OBJECTIVE To systematically evaluate the influential factors for all-cause mortality in patients with carbapenem-resistant Gram-negative bacteria （CR-GNB） treated with polymyxin B. METHODS PubMed， Embase， the Cochrane Library， Web of Science， Wanfang Data， VIP， CBM and CNKI were searched to collect clinical studies on all-cause death within 30 days or 28 days after treatment with polymyxin B in patients with CR-GNB infection from database establishment to July 2025. After literature screening， data extraction and evaluation of literature quality， meta-analysis was performed using RevMan 5.4 software. RESULTS A total of 12 studies were included， involving 1 326 patients， among whom 529 patients died， with a mortality rate of 39.89%. Meta-analysis results showed that combined with cardiovascular disease [OR＝2.06， 95%CI （1.37， 3.09）， P ＝0.005 ] ， increased Sequential Organ Failure Assessment （SOFA） score [OR＝1.20， 95%CI （1.07， 1.35）， P ＝0.003 ] ， mechanical ventilation [OR＝2.35， 95%CI （1.65， 3.34）， P ＜0.001 ] ， continuous renal replacement therapy （CRRT） [OR＝2.58， 95%CI （1.67， 3.97）， P ＜0.001 ] ， bloodstream infection [OR＝3.24， 95%CI （2.19， 4.78）， P ＜0.001 ] ， multiple-site infection [OR＝1.51， 95%CI （1.03， 2.20）， P ＝0.03 ] ， septic shock [OR＝3.19， 95%CI （1.94， 5.24）， P ＜0.001 ] ， use of vasoactive drugs [OR＝2.90， 95%CI （1.97， 4.27）， P ＜0.001 ] ， and the occurrence of acute kidney injury （AKI） [OR＝2.17， 95%CI （1.41， 3.36）， P ＜0.001 ] were risk factors for all-cause mortality in patients with CR-GNB infection treated with polymyxin B. Conversely， an extended duration of polymy xin B treatment [OR＝0.92， 95%CI （0.86， 0.99）， P ＝0.03 ] and early administration after CR-GNB infection [OR＝0.47， 95%CI （0.25， 0.85）， P ＝0.01 ] were protective factors. CONCLUSIONS Patients with cardiovascular disease， receiving mechanical ventilation or CRRT， having bloodstream infection， multiple-site infection or septic shock， combining with vasoactive drugs， with AKI and increased SOFA scores have a higher risk of all-cause mortality. Conversely， extending the duration of polymyxin B treatment （beyond 7 days） and early administration within 48 hours after confirmed CR-GNB infection can significantly reduce the risk of all-cause mortality.

OBJECTIVE: To explore the genetic etiology of 46 Chinese pedigrees affected with Hereditary multiple exostoses (HME) and provide genetic counseling and reproductive intervention. METHODS: Whole-exome sequencing and Sanger sequencing were carried out on 87 patients from the 46 pedigrees to analyze the variants of EXT1 and EXT2 genes. Pathogenicity of the variants was assessed based on the guidelines from the American College of Medical Genetics and Genomics and Association for Molecular Pathology (ACMG/AMP). Prenatal diagnosis and preimplantation genetic testing (PGT) were provided for couples with identified pathogenic mutations. This study was approved by the Medical Ethics Committee of the hospital (Ethics No.: LL-SC-SG-2014-010). RESULTS: In total 17 and 22 pathogenic variants were respectively identified in the EXT1 and EXT2 genes, among which 5 EXT1 and 12 EXT2 variants were unreported previously. Three patients with no family history were found to harbor de novo variants of the EXT1 gene. Twenty nine couples had opted for PGT or underwent prenatal diagnosis following natural conception, and 17 healthy babies were born. CONCLUSION This study has clarified the genetic etiology of 45 HME pedigrees and identified 17 novel variants, which has enriched the mutational spectrum of the EXT1 and EXT2 genes. Reproductive intervention through PGT and prenatal diagnosis have prevented the recurrence of HME in these families.
Humans ; Female ; Male ; Pedigree ; Exostoses, Multiple Hereditary/diagnosis* ; N-Acetylglucosaminyltransferases/genetics* ; Adult ; Exostosin 1 ; Asian People/genetics* ; Genetic Testing ; Exostosin 2 ; Mutation ; China ; Prenatal Diagnosis ; Pregnancy ; Genetic Counseling ; Preimplantation Diagnosis ; Exome Sequencing ; East Asian People

