Traditional Chinese medicine （TCM） diagnostics is a discipline that studies the basic theories and fundamental skills of diagnostic methods， disease diagnosis， and differentiation in accordance with the theories of TCM. The artificial intelligence （AI） technology has gained remarkable achievements in the intelligentization of the four diagnostic methods in TCM and the standardization of differentiation and diagnosis. However， it still faces many challenges. The standardization of clinical data collection is difficult， and the data quality is uneven， which affects the usability of the data. The integration of the four diagnostic information is insufficient. Most instruments can only collect data from a single diagnostic method， lacking overall integrity. The scientific nature of the diagnostic model needs to be improved. The existing models lack dynamics and the reasoning logic of TCM differentiation. The accuracy of intelligent methods needs to be improved， and the existing evaluation indicators cannot fully reflect the practical application effect of the model. Furthermore， the relevant laws and regulations are still not perfect， and data security and patient privacy lack guarantees. The cultivation of compound talents is insufficient， and there is a lack of interdisciplinary talents who are proficient in both TCM and AI. On this basis， this paper expounded on the current development status， difficulties， and bottlenecks of AI in TCM diagnosis and then explored the development trend of AI in the field of TCM diagnosis. It proposed solutions such as optimizing the data collection process， constructing multimodal diagnostic models， facilitating multi-disciplinary exchanges and cooperation， improving laws and regulations， and cultivating compound talents. It is hoped that modern， standardized， normalized， and intelligent TCM diagnosis can be further promoted， thereby providing new impetus and methods for the inheritance and innovation of TCM.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective To construct a lung cancer surgery-oriented disease-specific database covering the entire perioperative care pathway, thereby improving the quality and usability of key surgical data elements. Methods Real-world clinical data were extracted from a single-center thoracic surgery department. A standardized data model was established based on the open electronic health record (openEHR) standard. Large language model (LLM), optical character recognition (OCR), and artificial intelligence (AI)-driven techniques were employed to extract, structure, and perform quality control on unstructured clinical narratives, imaging reports, and radiological data, with a focus on capturing surgically relevant perioperative indicator. Results A multimodal database comprising 19 917 patients was established, including 7 930 males and 11 987 females, with ages ranging from 15 to 97 (61.7±9.7) years. The database includes 582 structured data variables, textual report data corresponding to 69 clinical indicators, 13 000 pulmonary function test PDF reports, and chest CT imaging data from 16 884 patients. This database comprehensively covers major information relevant to surgical diagnosis and treatment of lung cancer, significantly improving the completeness and granularity of surgical detail data. Large language models (LLMs) and optical character recognition (OCR) technologies enhanced the efficiency of converting unstructured data into structured formats, while a multi-level manual verification process ensured data accuracy and traceability. The database supports real-world research including comparisons of surgical procedures, prediction of postoperative complications, prognosis assessment, and multimodal data association analyses.

ObjectiveObesity, a global chronic metabolic disease, is closely associated with disruptions in lipid metabolism and gut microbiota. Current intervention strategies still have limitations in terms of safety and microecological regulation, necessitating the exploration of novel natural regulatory approaches. Based on the early pathological characteristics of obesity, this study innovatively employs a rectal delivery method alongside a high-fat diet (HFD)-induced obesity model to systematically evaluate the inhibitory effects, safety, and gut microbiota regulation mechanisms of leek-derived and konjac-derived extracellular vesicles on obesity development. By simulating early clinical intervention scenarios, this study aims to explore the preventive potential of plant-derived extracellular vesicles during the initial stages of obesity onset. MethodsExtracellular vesicles from leek and konjac were isolated using ultracentrifugation combined with density gradient centrifugation. Their nanoscale properties were characterized by dynamic light scattering (DLS), transmission electron microscopy (TEM), and nanoparticle tracking analysis (NTA). Male C57BL/6J mice were randomly divided into four groups: normal control (NC), high-fat diet (HFD), leek-derived extracellular vesicles (LEVs), and konjac-derived extracellular vesicles (KEVs). Beginning simultaneously with HFD feeding, mice in the intervention groups received 20 g/L vesicles rectally every 3 d for 4 weeks. Body mass and body composition were monitored throughout. At endpoint, mouse serum, adipose tissue, and colonic contents were collected. Serum biochemical indices (lipid profile, liver and kidney function, cardiac markers) were assessed to evaluate safety and metabolic efficacy, while 16S rRNA sequencing was employed to analyze gut microbial structure and diversity. ResultsDLS, NTA, and TEM confirmed that both LEVs and KEVs exhibited typical cup-shaped nanostructures with average particle sizes of approximately 284 nm and 223 nm, respectively. LEVs and KEVs treatment significantly suppressed HFD-induced weight gain and elevation of body-fat percentage (P<0.05), and reduced accumulation of abdominal white and epididymal adipose tissue. Serological analyses showed that both vesicles lowered total cholesterol, triglycerides and LDL-cholesterol, and ameliorated liver enzyme profiles (ALT, AST), demonstrating lipid-metabolic regulation and hepatoprotective effects. No hepatic, renal or cardiac dysfunction was observed, indicating favorable safety. Gut microbiota analyses revealed that vesicle intervention partially restored HFD-depleted microbial diversity and reshaped community structure. Notably, LEVs markedly increased the relative abundance of the beneficial taxon Lachnospiraceae at the family level, which is known for producing short-chain fatty acids and enhancing intestinal barrier function. Furthermore, Phylogenetic Investigation of Communities by Reconstruction of Unobserved States (PICRUSt) functional prediction suggested that LEVs and KEVs modulated gut microbial functions through distinct mechanisms: LEVs downregulated pathways related to ribosomes and DNA replication while enhancing xenobiotic degradation, whereas KEVs tended to upregulate energy metabolism and protein synthesis toward healthy levels. ConclusionRectally administered LEVs and KEVs exhibit excellent safety and pronounced metabolic benefits during the early phase of obesity, suppressing weight gain, correcting lipid dysregulation, and exerting effects via modulation of gut microbial composition and function. This study provides systematic experimental evidence supporting plant-derived exosome-like vesicles as an early intervention strategy against obesity.

