1.Research advances in the diagnosis and treatment of Polycystic kidney disease.
Jiafa WU ; Yuru JING ; Xiaoyuan NING
Chinese Journal of Medical Genetics 2026;43(3):234-240
Polycystic kidney disease (PKD) is a group of inherited disorders characterized by cystic lesions in the kidneys and multiple organs, primarily including autosomal dominant polycystic kidney disease (ADPKD) and autosomal recessive polycystic kidney disease (ARPKD). ADPKD is mainly caused by variations in the PKD1 and PKD2 genes. Its clinical manifestations include progressive renal cyst growth, hypertension, and multi-system complications. ARPKD, on the other hand, is primarily caused by mutations in the PKHD1 gene. It commonly occurs in infants and young children, with hepatorenal cystic fibrosis being a key feature. Although there is currently no cure for PKD, the integration of multi-omics and precision medicine strategies holds promise for optimizing patient management and improving outcomes in the future. This review summarizes the genetic basis, pathogenic mechanisms, diagnostic techniques, and therapeutic advances in PKD, providing a reference for clinical practice and research.
Humans
;
Polycystic Kidney Diseases/genetics*
;
TRPP Cation Channels/genetics*
;
Mutation
;
Polycystic Kidney, Autosomal Dominant/therapy*
;
Receptors, Cell Surface
2.Effect of polycystin2 on differentiation and maturation of osteoblasts promoted by low-frequency pulsed electromagnetic fields.
Yueying HE ; Mingjun YANG ; Zhuo CHEN ; Peng WEI ; Kun QIN ; Gaoqian XIE ; Keming CHEN
Chinese Journal of Biotechnology 2022;38(3):1159-1172
It is known that low-frequency pulsed electromagnetic fields (PEMFs) can promote the differentiation and maturation of rat calvarial osteoblasts (ROBs) cultured in vitro. However, the mechanism that how ROBs perceive the physical signals of PEMFs and initiate osteogenic differentiation remains unknown. In this study, we investigated the relationship between the promotion of osteogenic differentiation of ROBs by 0.6 mT 50 Hz PEMFs and the presence of polycystin2 (PC2) located on the primary cilia on the surface of ROBs. First, immunofluorescence staining was used to study whether PC2 is located in the primary cilia of ROBs, and then the changes of PC2 protein expression in ROBs upon treatment with PEMFs for different time were detected by Western blotting. Subsequently, we detected the expression of PC2 protein by Western blotting and the effect of PEMFs on the activity of alkaline phosphatase (ALP), as well as the expression of Runx-2, Bmp-2, Col-1 and Osx proteins and genes related to bone formation after pretreating ROBs with amiloride HCl (AMI), a PC2 blocker. Moreover, we detected the expression of genes related to bone formation after inhibiting the expression of PC2 in ROBs using RNA interference. The results showed that PC2 was localized on the primary cilia of ROBs, and PEMFs treatment increased the expression of PC2 protein. When PC2 was blocked by AMI, PEMFs could no longer increase PC2 protein expression and ALP activity, and the promotion effect of PEMFs on osteogenic related protein and gene expression was also offset. After inhibiting the expression of PC2 using RNA interference, PEMFs can no longer increase the expression of genes related to bone formation. The results showed that PC2, located on the surface of primary cilia of osteoblasts, plays an indispensable role in perceiving and transmitting the physical signals from PEMFs, and the promotion of osteogenic differentiation of ROBs by PEMFs depends on the existence of PC2. This study may help to elucidate the mechanism underlying the promotion of bone formation and osteoporosis treatment in low-frequency PEMFs.
Alkaline Phosphatase/metabolism*
;
Animals
;
Electromagnetic Fields
;
Osteoblasts/metabolism*
;
Osteogenesis/genetics*
;
Rats
;
TRPP Cation Channels/physiology*
3.Analysis of PDK1 gene variants and prenatal diagnosis for eight pedigrees affected with autosomal dominant polycystic kidney disease.