ObjectiveTo evaluate the clinical efficacy of Shenqi Yangxin decoction in the treatment of ischemic cardiomyopathy （ICM） with Qi and Yin deficiency and blood stasis syndrome and its effect on serum hydrogen sulfide （H₂S） and calcium ion （Ca²⁺）. MethodsA total of 64 ICM patients with Qi and Yin deficiency and blood stasis syndrome who met the inclusion criteria were randomly divided into a control group （n=32） and a treatment group （n=32）. All patients received conventional Western medicine treatment. The treatment group was additionally given Shenqi Yangxin decoction. The TCM syndrome score， Minnesota Living with Heart Failure Questionnaire （MLHFQ） score， left ventricular ejection fraction （LVEF）， N-terminal pro-B-type natriuretic peptide （NT-proBNP）， 6-minute walk test （6MWT）， New York Heart Association （NYHA） cardiac function classification， and serum H₂S and Ca²⁺ levels were compared between the two groups pre- and post-treatment. ResultsTwo cases dropped out from each group during the study. Finally， 30 patients in each group were included in the analysis. There were no significant differences in age， gender， course of coronary heart disease， underlying diseases， and laboratory tests between the two groups. Compared with baseline， the TCM syndrome score， MLHFQ score， and NT-proBNP in both treatment group and control group decreased significantly （P<0.01）， LVEF， 6MWT， and H₂S increased significantly （P<0.01）， and serum Ca²⁺ increased （P<0.05）. Compared with the control group after treatment， the MLHFQ score and NT-proBNP in the treatment group decreased （P<0.05）， the TCM syndrome score decreased significantly （P<0.01）， LVEF， 6MWT， and serum Ca²⁺ increased （P<0.05）， and H₂S increased significantly （P<0.01）. The improvement degree of the NYHA cardiac function classification in the treatment group was higher than that in the control group， but there was no significant difference. ConclusionShenqi Yangxin decoction is effective in treating ICM patients with Qi and Yin deficiency and blood stasis， which could significantly improve cardiac function and quality of life， and its therapeutic effect may be related to the regulation of serum H₂S and Ca²⁺ levels.

BACKGROUND AND OBJECTIVE

Barangay Health Workers (BHW) are a crucial part of the local health system. Health services at the barangay level are heavily dependent on BHWs. However, despite their significant role in the local health system, support has been minimal and not commensurate with their contributions. The study aimed to identify the perceived external and internal factors that affect the performance of BHWs.

The study identified the BHW-perceived external and internal factors affecting performance, through mixed quantitative and qualitative methods. A self-administered questionnaire with a 4-point Likert scale that will assess the factors was given to 561 BHWs from five different upland municipalities of Cavite. A focus group discussion using open-ended questions was conducted to gain an in-depth understanding of their experiences. Emerging themes were reported into narratives.

BHWs maintained a strong level of participation at required health activities, but more than half were often late, owing to their volunteer status and external responsibilities. They were perceived to have a high sense of duty reflected by punctual submission of reports and confidence in delivering health services. Job satisfaction emerged as a substantial motivator while burnout was not a significant demotivator. Leadership and support from local government and health program management were perceived positively by most BHWs. Service delivery confidence was high among BHWs as reflected in their capability to provide expected services. BHWs perceived that challenges were present in terms of the adequacy of medicines and supplies, and on data transmission, although half were generally satisfied with the organization of health records. Human resources were perceived to be sufficient. Financial aspects showed that while most BHWs do not contribute personally to patient care, a significant minority shell out resources for patients, reflecting financial strains within the health system. The study also revealed the varying motivations for volunteering, including community service, staff shortages, knowledge acquisition, and additional income.

External and internal factors affect the performance of BHWs at the local level. These were related to current health systems, political climate, personal household duties, and financial status. Despite facing these challenges, the BHWs showed commendable involvement in local health programs. BHWs remained motivated through training opportunities and positive community feedback but were hindered by a lack of health science knowledge and the need for supplementary income.

