ObjectiveTo investigate the potential mechanism of Danggui Buxuetang （DBT） in the treatment of vascular dementia （VAD）. MethodsSixty male SD rats were randomly assigned to the sham-operated group， model group， DBT low-， medium-， and high-dose groups， and the donepezil group. Except for the sham-operated group， rats in all other groups underwent bilateral common carotid artery ligation. After successful modeling， DBT was administered at doses of 9.2， 18.4， 36.8 g·kg^-1 for the low-， medium-， and high-dose groups， respectively， while the donepezil group received 3 mg·kg^-1 donepezil solution by gavage once daily. After 4 consecutive weeks of drug treatment， rats underwent the Morris water maze test， novel object recognition test， Nissl staining to observe hippocampal neurons， and immunofluorescence staining to detect the expression of neuronal nuclear protein （NeuN） in the hippocampus. Western blot was used to assess the expression of PTEN-induced kinase 1 （PINK1）， Parkin， microtubule-associated protein 1 light chain 3Ⅱ （LC3Ⅱ）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax）. Transmission electron microscopy was used to observe hippocampal neuronal ultrastructure. Real-time PCR was used to detect the expression of NADPH oxidase subunits p22^phox and p47^phox in hippocampal tissues. The levels of malondialdehyde （MDA）， glutathione （GSH）， superoxide dismutase （SOD）， and total antioxidant capacity were measured to evaluate oxidative stress levels. ResultsIn the Morris water maze test， escape latency changed significantly over time in all groups except the model group. Compared with the sham-operated group， the model group showed significantly prolonged escape latency （P<0.01）. Compared with the model group， rats in the DBT groups and the donepezil group exhibited significantly shorter escape latency （P<0.05， P<0.01）. The number of crossings over the original platform was significantly reduced in the model group compared with the sham-operated group （P<0.01）， whereas rats in the DBT and donepezil groups showed significantly increased platform crossings compared with the model group （P<0.05， P<0.01）. Compared with the sham-operated group， exploration time of new objects was significantly reduced in the model group （P<0.01）. Compared with the model group， exploration time of new objects increased significantly in the medium- and high-dose DBT groups and the donepezil group （P<0.05， P<0.01）， while no significant change was observed in the low-dose DBT group. Compared with the high-dose DBT group， rats in the donepezil group had significantly prolonged escape latency and reduced platform crossings and new-object exploration time （P<0.05）. Nissl staining showed decreased density of healthy neurons in the CA1 and CA3 regions of the hippocampus in the model group， with loss of Nissl bodies and nuclear atrophy or disappearance. In the high-dose DBT group， neuronal density in CA1 and CA3 increased， with neurons arranged closely and displaying normal morphology. Immunofluorescence showed that compared with the sham-operated group， the hippocampal NeuN⁺ cell count in the VAD model group was significantly decreased（P<0.01）， compared with the VAD model group， the hippocampal NeuN⁺ cell count in the high-dose DBT group was significantly increased（P<0.01）. Compared with the sham-operated group， the expression of PINK1， Parkin， LC3Ⅱ， and Bax proteins was significantly increased（P<0.01）， while the expression of Bcl-2 was significantly decreased in the VAD model group（P<0.01）. Compared with the VAD model group， the high-dose DBT group showed significantly decreased expression of PINK1， Parkin， LC3Ⅱ， and Bax proteins（P<0.01）and significantly upregulated Bcl-2 expression（P<0.01）. The medium-dose DBT group exhibited significantly reduced expression of Parkin， LC3Ⅱ， and Bax proteins（P<0.05，P<0.01） and significantly increased Bcl-2 expression（P<0.01）， while no statistically significant differences were observed in the low-dose DBT group. Transmission electron microscopy showed mitochondrial pyknosis， thickened cristae， increased electron density， and the presence of mitochondrial autophagy in the model group. In contrast， hippocampal neurons in the high-dose DBT group contained abundant mitochondria with intact morphology， clear cristae， and uniform matrix. Compared with the sham-operated group， total antioxidant capacity， SOD activity， and GSH levels were significantly decreased， while MDA levels were significantly increased in the model group （P<0.01）. Compared with the model group， total antioxidant capacity and antioxidant levels （SOD， GSH） increased significantly， and MDA decreased significantly in the medium- and high-dose DBT groups （P<0.01）， while no significant changes were observed in the low-dose DBT group. Compared with the sham-operated group， mRNA expression of p22^phox and p47^phox was significantly increased in the model group （P<0.01）. Compared with the model group， expression of p22^phox and p47^phox was significantly decreased in the DBT groups （P<0.05， P<0.01）. ConclusionDBT may exert neuroprotective effects by regulating PINK1/Parkin-mediated mitochondrial autophagy， thereby improving learning and memory abilities and treating VAD.