Huijun LI ; Peixuan CAO ; Xiangyu ZHU ; Yujie ZHU ; Xing WU ; Jie LI
Chinese Journal of Medical Genetics 2022;39(9):932-937
OBJECTIVE:
To detect potential variants in eight Chinese pedigrees affected with autosomal dominant polycystic kidney disease (ADPKD) and provide prenatal diagnosis for two of them.
METHODS:
Whole exome sequencing and high-throughput sequencing were carried out to detect variants of PKD1 and PKD2 genes in the probands. Sanger sequencing was used to validate the variants, and their pathogenicity was predicted by searching the ADPKD and protein variation databases.
RESULTS:
Eight PKD1 variants were detected, which have included five nonsense mutations and three missense mutations. Among these, four nonsense variants (PKD1: c.7555C>T, c.7288C>T, c.4957C>T, c.11423G>A) were known to be pathogenic, whilst one missense variant (PKD1: c.2180T>G) was classified as likely pathogenic. Three novel variants were detected, which included c.6781G>T (p.Glu2261*), c.109T>G (p.Cys37Gly) and c.8495A>G (p.Asn2832Ser). Prenatal testing showed that the fetus of one family has carried the same mutation as the proband, while the fetus of another family did not.
CONCLUSION
PKD1 variants, including three novel variants, have been identified in the eight pedigrees affected with ADPKD. Based on these results, prenatal diagnosis and genetic counseling have been provided.
DNA Mutational Analysis/methods*
;
Female
;
Humans
;
Mutation
;
Pedigree
;
Polycystic Kidney, Autosomal Dominant/genetics*
;
Pregnancy
;
Prenatal Diagnosis
;
TRPP Cation Channels/genetics*
4.Genetic diagnosis and prenatal diagnosis of autosomal dominant polycystic kidney disease.
Chinese Journal of Medical Genetics 2019;36(5):419-423
OBJECTIVE:
To explore the genetic etiology for 17 pedigrees affected with autosomal dominant polycystic kidney disease (ADPKD).
METHODS:
Peripheral blood samples were derived from the probands and their parents with informed consent. Following DNA extraction, targeted capture and next generation sequencing were carried out in search for potential disease-causing variants. Sanger sequencing was used to validate candidate pathogenic variants co-segregating with the disease in each pedigree. Prenatal diagnosis was provided for one family.
RESULTS:
Among the 17 probands, 14 PKD1 mutations and 3 PKD2 mutations were detected, which included 6 missense mutations, 4 nonsense mutations and 7 frameshift mutations. Of these, 8 have been associated with ADPKD previously and 9 were novel, which included c.7625G>T (p.Gly2542Val), c.3673C>T (p.Gln1225*), c.11048dupT (p.Thr3684Aspfs*38), c.9083_9084delAG (p.Glu3028Glyfs*40), c.10560delG (p.Pro3521Hisfs*6), c.7952_7974del TGTCCCTGAGGGTCCACACTGTG (p.Val2651Glyfs*2) of PKD1, and c.662T>G (p.Leu221*), c.1202_1203 insCT (p.Glu401Aspfs*2), and c.919 delA (p.Ser307Valfs*10) of PKD2. Prenatal testing showed that the fetus did not carry the same mutation as the proband.
CONCLUSION
Identification of causative mutations in the 17 pedigrees affected with ADPKD has provided a basis for genetic counseling and reproductive guidance. The novel findings have enriched the mutational spectrum of the PKD1 and PKD2 genes.
DNA Mutational Analysis
;
Female
;
Humans
;
Mutation
;
Pedigree
;
Polycystic Kidney, Autosomal Dominant
;
Pregnancy
;
Prenatal Diagnosis
;
TRPP Cation Channels
5.Analysis of PKD1 gene mutation in a family affected with autosomal dominant polycystic kidney disease.
Jin MEI ; Min WANG ; Hao WANG ; Lidan ZHANG ; Pan ZHANG
Chinese Journal of Medical Genetics 2017;34(3):365-368
OBJECTIVETo determine the molecular etiology for a family affected with autosomal dominant polycystic kidney disease and provide prenatal diagnosis for the family.