Congenital divided nevus of the eyelids is a rare form of melanocytic nevus which involves contiguous portions of the upper and lower eyelid margins unilaterally, hence the term ‘kissing nevus’. While usually present at birth, these nevi may also appear later in life. When the mass enlarges, it may cause cosmetic issues to the patient, as well as functional problems such as mechanical ptosis, ectropion, and epiphora.

We report three cases of congenital divided nevus of the eyelids, all presenting with unilateral upper and lower hyperpigmented lid masses since birth. The first case had an upper lid mass measuring 11 mm x 19 mm, and a lower lid mass measuring 55 mm x 47 mm, with both masses extending into the palpebral conjunctiva, and causing severe ptosis and corneal neovascularization due to chronic irritation. The second case presented with hyperpigmented masses at the lateral third of the right upper eyelid measuring 8 mm x 17 mm and of the lower eyelid measuring 9 mm x 15 mm on the lower lid with lashes growing through the masses. There was extension of the mass into the palpebral conjunctiva. The third case presented with a 23 x 18 mm hyperpigmented, well-circumscribed, verrucated mass at the medial half of the upper eyelid crossing the eyelid margin, and a 15 x 13 mm lesion at the medial third of the lower lid with the same characteristics, with small crusty lesions and clotted blood. All three patients underwent excision biopsy with lid reconstruction using full thickness skin grafts from the supraclavicular area. Six months postoperatively, the first case underwent a repeat full thickness skin graft due to graft contraction, and also received two sessions of fractional carbon dioxide (CO2 ) laser, two sessions of intralesional triamcinolone injections, and silicone gel application with further improvement of graft healing and scarring. The second case also underwent two sessions of intralesional steroid injection for scar management. During follow-up, which spanned 13 months for the first case, 10 months for the second case, and two months for the third case, improved functional and cosmetic outcomes were observed.

This case series highlights the outcomes of the most common surgical technique done for congenital divided nevi of the eyelids. Congenital divided nevi are usually diagnosed clinically and malignant degeneration is rare, hence lid reconstruction may be done without frozen section. The cases in the series were treated due to cosmetic and functional purposes, hence the importance of continuous post-operative follow-up to monitor for graft dehiscence, scar development, recurrence of the mass, malignant degeneration, and development of lid malposition. Additional procedures for scar management, such as CO2 laser and intralesional steroid injections, may be necessary to further enhance outcomes in complex cases. All three cases in this series exhibited improved functional and cosmetic outcomes post-operatively, with significant reduction in ptosis and scarring. Longterm follow-up revealed satisfactory recovery with minimal complications, with no recurrence nor malignant degeneration.

BACKGROUND AND OBJECTIVE

Randomized controlled trials (RCTs) are essential for advancing evidence-based healthcare by evaluating the effectiveness and safety of health interventions. Despite the increasing recognition of clinical research, the Philippines has had limited contributions to global RCT output. This bibliometric analysis aims to assess the trends, characteristics, and impact of RCTs conducted in the Philippines and published online.

A systematic search of Medline (PubMed), and EMBASE, along with Acta Medica Philippina, was conducted to identify published RCTs from January 1990 to October 2022. Eligible studies were screened and analyzed based on publication trends, funding sources, study designs, research settings, and institutional contributions. Descriptive statistics were used to summarize key findings.

A total of 391 RCTs were identified, with a notable increase in number of RCTs published over time. Most studies (91.8%) were published in international journals, and funding was primarily sourced from pharmaceutical companies (47.1%). The predominant RCT design was two-arm parallel (64.7%), with hospitals being the most common research setting (54.2%). Research areas were led by infectious diseases, particularly vaccine-preventable illnesses (23.8%). While the University of the Philippines Manila (21.1%) and the Research Institute for Tropical Medicine (13.7%) were the leading institutions in terms of highest number of published RCTs, foreign authors accounted for nearly half (47.3%) of primary authorships. The most cited studies focused on cardiovascular diseases, infectious diseases, and oncology.

The increasing number of published RCTs in the Philippines reflects growth in research capacity and institutional engagement. Strengthening national research dissemination platforms and fostering regional collaborations will be essential in advancing the Philippines’ contribution to global clinical research.