ObjectiveTo observe the effect of Qishao capsules on renal injury in db/db mice with diabetic kidney disease （DKD），and explore its mechanism of protecting the kidney by inhibiting podocyte apoptosis. Methodsdb/m mice （7 mice） were used as the normal group，and db/db mice （35 mice） were randomly divided into a model group，a dapagliflozin group （0.001 g·kg^-1·d^-1），and low-，medium-，and high-dose groups of Qishao capsules （0.341 3，0.682 5，and 1.365 g·kg^-1·d^-1，respectively）. Drug intervention lasted for 8 consecutive weeks. After sampling，the serum renal function indicators ［creatinine（SCr），and urea nitrogen（BUN）］，fasting blood glucose （FBG），24 h urinary protein quantification （24 h-UTP）， and other indicators of the mice were measured. The pathological tissue morphology of the kidney was observed by periodic acid-silver methenamine （PASM） and Masson's trichrome （Masson） staining. Immunohistochemical detection of cysteine-dependent aspartate-specific protease （Caspase）-3 and B-cell lymphoma 2 （Bcl-2） was performed. Western blot was used to detect the protein expression of Caspase-8，Caspase-7，Caspase-3， and other molecules. Terminal deoxynucleotidyl transferase dUTP nick End labeling （TUNEL） staining was used to observe apoptosis in renal tissue. Immunofluorescence staining of Wilms tumor suppressor gene-1 （WT-1） was used to observe podocyte injury. Real-time polymerase chain reaction （Real-time PCR） was employed to detect Caspase-8 and Caspase-3 mRNA expression in the kidneys of experimental mice. Data analysis was conducted using statistical software GraphPad Prism 10. ResultsCompared with the normal group，the model group showed significantly increased 24 h-UTP，SCr，BUN，and FBG （P<0.01）. Additionally， PASM staining of renal tissue showed increased glycogen deposition，glomerular hypertrophy，and thickening of the basement membrane. Masson staining showed collagen fiber proliferation in renal tissue. Transmission electron microscopy showed thickening of the renal tissue basement membrane and fusion or loss of foot processes in the model group. The immunohistochemical results showed that Caspase-3 in the kidneys of the mice in the model group significantly increased （P<0.01），while the Bcl-2 protein expression level decreased significantly （P<0.01）. The number of TUNEL positive cells in renal tissue significantly increased （P<0.01）. The positive expression of WT-1 in podocytes was significantly reduced （P<0.01）. Western blot analysis showed significant upregulation of Caspase-8，Caspase-7，and Caspase-3 protein expression in renal tissue （P<0.01）. The mRNA expression levels of Caspase-8 and Caspase-3 in the kidneys increased significantly （P<0.01）. Compared with the model group，the Qishao capsules groups can significantly reduce the levels of 24 h-UTP，SCr，BUN，and FBG （P<0.01）. The pathological damage of renal tissue and podocyte injury were improved to some extent. Immunohistochemistry in the kidney showed a significant decrease in Caspase-3 （P<0.01） and a significant increase in Bcl-2 protein expression level （P<0.01）. Additionally， there were a significant decrease in the number of TUNEL positive cells in renal tissue （P<0.01），a significant increase in WT-1 positive expression in podocytes （P<0.01），marked downregulation of Caspase-8，Caspase-7，and Caspase-3 protein expression in renal tissue （P<0.05，P<0.01），and a significant decrease in Caspase-8 and Caspase-3 mRNA expression levels （P<0.01）. ConclusionQishao capsules can inhibit podocyte apoptosis by regulating the expression of Caspase-8，Caspase-7， and Caspase-3，thereby improving the diabetic renal injury in db/db mice.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

AIM: To compare the preoperative ocular biometry between Pentacam AXL and IOL Master 700 in cataract patients.METHODS:Prospective study. A total of 150 patients(150 eyes)with cataracts who were treated in our hospital from May to December 2024 were selected. The IOL Master 700 and Pentacam AXL were preoperatively used to measure axial length(AL), corneal curvature(K1, K2 and Km), anterior chamber depth(ACD), and white-to-white(WTW). The difference and consistency of the results of the two instruments were compared.RESULTS: There was no significant difference between the two instruments in the AL, K1, K2, Km, ACD, and WTW(all P>0.05). The Spearman correlation analysis showed that the two instruments positively correlated with the AL, K1, K2, Km, ACD and WTW of the operated eye(all P<0.001). The Bland-Altman analysis showed that for the Pentacam AXL and IOL Master 700, there were 5/150(3.3%), 7/150(4.7%), 4/150(2.7%), 5/150(3.3%), and 0 points outside the 95%LoA for the AL, K1, K2, Km, ACD, and WTW of the examined eyes, respectively, with all of these values less than 5%, indicating good consistency.CONCLUSION:The AL, K1, K2, Km, ACD and WTW of Pentacam AXL and IOL Master 700 in cataract patients before cataract phacoemulsification combined with IOL implantation show no significant differences, and have good correlation and consistency. The two instruments can be used interchangeably.