ObjectiveObesity, a global chronic metabolic disease, is closely associated with disruptions in lipid metabolism and gut microbiota. Current intervention strategies still have limitations in terms of safety and microecological regulation, necessitating the exploration of novel natural regulatory approaches. Based on the early pathological characteristics of obesity, this study innovatively employs a rectal delivery method alongside a high-fat diet (HFD)-induced obesity model to systematically evaluate the inhibitory effects, safety, and gut microbiota regulation mechanisms of leek-derived and konjac-derived extracellular vesicles on obesity development. By simulating early clinical intervention scenarios, this study aims to explore the preventive potential of plant-derived extracellular vesicles during the initial stages of obesity onset. MethodsExtracellular vesicles from leek and konjac were isolated using ultracentrifugation combined with density gradient centrifugation. Their nanoscale properties were characterized by dynamic light scattering (DLS), transmission electron microscopy (TEM), and nanoparticle tracking analysis (NTA). Male C57BL/6J mice were randomly divided into four groups: normal control (NC), high-fat diet (HFD), leek-derived extracellular vesicles (LEVs), and konjac-derived extracellular vesicles (KEVs). Beginning simultaneously with HFD feeding, mice in the intervention groups received 20 g/L vesicles rectally every 3 d for 4 weeks. Body mass and body composition were monitored throughout. At endpoint, mouse serum, adipose tissue, and colonic contents were collected. Serum biochemical indices (lipid profile, liver and kidney function, cardiac markers) were assessed to evaluate safety and metabolic efficacy, while 16S rRNA sequencing was employed to analyze gut microbial structure and diversity. ResultsDLS, NTA, and TEM confirmed that both LEVs and KEVs exhibited typical cup-shaped nanostructures with average particle sizes of approximately 284 nm and 223 nm, respectively. LEVs and KEVs treatment significantly suppressed HFD-induced weight gain and elevation of body-fat percentage (P<0.05), and reduced accumulation of abdominal white and epididymal adipose tissue. Serological analyses showed that both vesicles lowered total cholesterol, triglycerides and LDL-cholesterol, and ameliorated liver enzyme profiles (ALT, AST), demonstrating lipid-metabolic regulation and hepatoprotective effects. No hepatic, renal or cardiac dysfunction was observed, indicating favorable safety. Gut microbiota analyses revealed that vesicle intervention partially restored HFD-depleted microbial diversity and reshaped community structure. Notably, LEVs markedly increased the relative abundance of the beneficial taxon Lachnospiraceae at the family level, which is known for producing short-chain fatty acids and enhancing intestinal barrier function. Furthermore, Phylogenetic Investigation of Communities by Reconstruction of Unobserved States (PICRUSt) functional prediction suggested that LEVs and KEVs modulated gut microbial functions through distinct mechanisms: LEVs downregulated pathways related to ribosomes and DNA replication while enhancing xenobiotic degradation, whereas KEVs tended to upregulate energy metabolism and protein synthesis toward healthy levels. ConclusionRectally administered LEVs and KEVs exhibit excellent safety and pronounced metabolic benefits during the early phase of obesity, suppressing weight gain, correcting lipid dysregulation, and exerting effects via modulation of gut microbial composition and function. This study provides systematic experimental evidence supporting plant-derived exosome-like vesicles as an early intervention strategy against obesity.