Cancer stem cells (CSCs) represent a distinct subpopulation of cells characterized by self-renewal capacity, differentiation potential, and critical roles in driving tumor progression, therapeutic resistance, recurrence, and maintenance of the tumor microenvironment. Targeting CSCs has emerged as a pivotal direction in cancer research, offering novel strategies to overcome drug resistance and prevent metastasis and relapse. Lysosomes, traditionally recognized as central organelles for intracellular degradation and recycling, are indispensable for cellular homeostasis. Dysregulation of lysosomal function is intimately linked to various diseases, including cancer. In tumors, aberrant lysosomal activity can promote malignant progression through mechanisms such as altering metabolic pathways, enhancing lysosomal exocytosis, modulating drug resistance, and interfering with autophagy-lysosomal pathways. Recent studies have underscored the involvement of lysosomes in regulating CSC properties. This review synthesizes findings on lysosomal regulation of CSCs through the following aspects. (1) Lysosomes exert complex and critical bidirectional control over CSC stemness maintenance through three degradation pathways that are dependent on their degradative function. (i) The lysophagy pathway. This pathway exhibits dual roles. Activation can sustain CSC functions; for instance, in glioblastoma, hypoxia upregulates Gal-8 via the STAT3/HIF1α signaling axis to induce autophagy, supporting stem cell survival. In head and neck squamous cell carcinoma, degradation of GSK3β activates the Wnt pathway, enhancing stemness. Conversely, this pathway can suppress stemness by degrading stemness-related proteins such as BMI-1 and OCT4A, thereby impairing CSC self-renewal capacity. (ii) Mitophagy pathway. In non-small cell lung cancer stem cells, mitophagy-related mechanisms, such as the accumulation of mitochondrial DNA (mtDNA) activating the TLR9-Notch1-AMPK signaling axis, have been shown to promote CSC proliferation. (iii) Autophagosome-dependent lysosomal degradation pathway. This pathway directly regulates stemness-related proteins in a bidirectional manner. Enhanced degradative function can promote CSC properties, exemplified by the degradation of NUMB to activate Notch signaling. Conversely, attenuated degradative function can also enhance stemness by stabilizing oncoproteins (e.g., protecting Frizzled-1 from degradation to sustain Wnt signaling) or preventing the degradation of tumor suppressors (e.g., inhibiting Notch degradation). (2) Constituent proteins of lysosomes, including membrane proteins and luminal acid hydrolases, participate in regulating CSC stemness. Regarding membrane proteins, LAMP2A facilitates chaperone-mediated autophagy to maintain stemness in glioblastoma and ovarian cancer. V-ATPase, by maintaining an acidic luminal environment, promotes proliferation and drug resistance in glioma stem cells. Among hydrolases, cathepsins B and L are highly expressed in pancreatic and ovarian cancers and correlate with poor prognosis. Furthermore, targeting lysosomes to induce lysosomal membrane permeabilization (LMP) triggers lysosome-mediated cell death, presenting a potential therapeutic strategy for eradicating CSCs.(3) The acidic luminal environment, single-membrane structure, and the presence of transmembrane transporters (e.g., ABCA3) enable lysosomes to passively trap or actively uptake and sequester chemotherapeutic drugs. Subsequent drug extrusion via exocytosis confers drug resistance. In CSCs, this lysosome-mediated drug sequestration, often cooperating with autophagy, establishes multimodal drug resistance. Therefore, targeting lysosomal function represents a potential strategy to overcome therapy resistance. The central role of lysosomes in regulating CSC stemness and resistance positions them as highly promising therapeutic targets. Strategies aimed at disrupting lysosomal function to selectively eliminate CSCs include: inhibiting the lysosome-autophagy system using agents like IITZ or lovastatin; inducing lysosomal membrane permeabilization (LMP) with compounds such as hexamethylene amiloride to compromise membrane stability; and disrupting the acidic luminal environment using drugs like siramesine or the K/H transport compound 2. In conclusion, lysosomes critically regulate CSC stemness maintenance and drug resistance through degradative pathways, membrane protein functions, luminal hydrolase activities, and drug sequestration mechanisms. This redefines the lysosome from a traditional “waste disposal unit” to a “signal integration center” in CSCs. The duality and context-dependency of lysosomal function in CSCs offer novel insights into the heterogeneity observed across different tumors. Targeting lysosomal vulnerabilities—such as inducing LMP, disrupting acidity, or blocking autophagic flux—provides a strategy to bypass canonical CSC resistance mechanisms and directly trigger cell death. This establishes the lysosome as a key target to overcome CSC-mediated therapy resistance, paving the way for developing diverse candidate drugs and innovative combination therapies in oncology.