Objective: To characterize perioperative dynamic changes in immune-cell phenotypes and inflammatory cytokines in patients undergoing CPB (cardiopulmonary bypass) cardiac surgery, and to explore their associations with postoperative outcomes. Methods: In this prospective cohort study, 120 adult patients who underwent elective cardiac surgery under CPB at West China Hospital from May 2022 to March 2023 were enrolled. Perioperative immune-cell phenotypes and concentrations of 40 inflammation-related cytokines were measured. The primary outcomes were the sequential organ failure assessment (SOFA) score at 24 h after surgery and ΔSOFA (the peak SOFA score within 48 h after surgery minus the preoperative SOFA score). Secondary outcomes included major adverse cardiovascular events (MACE), acute kidney injury (AKI), respiratory failure, severe liver injury, and infection. Results: The mean age of enrolled patients was 57±10 years. Of these, 52% (62/120) were male and 90% (108/120) underwent valve surgery. During the rewarming to the end of CPB, neutrophil counts rapidly increased (7.39×10 /L vs preoperative 3.07×10 /L, P<0.001), with significant upregulation of CD11b (7.30×10 /L vs preoperative 3.05×10 /L, P<0.001) and CD54 (7.15×10 /L vs preoperative 2.99×10 /L, P<0.001). Lymphocyte counts increased at the end of CPB (1.75×10 /L vs preoperative 1.12×10 /L, P<0.001) but decreased significantly at 24 h after surgery (0.59×10 /L vs preoperative 1.12×10 /L, P<0.001). Plasma analysis showed that multiple pro-inflammatory cytokines increased during CPB and remained elevated up to 24 h after surgery; five chemokines and the anti-inflammatory cytokine IL-10 peaked at the end of CPB. The SOFA score increased from 1 (1, 2) preoperatively to 7 (5, 10) at 24 h after surgery, with a ΔSOFA of 6 (4, 8). Within 30 days after surgery, 48 patients (40.0%) developed AKI, 17 (14.2%) developed infection, 4 (3.3%) developed severe liver injury, 3 (2.5%) developed respiratory failure, and 3 (2.5%) experienced MACE. During the 2-year follow-up, 8 patients (6.7%) experienced MACE and 5 (4.2%) died. Conclusion: Multi-organ dysfunction is common after cardiac surgery under CPB (median ΔSOFA, 6), accompanied by perioperative activation of multiple immune-cell subsets and upregulation of pro-inflammatory, anti-inflammatory, and chemotactic mediators. This study provides data-driven evidence and research clues for further investigation of the associations between CPB-related immune perturbations and postoperative organ dysfunction and clinical outcomes.