METHODSClinical data of the family was collected. Target region sequencing with monogenetic disorders capture array combined with Sanger sequencing and bioinformatics analysis were performed in turn. SIFT and NCB1 were used to evaluate the conservation of the gene and pathogenicity of the identified mutation.
RESULTSTarget region sequencing has identified a novel c.11333C to A (p.T3778N) mutation of the PKD1 gene in the proband and the fetus, which was confirmed by Sanger sequencing in three affected individuals from the family. The same mutation was not detected in healthy members of the pedigree. Bioinformatics analysis suggested that the mutation has caused a likely pathogenic amino acid substitution of Threonine by Aspartic acid, and Clustal analysis indicated that the altered amino acid is highly conserved in mammals.
CONCLUSIONA novel mutation of the PKD1 gene has been identified in an affected Chinese family. The mutation is probably responsible for a range of clinical manifestations, for which reliable prenatal diagnosis and genetic counseling may be provided.
Adult ; Amino Acid Sequence ; Asian Continental Ancestry Group ; genetics ; Base Sequence ; China ; DNA Mutational Analysis ; Exons ; Female ; Humans ; Male ; Middle Aged ; Molecular Sequence Data ; Mutation ; Pedigree ; Polycystic Kidney, Autosomal Dominant ; genetics ; TRPP Cation Channels ; genetics ; Young Adult
6.Identification of a novel splicing mutation of PKD1 gene in a pedigree affected with autosomal dominant polycystic kidney disease.
Peiwen XU ; ; Yang ZOU ; Jie LI ; Sexin HUANG ; Ming GAO ; Ranran KANG ; Yuan GAO
Chinese Journal of Medical Genetics 2016;33(6):778-781
OBJECTIVETo identify potential mutations of PKD1 gene in a family affected with autosomal dominant polycystic kidney disease (ADPKD).
METHODSThe coding regions of the PKD1 gene were subjected to PCR and Sanger sequencing. Reverse transcription-PCR (RT-PCR) was used to determine the relative mRNA expression in the patient.
RESULTSA splicing site mutation, c.8791+1_8791+5delGTGCG (IVS23+1_+5delGTGCG), was detected in the PKD1 gene in all 5 patients from the pedigree but not in 6 phenotypically normal relatives and 40 healthy controls. Sequencing of RNA has confirmed that there were 8 bases inserted in the 3' end of exon 23 of the PKD1 gene.
CONCLUSIONThe novel c.8791+1_8791+5delGTGCG mutation has created a new splice site and led to a frameshift, which probably underlies the ADPKD in the family. Above finding has enriched the mutation spectrum of the PKD1 gene.
Adult ; Female ; Humans ; Male ; Mutation ; genetics ; Pedigree ; Polycystic Kidney, Autosomal Dominant ; genetics ; RNA Splicing ; genetics ; TRPP Cation Channels ; genetics ; Young Adult
7.Cyst growth, polycystins, and primary cilia in autosomal dominant polycystic kidney disease.
Kidney Research and Clinical Practice 2014;33(2):73-78
The primary cilium of renal epithelia acts as a transducer of extracellular stimuli. Polycystin (PC)1 is the protein encoded by the PKD1 gene that is responsible for the most common and severe form of autosomal dominant polycystic kidney disease (ADPKD). PC1 forms a complex with PC2 via their respective carboxy-terminal tails. Both proteins are expressed in the primary cilia. Mutations in either gene affect the normal architecture of renal tubules, giving rise to ADPKD. PC1 has been proposed as a receptor that modulates calcium signals via the PC2 channel protein. The effect of PC1 dosage has been described as the rate-limiting modulator of cystic disease. Reduced levels of PC1 or disruption of the balance in PC1/PC2 level can lead to the clinical features of ADPKD, without complete inactivation. Recent data show that ADPKD resulting from inactivation of polycystins can be markedly slowed if structurally intact cilia are also disrupted at the same time. Despite the fact that no single model or mechanism from these has been able to describe exclusively the pathogenesis of cystic kidney disease, these findings suggest the existence of a novel cilia-dependent, cyst-promoting pathway that is normally repressed by polycystin function. The results enable us to rethink our current understanding of genetics and cilia signaling pathways of ADPKD.