ObjectiveTo investigate the potential mechanism of Danggui Buxuetang （DBT） in the treatment of vascular dementia （VAD）. MethodsSixty male SD rats were randomly assigned to the sham-operated group， model group， DBT low-， medium-， and high-dose groups， and the donepezil group. Except for the sham-operated group， rats in all other groups underwent bilateral common carotid artery ligation. After successful modeling， DBT was administered at doses of 9.2， 18.4， 36.8 g·kg^-1 for the low-， medium-， and high-dose groups， respectively， while the donepezil group received 3 mg·kg^-1 donepezil solution by gavage once daily. After 4 consecutive weeks of drug treatment， rats underwent the Morris water maze test， novel object recognition test， Nissl staining to observe hippocampal neurons， and immunofluorescence staining to detect the expression of neuronal nuclear protein （NeuN） in the hippocampus. Western blot was used to assess the expression of PTEN-induced kinase 1 （PINK1）， Parkin， microtubule-associated protein 1 light chain 3Ⅱ （LC3Ⅱ）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax）. Transmission electron microscopy was used to observe hippocampal neuronal ultrastructure. Real-time PCR was used to detect the expression of NADPH oxidase subunits p22^phox and p47^phox in hippocampal tissues. The levels of malondialdehyde （MDA）， glutathione （GSH）， superoxide dismutase （SOD）， and total antioxidant capacity were measured to evaluate oxidative stress levels. ResultsIn the Morris water maze test， escape latency changed significantly over time in all groups except the model group. Compared with the sham-operated group， the model group showed significantly prolonged escape latency （P<0.01）. Compared with the model group， rats in the DBT groups and the donepezil group exhibited significantly shorter escape latency （P<0.05， P<0.01）. The number of crossings over the original platform was significantly reduced in the model group compared with the sham-operated group （P<0.01）， whereas rats in the DBT and donepezil groups showed significantly increased platform crossings compared with the model group （P<0.05， P<0.01）. Compared with the sham-operated group， exploration time of new objects was significantly reduced in the model group （P<0.01）. Compared with the model group， exploration time of new objects increased significantly in the medium- and high-dose DBT groups and the donepezil group （P<0.05， P<0.01）， while no significant change was observed in the low-dose DBT group. Compared with the high-dose DBT group， rats in the donepezil group had significantly prolonged escape latency and reduced platform crossings and new-object exploration time （P<0.05）. Nissl staining showed decreased density of healthy neurons in the CA1 and CA3 regions of the hippocampus in the model group， with loss of Nissl bodies and nuclear atrophy or disappearance. In the high-dose DBT group， neuronal density in CA1 and CA3 increased， with neurons arranged closely and displaying normal morphology. Immunofluorescence showed that compared with the sham-operated group， the hippocampal NeuN⁺ cell count in the VAD model group was significantly decreased（P<0.01）， compared with the VAD model group， the hippocampal NeuN⁺ cell count in the high-dose DBT group was significantly increased（P<0.01）. Compared with the sham-operated group， the expression of PINK1， Parkin， LC3Ⅱ， and Bax proteins was significantly increased（P<0.01）， while the expression of Bcl-2 was significantly decreased in the VAD model group（P<0.01）. Compared with the VAD model group， the high-dose DBT group showed significantly decreased expression of PINK1， Parkin， LC3Ⅱ， and Bax proteins（P<0.01）and significantly upregulated Bcl-2 expression（P<0.01）. The medium-dose DBT group exhibited significantly reduced expression of Parkin， LC3Ⅱ， and Bax proteins（P<0.05，P<0.01） and significantly increased Bcl-2 expression（P<0.01）， while no statistically significant differences were observed in the low-dose DBT group. Transmission electron microscopy showed mitochondrial pyknosis， thickened cristae， increased electron density， and the presence of mitochondrial autophagy in the model group. In contrast， hippocampal neurons in the high-dose DBT group contained abundant mitochondria with intact morphology， clear cristae， and uniform matrix. Compared with the sham-operated group， total antioxidant capacity， SOD activity， and GSH levels were significantly decreased， while MDA levels were significantly increased in the model group （P<0.01）. Compared with the model group， total antioxidant capacity and antioxidant levels （SOD， GSH） increased significantly， and MDA decreased significantly in the medium- and high-dose DBT groups （P<0.01）， while no significant changes were observed in the low-dose DBT group. Compared with the sham-operated group， mRNA expression of p22^phox and p47^phox was significantly increased in the model group （P<0.01）. Compared with the model group， expression of p22^phox and p47^phox was significantly decreased in the DBT groups （P<0.05， P<0.01）. ConclusionDBT may exert neuroprotective effects by regulating PINK1/Parkin-mediated mitochondrial autophagy， thereby improving learning and memory abilities and treating VAD.

