induced kinase 1 （PINK1）， Parkin， microtubule-associated protein 1 light chain 3Ⅱ （LC3Ⅱ）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax）. Transmission electron microscopy was used to observe hippocampal neuronal ultrastructure. Real-time PCR was used to detect the expression of NADPH oxidase subunits p22^phox and p47^phox in hippocampal tissues. The levels of malondialdehyde （MDA）， glutathione （GSH）， superoxide dismutase （SOD）， and total antioxidant capacity were measured to evaluate oxidative stress levels. ResultsIn the Morris water maze test， escape latency changed significantly over time in all groups except the model group. Compared with the sham-operated group， the model group showed significantly prolonged escape latency （P<0.01）. Compared with the model group， rats in the DBT groups and the donepezil group exhibited significantly shorter escape latency （P<0.05， P<0.01）. The number of crossings over the original platform was significantly reduced in the model group compared with the sham-operated group （P<0.01）， whereas rats in the DBT and donepezil groups showed significantly increased platform crossings compared with the model group （P<0.05， P<0.01）. Compared with the sham-operated group， exploration time of new objects was significantly reduced in the model group （P<0.01）. Compared with the model group， exploration time of new objects increased significantly in the medium- and high-dose DBT groups and the donepezil group （P<0.05， P<0.01）， while no significant change was observed in the low-dose DBT group. Compared with the high-dose DBT group， rats in the donepezil group had significantly prolonged escape latency and reduced platform crossings and new-object exploration time （P<0.05）. Nissl staining showed decreased density of healthy neurons in the CA1 and CA3 regions of the hippocampus in the model group， with loss of Nissl bodies and nuclear atrophy or disappearance. In the high-dose DBT group， neuronal density in CA1 and CA3 increased， with neurons arranged closely and displaying normal morphology. Immunofluorescence showed that compared with the sham-operated group， the hippocampal NeuN⁺ cell count in the VAD model group was significantly decreased（P<0.01）， compared with the VAD model group， the hippocampal NeuN⁺ cell count in the high-dose DBT group was significantly increased（P<0.01）. Compared with the sham-operated group， the expression of PINK1， Parkin， LC3Ⅱ， and Bax proteins was significantly increased（P<0.01）， while the expression of Bcl-2 was significantly decreased in the VAD model group（P<0.01）. Compared with the VAD model group， the high-dose DBT group showed significantly decreased expression of PINK1， Parkin， LC3Ⅱ， and Bax proteins（P<0.01）and significantly upregulated Bcl-2 expression（P<0.01）. The medium-dose DBT group exhibited significantly reduced expression of Parkin， LC3Ⅱ， and Bax proteins（P<0.05，P<0.01） and significantly increased Bcl-2 expression（P<0.01）， while no statistically significant differences were observed in the low-dose DBT group. Transmission electron microscopy showed mitochondrial pyknosis， thickened cristae， increased electron density， and the presence of mitochondrial autophagy in the model group. In contrast， hippocampal neurons in the high-dose DBT group contained abundant mitochondria with intact morphology， clear cristae， and uniform matrix. Compared with the sham-operated group， total antioxidant capacity， SOD activity， and GSH levels were significantly decreased， while MDA levels were significantly increased in the model group （P<0.01）. Compared with the model group， total antioxidant capacity and antioxidant levels （SOD， GSH） increased significantly， and MDA decreased significantly in the medium- and high-dose DBT groups （P<0.01）， while no significant changes were observed in the low-dose DBT group. Compared with the sham-operated group， mRNA expression of p22^phox and p47^phox was significantly increased in the model group （P<0.01）. Compared with the model group， expression of p22^phox and p47^phox was significantly decreased in the DBT groups （P<0.05， P<0.01）. ConclusionDBT may exert neuroprotective effects by regulating PINK1/Parkin-mediated mitochondrial autophagy， thereby improving learning and memory abilities and treating VAD.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective: This study aimed to compare the long-term radiographic incidence of adjacent segment degeneration (ASD) following minimally invasive transforaminal lumbar interbody fusion (MIS-TLIF) versus open TLIF (O-TLIF) in a matched cohort, and to identify radiographic parameters associated with the development of kyphosis-type ASD. Methods: A retrospective matched-pair analysis was conducted involving 60 patients (30 MIS-TLIF and 30 O-TLIF) who underwent single-level TLIF between 2004 and 2009 and had a minimum follow-up of 8 years. Patients were matched for age (±3 years), sex, body mass index (±2 kg/m²), and operative level. Radiographic ASD was defined as greater than 50% disc-height loss, greater than 3 mm of listhesis, or greater than 10° of kyphotic change at the adjacent segment. Continuous variables were analyzed using independent-sample t-tests or Mann-Whitney U-tests, as appropriate, and categorical variables were analyzed using chi-square or Fisher exact tests, with statistical significance set at p<0.05. Results: The mean follow-up duration was 8.9±1.2 years. The MIS-TLIF group had a significantly shorter hospital stay than the O-TLIF group (3.4±1.7 days vs 6.0±2.3 days, p<0.001). Radiographic ASD occurred significantly less frequently in the MIS-TLIF group at 2 years (3.3% vs. 23.3%, p=0.023), but no significant difference was observed at ≥8 years of follow-up (43.3% vs. 50.0%, p=0.605). An increased Cobb angle at the superior adjacent level was significantly associated with kyphosis-type ASD (p=0.017). No demographic characteristics or preoperative magnetic resonance imaging parameters were found to predict ASD occurrence. Conclusion MIS-TLIF demonstrated an early radiographic advantage in reducing ASD compared with O-TLIF; however, this advantage diminished over time. Long-term ASD appears to be multifactorial, with sagittal imbalance playing a more prominent role in the progression of kyphosis-type ASD than the surgical approach itself.