Objective To analyze the epidemiological and spatial clustering characteristics of varicella in Changzhou from 2018 to 2024, and to provide a theoretical support for the formulation of prevention and control measures. Methods The reported case information of varicella in Changzhou from 2018 to 2024 was collected through the China Information System for Disease Control and Prevention, and the three-dimensional distribution characteristics were analyzed. The incidence trend was analyzed by Joinpoint regression, and the spatial autocorrelation analysis was performed by Arc GIS 10.5 software. The spatiotemporal scanning analysis was carried out with SaTScan 10.1.2 software. Results From 2018 to 2024, a total of 42,132 cases of varicella were reported in Changzhou, with an average annual incidence of 116.25/100,000. The reported incidence showed a downward trend, with an annual percentage change (APC) of -21.96% (95%C1: -32.63%~-9.33%, P<0.01). The incidence showed a ^“bimodal distribution^”, and the age group was mainly under 15 years old (29,086 cases, accounting for 69.04%). The difference in incidence between men and women was statistically significant (χ²= 92.83, P<0.001), and the incidence gradually decreased with age ( χ²_trend=112771.44, P<0.001). Global autocorrelation analysis showed that there was spatial aggregation in the six years (P<0.05), and local autocorrelation analysis showed that most of the towns (streets) in the three central urban areas of Tianning District, Zhonglou District, and Xinbei District, as well as some towns (streets) in Liyang City, Wujin District, and Economic Development Zone were high-high aggregation areas. Spatiotemporal scanning analysis showed that the first type of aggregation area was most of the towns (streets) in Tianning District, Zhonglou District and Xinbei District (23, accounting for 92%), and some towns (streets) in Wujin District and Economic Development Zone (RR=3.76, P<0.001), and the second type of aggregation area was most of the towns (streets) in Liyang City (7, accounting for 70%) (RR=3.66, P<0.001). Conclusion The reported incidence of varicella in Changzhou City shows a downward trend, with multiple spatial and temporal clusters. The prevention and control of varicella in high-risk clustering areas, peak hours and high-risk populations should be strengthened, and intervention measures should be taken as soon as possible.

Objective To investigate the depressive state of patients with Parkinson's disease (PD), and to analyze the correlation of depressive state with autonomic dysfunction. Methods A total of 327 patients with PD in the hospital were selected from March 2022 to March 2024. The depressive state was evaluated by Hamilton Depression Scale (HAMD). The autonomic nerve function was assessed using the Scale for Outcomes in PD for Autonomic Symptoms (SCOPA-AUT) and heart rate variability [standard deviation of sinus RR interval (SDNN), standard deviation of average sinus RR interval (SDANN), and percentage of successive NN interval differences above 50 ms (pNN50)]. According to the positive depression (HAMD>20 points), the patients were divided into a depression group and a non-depression group. The clinical data and autonomic nerve function indicators were compared between the two groups. Pearson correlation coefficient analysis was performed to analyze the correlation between depressive state and autonomic dysfunction in PD patients. Results The positive rate of depression in patients with PD was 31.19%. There were 102 patients in the depression group and 225 patients in the non-depression group. The years of education and the proportion of mild Hoehn-Yahr stage (H-Y stage) in the depression group were lower than those in the non-depression group, while the disease course was longer, and the Unified Parkinson's Disease Rating Scale (UPDRS) II score and UPDRS III score were higher than those in the non-depression group (P<0.05). The SCOPA-AUT score in the depression group was higher while the SDNN, SDANN and pNN50 were lower compared to the non-depression group (P<0.05). HAMD score was positively correlated with SCOPA-AUT score (r=0.685), and was negatively correlated with SDNN, SDANN and pNN50 (r=-0.578, -0.685, and -0.439) (P<0.05). Conclusion Depression is a common state among patients with PD, and its level is positively correlated with the severity of autonomic dysfunction in patients.