ObjectiveTo observe the effect of Qishao capsules on renal injury in db/db mice with diabetic kidney disease （DKD），and explore its mechanism of protecting the kidney by inhibiting podocyte apoptosis. Methodsdb/m mice （7 mice） were used as the normal group，and db/db mice （35 mice） were randomly divided into a model group，a dapagliflozin group （0.001 g·kg^-1·d^-1），and low-，medium-，and high-dose groups of Qishao capsules （0.341 3，0.682 5，and 1.365 g·kg^-1·d^-1，respectively）. Drug intervention lasted for 8 consecutive weeks. After sampling，the serum renal function indicators ［creatinine（SCr），and urea nitrogen（BUN）］，fasting blood glucose （FBG），24 h urinary protein quantification （24 h-UTP）， and other indicators of the mice were measured. The pathological tissue morphology of the kidney was observed by periodic acid-silver methenamine （PASM） and Masson's trichrome （Masson） staining. Immunohistochemical detection of cysteine-dependent aspartate-specific protease （Caspase）-3 and B-cell lymphoma 2 （Bcl-2） was performed. Western blot was used to detect the protein expression of Caspase-8，Caspase-7，Caspase-3， and other molecules. Terminal deoxynucleotidyl transferase dUTP nick End labeling （TUNEL） staining was used to observe apoptosis in renal tissue. Immunofluorescence staining of Wilms tumor suppressor gene-1 （WT-1） was used to observe podocyte injury. Real-time polymerase chain reaction （Real-time PCR） was employed to detect Caspase-8 and Caspase-3 mRNA expression in the kidneys of experimental mice. Data analysis was conducted using statistical software GraphPad Prism 10. ResultsCompared with the normal group，the model group showed significantly increased 24 h-UTP，SCr，BUN，and FBG （P<0.01）. Additionally， PASM staining of renal tissue showed increased glycogen deposition，glomerular hypertrophy，and thickening of the basement membrane. Masson staining showed collagen fiber proliferation in renal tissue. Transmission electron microscopy showed thickening of the renal tissue basement membrane and fusion or loss of foot processes in the model group. The immunohistochemical results showed that Caspase-3 in the kidneys of the mice in the model group significantly increased （P<0.01），while the Bcl-2 protein expression level decreased significantly （P<0.01）. The number of TUNEL positive cells in renal tissue significantly increased （P<0.01）. The positive expression of WT-1 in podocytes was significantly reduced （P<0.01）. Western blot analysis showed significant upregulation of Caspase-8，Caspase-7，and Caspase-3 protein expression in renal tissue （P<0.01）. The mRNA expression levels of Caspase-8 and Caspase-3 in the kidneys increased significantly （P<0.01）. Compared with the model group，the Qishao capsules groups can significantly reduce the levels of 24 h-UTP，SCr，BUN，and FBG （P<0.01）. The pathological damage of renal tissue and podocyte injury were improved to some extent. Immunohistochemistry in the kidney showed a significant decrease in Caspase-3 （P<0.01） and a significant increase in Bcl-2 protein expression level （P<0.01）. Additionally， there were a significant decrease in the number of TUNEL positive cells in renal tissue （P<0.01），a significant increase in WT-1 positive expression in podocytes （P<0.01），marked downregulation of Caspase-8，Caspase-7，and Caspase-3 protein expression in renal tissue （P<0.05，P<0.01），and a significant decrease in Caspase-8 and Caspase-3 mRNA expression levels （P<0.01）. ConclusionQishao capsules can inhibit podocyte apoptosis by regulating the expression of Caspase-8，Caspase-7， and Caspase-3，thereby improving the diabetic renal injury in db/db mice.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.