Introduction: Hypertension is common in obesity and increases cardiovascular risk. Bariatric surgery improves metabolic health, but subgroup differences in blood pressure response remain unclear. This study examined 1-year changes in systolic blood pressure (SBP) and diastolic blood pressure (DBP) after bariatric surgery across sex, age group, and diabetes status. Methodology: This study included 32 obese adults undergoing bariatric surgery, with blood pressure measured at baseline, 6 and 12 months. Generalized estimating equation models were used to evaluate changes in SBP and DBP over time, adjusting for age, sex, surgery type, diabetes category, baseline body mass index, antihypertensive medication use, and baseline blood pressure. Interaction terms were tested to assess differences in blood pressure trajectories across subgroups. Results: Participants were predominantly female (67.4%), with a mean age of 36.9 ± 6.2 years and a mean body mass index of 40.7 ± 8.8 kg/m². Hypertension and diabetes were present in 40.6 and 31.3% of participants, respectively. There was a significant time effect for both SBP (p <0.001) and DBP (p = 0.004). At 12 months post-surgery, mean SBP decreased by 15 mmHg and DBP by 7.9 mmHg compared with baseline (both p <0.001). No significant interactions were observed between time and sex, diabetes category, or age category, indicating that blood pressure improvements were comparable across subgroups. Conclusion Bariatric surgery was associated with clinically meaningful reductions in both SBP and DBP, with similar improvement patterns observed across demographic and metabolic subgroups. These findings support the effectiveness of bariatric surgery as a strategy for blood pressure reduction and cardiovascular risk management in patients with obesity.
Blood Pressure ; Bariatric Surgery

To reduce the dependency on high-carbon-load chromatographic columns,a new method has been established for the determination of the content of docusate sodium using ion-pair high-performance liquid chromatography (IP-HPLC). Tetrapropylammonium chloride was used as the ion-pair reagent with a mobile phase, composition of acetonitrile:10 mmol/L tetrapropylammonium chloride solution = 66∶34, adjusting pH to 6.5 with 0.1% phosphoric acid solution,flow rate of 1.5 mL/min, detection wavelength of 214 nm,column temperature of 35 °C, and an injection volume of 25 μL,and quantified by an external standard method. The main peak of docusate sodium exhibited a tailing factor of 1.34. The method showed good linearity within the range of 0.02 mg/mL to 0.40 mg/mL, with a correlation coefficient (r) of 0.999 9. It also demonstrated good repeatability, with recovery ranging from 97.0% to 98.2% (n=6). The quantification limit was 3.31 μg/mL, and the detection limit was 2.76 μg/mL.In summary,the new method shows good durability, a wide linear range, and high sensitivity, it is suitable for the determination of docusate sodium.