Calcium
;
Cilia*
;
Genetics
;
Kidney Diseases, Cystic
;
Polycystic Kidney, Autosomal Dominant*
;
Transducers
;
TRPP Cation Channels*
8.Identification of mutations in PKD1 and PKD2 genes in two Chinese families with autosomal dominant polycystic kidney disease.
Chao-wen YU ; Yuan YANG ; Si-zhong ZHANG
Chinese Journal of Medical Genetics 2011;28(5):485-489
OBJECTIVETo identify the responsible mutation of autosomal dominant polycystic kidney disease (ADPKD) in two Chinese families.
METHODSTotal genomic DNA of all available family members and 100 unrelated healthy controls was extracted from peripheral blood leukocytes using a standard phenol-chloroform procedure. All exons with intronic flanking sequences of the PKD1 and PKD2 genes in the probands were amplified by PCR. Mutations were detected directly by DNA sequencing. To evaluate the pathogenicity of the variations, family and control based analyses were performed.
RESULTSFive sequence variants were identified in the two families including PKD1 :c.2469G to A, PKD1:c.5014_5015delAG, PKD1:c.10529 C to T, PKD2:c.568G to A and PKD2:c.2020 1_2020delAG. Among them, PKD1:c.2469G to A and PKD2:c.2020 1_2020 delAG were novel mutations. Furthermore, the frameshift and splicing site mutations detected in the affected individuals were not detected in their unaffected relatives and 100 unrelated normal controls.
CONCLUSIONPKD1:c.5014_5015delAG and PKD2:c.2020 1_2020delAG are the responsible mutations of family A and B, respectively, and PKD2:c.2020 1_2020delAG is a de novo mutation.
Adult ; Amino Acid Substitution ; Asian Continental Ancestry Group ; genetics ; Base Sequence ; China ; Exons ; Female ; Humans ; Male ; Middle Aged ; Mutation ; genetics ; Polycystic Kidney, Autosomal Dominant ; genetics ; Polymorphism, Single Nucleotide ; genetics ; TRPP Cation Channels ; genetics
9.Recent advances in studies on autosomal dominant adult polycystic kidney disease.
Chinese Journal of Medical Genetics 2010;27(4):402-405
Adult polycystic kidney disease (APKD) is a severe autosomal dominant inheritable renal disease with high incidence. Because of the late-onset of the disease, patients might have transferred the disease gene to the next generation when diagnosis is made. Since its pathogenic molecular mechanism is still not completely clear and the shortage of effective medicines, the prevention and treatment of the disease is still not satisfactory. In the present article, the recent advances in the research on the pathogenesis, gene diagnosis and management of APKD are reviewed.
Aged
;
Female
;
Humans
;
Male
;
Middle Aged
;
Polycystic Kidney, Autosomal Dominant
;
genetics
;
Research
;
TRPP Cation Channels
;
genetics
10.TRPP subfamily and kidney diseases.
Jie ZHAO ; Wei YANG ; Jian-hong LUO
Journal of Zhejiang University. Medical sciences 2010;39(6):650-656
TRPP subfamily is an important member of transient receptor potential family. It has six transmembrane (TM) domains, a large extracellular loop between the first and second TM and 2-4 ankyrin repeats in the N terminal. TRPP subfamily includes TRPP2, TRPP3, TRPP5 etc. There are several differences in their structure, activation mode and function. TRPP subfamily is involved in many physiological mechanisms and its abnormal structure can lead to the formation of polycystic kidney. This subfamily is also closely related to gustation. In this review, we summarize recent research findings of TRPP subfamily and its association with polycystic kidney diseases.
Humans
;
Polycystic Kidney Diseases
;
genetics
;
metabolism
;
TRPP Cation Channels
;
chemistry
;
genetics
;
physiology

Result Analysis
Print
Save
E-mail