Work serves as a critical means of obtaining resources, facilitating personal growth, realizing self-worth, and engaging in social interactions. However, work-related diseases pose significant threats to workers’ health and productivity, and impose considerable economic burdens. This article categorized work-related diseases into six major types, including musculoskeletal disorders, mental and behavioral disorders, cardiovascular and metabolic diseases, digestive system diseases, reproductive system diseases, and non-specific respiratory diseases, and summarized their risk factors, assessment methods, policy regulation, and prevention and control measures. Current research in this field predominantly relies on cross-sectional studies, which present limitations in causal inference and potential risks of bias. Future studies should expand sample sizes, optimize research designs, and establish multidimensional evaluation systems to comprehensively assess the health and economic impacts of work-related diseases. It is recommended to enhance the translation of research findings into practice, thereby providing a scientific basis for the occupational health protection system and promoting the well-being and sustainable development of the working population.

Objective To evaluate the effect of dapagliflozin on myocardial function in early spontaneously hypertensive rats(SHR)with layer-specific global longitudinal strain(GLS).Methods A total of 45 male SHR aged 6 weeks were randomly divided into control group(normal saline),dapagliflozin group[1 mg/(kg·day)],and losartan group[10 mg/(kg·day)].Fifteen male Wistar-Kyoto(WKY)rats at same age with normal blood pressure were subjected and served as blank control group.During 8 weeks of intervention,systolic blood pressure(SBP)was measured,and conventional echocardiography and two-dimensional speckle tracking echocardiography(2DSTE)were performed and the results were collected to acquire the longitudinal strain of each layer of left ventricular(LV)myocardium.The parameters were compared among the groups.The pathological changes of myocardium were observed in each group of rats.Results Compared with the WKY group,LV ejection fraction(LVEF)and LV fraction shortening(LVFS)at week 8 were decreased in the control group(P＜0.05),but no such decreases were observed in the dapagliflozin group and the losartan group.The GLS of endo-myocardium(GLSendo)at the 6th week was decreased,and GLSendo,GLSmid and GLSepi at the 8th week were all decreased in the control group than the WKY group(all P＜0.05).But there were no statistical differences in the above 3 indicators in the dapagliflozin and losartan groups when compared with the WKY group(all P＞0.05).The pathological results showed that myocardial interstitial fibrosis was observed in the control group at the 6th week.Conclusion Dapagliflozin can effectively improve myocardial function in early SHR.

Cosmetics may be an important source of human exposure to per-and polyfluoroalkyl substances(PFASs),posing risks to human health.In this study,a nontarget screening method for PFASs in cosmetics was developed using ultra-high performance liquid chromatography-high-resolution mass spectrometry(UHPLC-Q-Orbitrap HRMS)based on the Kendrick mass defect(KMD).The sample was extracted by ultrasonic assisted extraction prior to being analyzed by UHPLC-Q-Orbitrap HRMS.Acquisition of HRMS data was achieved in both full scan and data-dependent(Full MS/dd MS2)mode.The data collected by HRMS were imported into an in-lab built R script for processing.Samples retained the mass spectra peaks with KMD values in the range of 0.85-1 or 0-0.15 for in-and out-of-library matching;when KMD deviation(δKMD)<0.001 and CF 2 mass error(δMS)<15 ppm,it was considered as a potential PFASs homologues.According to matches of parent ions(MS),fragment ions(MS2)and retention time(RT)with the in-house built PFASs database,the screened and identified potential PFASs were categorized to 5 confidence levels(CL1-CL5).A total of 15 kinds of PFASs homologues with confidence level of CL3 and above were screened from 13 cosmetics products and 8 cosmetic raw materials,including perfluoroalkyl alcohol,hydroperfluoroalkyl sulfonic acid,chloroperfluoroalkyl sulfonic acid,etc.with concentrations ranging from 1.9 ng/g to 98.1 ng/g.The nontarget screening method could be used to screen and identify PFASs homologues feasibly and therefore provided data basis for management and control of PFASs addition in cosmetics.