OBJECTIVE To systematically evaluate the efficacy of dydrogesterone combined with estradiol valerate for the prevention of intrauterine adhesion （IUA） and prognosis improvement after induced abortion. METHODS Retrieved from CNKI， Wanfang Data， VIP， CBM， PubMed， Embase and the Cochrane Library， randomized controlled trial （RCT） about conventional treatment combined with dydrogesterone and estradiol valerate （trial group） versus conventional treatment （control group） for the prevention of IUA in patients after induced abortion were collected from the inception to Dec. 2024. After screening the literature， extracting data and evaluating the quality of literature， meta-analysis was performed using RevMan 5.4 software. RESULTS A total of 12 RCTs were included， involving 1 109 patients. Meta-analysis showed that the postoperative incidence of IUA [RR＝0.30， 95%CI （0.22， 0.41）， P＜0.000 01]， postoperative vaginal bleeding time [MD＝－1.69， 95%CI （－2.05， －1.32）， P＜0.000 01]， postoperative vaginal bleeding volume [MD＝－10.78， 95%CI （－12.19， －9.37）， P＜0.000 01]， postoperative menstrual resumption time [MD＝－6.99， 95%CI （－8.27， －5.71）， P＜0.000 01]， and the incidence of postoperative reduced menstrual flow [RR＝0.25， 95%CI （0.12， 0.56）， P＝0.000 7] were significantly lower， less or shorter than control group； postoperative endometrial thickness [MD＝ 1.90， 95%CI （1.68， 2.13）， P＜0.000 01] and the rate of postoperative re-pregnancy [RR＝6.26， 95%CI （1.88， 20.83）， P＝0.003] were significantly higher than control group. CONCLUSIONS Dydrogesterone combined with estradiol valerate may reduce the incidence of IUA after induced abortion patients， decrease postoperative vaginal bleeding volume， shorten postoperative vaginal bleeding time and postoperative menstrual resumption time， and increase postoperative endometrial thickness.

Pyruvate kinase M2(PKM2)is closely linked to a variety of neurological disorders,involved in the onset and progression of a wide range of diseases,including Alzheimer's disease,Parkinson's disease,multiple sclerosis and traumatic brain injury through such mechanisms as aerobic glycolysis,oxidative stress,inflammation and apoptosis.This review is intended to provide an overview of the biological characteristics of PKM2 and its role in the pathophysiological mechanisms of neurological disorders.A better understanding of the correlations between PKM2 and the development of neurological diseases can offer new insights into and references for the clinical diagnosis and treatment of these conditions.

Objective To study the role of photobiomodulation(PBM)in promoting the repair of spinal cord injury(SCI)by regulating microglial cells.Methods Forty-five C57BL/6J mice were randomly divided into the sham operation(Sham)group,surgery(SCI)group and the treatment(SCI+PBM)group,with 15 mice in each.After laminectomy of the T10 vertebral body in the three groups of mice,the SCI group and the SCI+PBM group were used to construct the model of spinal cord hemisection.The SCI+PBM group received immediate PBM treatment after spinal cord injury,while the other two groups did not.On the 1st,3rd,7th,14th,21st and 28th days(D1,D3,D7,D14,D21,D28)after the operation,the Basso Mouse Scale(BMS)was used to assess the recovery of the hind limb motor function of the mice.On the 28th day post operatively,immunofluorescence was used to detect the changes of neurons in the areas of injury in the three groups of mice.Quantitative real-time PCR and Western blotting experiments were used to detect the phenotypic changes of BV2 cells under the interventions of PBM with inflammatory stimulation.Western blotting experiments were conducted to detect the effects of PBM on the nuclear factor kappa-B(NF-κB)pathway.Results On the 28th day after the operation,the results of the mouse motor assessment showed that the BMS scores and related behaviors of the mice in the SCI+PBM group were better than those of the mice in the SCI group(P＜0.05),and the neurons in the SCI+PBM group far outnumbered those in the SCI group(P＜0.05).The results of quantitative real-time PCR and Western blotting experiments showed that on the 14th day after the operation,PBM promoted the activation of M2-type microglial cells in vivo but inhibited the activation of M1-type microglial cells.In vitro experiments confirmed that PBM could promote the polarization of BV2 cells towards M2-type microglial cells.In addition,PBM inhibited the activation of the NF-κB pathway in injured spinal cords and in activated BV2 cells.Conclusion PBM can promote the repair of spinal cord injury in SCI mice by promoting microglial cells through inhibiting the NF-κB pathway.