Objective To assess the clinical efficacy of sodium hyaluronate （0.3%） eye drops combined with herbal self-heating steam eye mask in the treatment of dry eye disease. Methods A prospective randomized controlled clinical trial was performed on 60 patients diagnosed with dry eye at the ophthalmic clinic of a Grade A, Class Ⅲ hospital in Shanghai from June 2023 to September 2024. Specifically, patients were randomly divided into control group and study group. Patients in the control group were treated with sodium hyaluronate （0.3%） eye drops for six weeks; while in the study group, patients received the eye drops combined with the herbal self-heating steam eye mask mainly containing powders of Flos Buddlejae. Subsequently, comparisons and analysis were performed before and after treatment between the two groups in the clinical symptom questionnaire score traditional Chinese medicine （TCM syndrome score），the Chinese dry eye questionnaire score and determination of tear film fluorscein breakup time （FBUT）, and curative effect. Results The quality control standard of the herbal powder in the self-heating steam eye mask was established through TLC and HPLC, and good heating behavior of the herbal self-heating steam eye mask was ascertained heating temperature （43±5）℃; heating duration （≥20 min）, meeting requirements of the product quality control. After treatment for 6 weeks, FBUT was increased, while TCM syndrome score and the Chinese dry eye questionnaire score were both decreased in the study group （P<0.001）. Besides, compared with the control group, TCM syndrome score and the Chinese dry eye questionnaire score were much lower, while the FBUT were higher in the study group （P<0.001）. Moreover, the overall response rate in the study group （81.7%） was much better than that in the control group （25.9%）. Conclusion The combination of sodium hyaluronate （0.3%） eye drops with herbal self-heating steam eye mask could be applied to the clinical treatment of dry eye disease due to its good clinical effects on relieving dry eye symptoms.

Stroke is one of the leading causes of disability and mortality worldwide. Research into its mechanisms and the development of therapeutic strategies heavily rely on animal models that accurately replicate the pathological features of human disease. An ideal animal model for stroke should not only reproduce the neurological deficits and pathological changes observed in clinical patients but also demonstrate good reproducibility and translational value. This review focuses on the preparation and evaluation methods of ischemic stroke animal models. Firstly, it elaborates on the selection criteria, advantages, and disadvantages of experimental animals, including rodents (rats, mice) and non-rodents (non-human primates, miniature pigs, rabbits, zebrafish). Secondly, it provides a detailed overview of the modeling principles, key procedures, and application scopes for ischemic stroke models and hemorrhagic stroke models. Furthermore, the review summarizes advances in the applications of emerging technologies—including gene editing [e.g., clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) gene editing], multimodal imaging (e.g., two-photon microscopy, photoacoustic imaging), artificial intelligence, optogenetics, 3D bioprinting, organoid models, and multi-omics–in model optimization, precise assessment, and mechanistic investigation. Finally, based on a systematic analysis of relevant domestic and international literature from 2019 to 2024, this review discusses model selection strategies based on research objectives, a multidimensional evaluation system encompassing behavioral, imaging, and molecular pathological assessments, and envisions future directions involving technological integration to achieve model precision and individualization. This article aims to provide a comprehensive methodological reference to help researchers select appropriate animal models of stroke according to specific scientific questions.

Introduction: There remains little evidence on rehabilitation protocols for proximal humerus fractures (PHFs), although early mobilisation has been associated with positive clinical outcomes. There may be a potential role in allowing patients with more stable fractures to undergo an accelerated rehabilitation process to facilitate quicker return to function, although it must be balanced with safety concerns of premature mobilisation and logistical concerns of implementation with excessive stratification. The study aim was to report the overall safety and outcomes of a simple and implementable 2-tier stratified rehabilitation protocol based on fracture stability adopted by our institution for nonoperatively treated PHFs. Materials and methods: Patients in our institution (level 1 trauma centre) with non-operatively treated PHFs underwent a stratified rehabilitation protocol that classified patients into Accelerated versus Standard arms - with more stable fractures undergoing an accelerated rehabilitation programme. The Oxford Shoulder Score (OSS), Quick Disabilities of the Arm, Shoulder and Hand Score (QuickDASH), EuroQol-5-Dimensions (EQ5D) questionnaires, shoulder range of motion (ROM) and grip strength were measured at six months and one year postinjury. The frequency of adverse events requiring surgical intervention was noted. Results: We included 164 patients and 43% (71/164) went through the accelerated protocol. Overall, patients had favourable OSS (median[range] 47[44-48]), EQ5D (median [range] 1.0[0.82-1.00]), QuickDASH scores (median[range] 2.3[0- 10.7]), and shoulder ROM and grip strength above the requirement for functional activities of daily living at 1 year. There were no adverse events reported 1-year post-injury. Conclusion: This study was the first to report the safety and outcomes of a stratified rehabilitation protocol for PHFs. Our simple 2-tier stratified rehabilitation protocol which allowed a shorter period of rehabilitation and earlier return to function for patients with more stable PHFs is implementable, safe and had overall favourable functional outcome scores.