BACKGROUND:With the continuous progress of science and technology,the introduction of new technologies and methods will bring more possibilities and new breakthroughs for the application of shape memory alloys in the fields of assistive and rehabilitation. OBJECTIVE:To review the application status of shape memory alloys in assistive and rehabilitation equipment,discuss their main methods,techniques and results,summarize and put forward suggestions,hoping that shape memory alloys can be continuously optimized and bring more new changes for the development of assistive and rehabilitation equipment. METHODS:WanFang,PubMed,and Web of Science databases were searched by computer."Shape memory alloys,application progress,orthodontics,orthopedic,prosthesis,rehabilitation,properties,implantation,mechanical properties,nickel-titanium memory alloys,actuation"were used as Chinese search terms."Shape memory alloys,application,orthodontics,orthopedic,prosthetics,rehabilitation,properties,implant,drive,progress,prostheses"were used as English search terms.Finally,91 articles were included for review. RESULTS AND CONCLUSION:(1)Shape memory alloy has the characteristics of corrosion resistance,wear resistance,biocompatibility,fatigue resistance,kink resistance and other properties.Compared with other traditional materials(stainless steel,titanium alloy,cobalt-chromium alloy,etc.),shape memory alloy has lower elastic modulus and no biological toxicity,which is suitable for long-term implantation as an implant prosthesis.Due to its shape memory effect and excellent mechanical properties,it is mainly used as a driving element or as a bridge connecting the device and the human body in artificial limbs,orthoses and rehabilitation equipment.(2)The use of shape memory alloy drive elements can reduce the weight of the device,eliminate noise,easy to operate,easy to carry,better assist joint movement;compared with the use of pneumatic,hydraulic,and electrical drive methods of the device,it has obvious advantages.(3)In addition,shape memory alloy can produce permanent and stable stress during deformation.Compared with stainless steel,titanium alloy and aluminum alloy,shape memory alloy has a higher material recovery rate and does not need to be replaced and adjusted frequently,so it is more practical in the correction of deformity.(4)At present,shape memory alloy is most commonly used in orthosis,and the best clinical application effect is in stapes prosthesis.However,due to the limitations of technology and cost,shape memory alloys are rarely used in artificial limbs and rehabilitation equipment,and there is a lack of large sample size studies on the application effect.(5)Although shape memory alloys have been developed in the field of auxiliary and rehabilitation,there are still many problems:it is difficult to accurately control the shape memory alloys;the cooling speed of shape memory alloy is slow;the deformation speed of shape memory alloy cannot be controlled;there is a lack of comparative research and expert consensus on shape memory alloys with different properties;shape memory alloys are costly and expensive.(6)In the future,attention should be paid to the development of new shape memory alloys,increase comparative research,and use new technologies and methods(such as 4D printing)to solve the existing problems,so as to develop high-performance assistive devices and rehabilitation equipment.

Objective: To investigate the awareness of knowledge about hepatitis C prevention and control among outpatients in Ningbo City, Zhejiang Province, and its influencing factors, so as to provide the evidence for strengthening health education on hepatitis C prevention and control. Methods: Based on sentinel surveillance of hepatitis C, the outpatients aged 15 to 65 years at seven hospitals in Yinzhou District, Cixi City and Xiangshan County of Ningbo City were selected using the convenient sampling method from April to June during 2020 and 2022. Demographic information, knowledge and behaviors related to hepatitis C prevention and control were collected through questionnaire surveys. The influencing factors for knowledge about hepatitis C prevention and control were analyzed using a multivariable logistic regression model. Results: A total of 2 792 participants were surveyed, including 1 157 males (41.44%) and 1 635 females (58.56%). The awareness rate of knowledge about hepatitis C prevention and control was 56.23%, and was lower in knowledge about hepatitis C vaccine and treatment. The awareness rates of knowledge about hepatitis C prevention and control among outpatients from 2020 to 2022 were 47.11%, 53.22% and 70.65%, respectively, showing an upward trend (P<0.05). Multivariable logistic regression analysis showed that participants aged 25 to <50 years (OR=1.358, 95%CI: 1.073-1.719), with an educational level of high school or junior college (OR=1.431, 95%CI: 1.134-1.806) or above junior college (OR=3.728, 95%CI: 2.958-4.699), with household monthly income per capita of 3 000 to <5 000 yuan (OR=1.828, 95%CI: 1.344-2.486) or ≥5 000 yuan (OR=1.858, 95%CI: 1.366-2.526), without a history of invasive treatments such as pedicure in public places (OR=1.287, 95%CI: 1.024-1.618), without a history of contact with family members' blood-contaminated items (OR=2.050, 95%CI: 1.552-2.707), and always using condoms during sexual contacts (OR=1.740, 95%CI: 1.273-2.378) had higher awareness of knowledge about hepatitis C prevention and control. Conclusions The awareness of knowledge about hepatitis C vaccine and treatment among outpatients in Ningbo City needs to be improved. Age, educational level, household monthly income per capita, history of invasive treatments such as pedicure in public places, history of contact with family members' blood-contaminated items and frequency of condom use during sexual contacts are associated with outpatients' awareness of knowledge about hepatitis C prevention and control.