OBJECTIVES

In Asia, younger individuals (below age 45) are diagnosed to have type 2 diabetes with increased rates of obesity defined by lower BMI yet with greater visceral adiposity (waist circumference and waisthip ratios). The prevalence data on type 1 diabetes is not well established, considered to be low, but is seen to be increasing as well. This changing phenotype therefore, presents a clinical dilemma in terms of correctly classifying diabetes and deciding on the consequent appropriate treatment. Distinguishing type 1 from type 2 diabetes has become more difficult with type 2 diabetes dramatically increasing in young adults and children. This study aims to define the characteristics of diabetes among young adults in the Philippines to provide a basis for appropriate management amidst changes in diabetes phenotypes seen globally.

METHODS

In this cross-sectional analytic study, we characterized the demographic, metabolic, and autoimmune features of diabetes among young adult Filipinos aged 18 to 45 years old consulting at a tertiary referral center in Manila, Philippines. Baseline serum A1c, FBS, 75-g oral glucose tolerance test, insulin, serum C-peptide, insulin autoantibodies, leptin, adiponectin, lipid profile, and thyroid function tests were obtained from the participants and analyzed. The homeostasis model assessment (HOMA) was used to estimate the insulin sensitivity.

RESULTS

A total of 348 patients with diabetes were included, with females comprising two-thirds of the participants. The mean age at diagnosis of diabetes was 35.9±7.22 years. The mean BMI was 28.12 kg/m2, with median waist to hip ratio (WHR) of 0·93. Metabolic syndrome was found in 60% of participants and 67.82% were obese by body mass index. The mean A1c was 9.07±2.52%. Good glucose control (A1c less than 7.0%) was seen in 23% of participants  while nearly half (48%) had HbA1c which was >9.0%. The median levels of fasting insulin and C-peptide were 12.62 (range 1.33–90.42) mIU/L and 0.78 ng/mL (range 0–16.2), respectively. 

Included participants were diagnosed with diabetes within a year and as such, majority did not have any micro- or macrovascular complications. The most common diabetes complication was sensory neuropathy detected by monofilament testing, which was found in 28% of participants, followed by non-proliferative diabetic retinopathy in 13%. A history of previous diabetic ketoacidosis was found in 10 patients (2.87%). Glutamic acid decarboxylase (GAD) and insulin auto-antibodies were found in 3.2% and 19.3% of participants, respectively. Approximately half (51.73%) of the participants were insulin resistant by HOMA-IR.

CONCLUSION

In contrast with Caucasians and other Asians, diabetes among young Filipino adults is associated with lower BMI but with a similarly high visceral adiposity as shown by an elevated WHR. Metabolic syndrome with insulin resistance as defined by a variety of indices is predominant. Type 1 diabetes with autoantibodies occur in only a small fraction of this population. Data derived from this work can provide a framework for cluster analysis towards personalized management specific to this population.

Human ; Acids ; Adiponectin ; Adiposity ; Adult ; Aged ; Antibodies ; Asia ; Asian ; Asian Continental Ancestry Group ; Autoantibodies ; Body Mass Index ; C-peptide ; Carboxy-lyases ; Child ; Cluster Analysis ; Demography ; Diabetes Complications ; Diabetes Mellitus ; Diabetes Mellitus, Type 1 ; Diabetes Mellitus, Type 2 ; Diabetic Ketoacidosis ; Diabetic Retinopathy ; Diagnosis ; Fasting ; Female ; Glucose ; Glucose Tolerance Test ; Glutamate Decarboxylase ; Glutamic Acid ; Insulin ; Insulin Resistance ; Ketosis ; Leptin ; Lipids ; Metabolic Syndrome ; Obesity ; Patients ; Peptides ; Phenotype ; Philippines ; Population ; Prevalence ; Serum ; Therapeutics ; Thyroid Gland ; Thyroid Function Tests ; Young Adult

Introduction: Prediabetes or intermediate hyperglycemia (IH) represents a critical phase in the trajectory toward type 2 diabetes mellitus (T2DM). Recent evidence from the International Diabetes Federation (IDF) suggests that 1-hour OGTT (1HOGTT) ≥8.6 mmol/L is a more sensitive biomarker for early beta-cell dysfunction, with enhanced detection of IH and future T2DM risk. Conventional screening using hemoglobin A1c (HbA1c) or 2-Hour OGTT (2HOGTT) may delay identification of prediabetes, narrowing the window for early intervention. This study evaluates 1HOGTT as a screening tool for prediabetes among Malaysians. Methodology: This cross-sectional study enrolled adults without prior T2DM or prediabetes. Participants underwent 1HOGTT, 2HOGTT, and HbA1c, classified as per the Malaysian Clinical Practice Guideline for T2DM (6th Edition) and IDF 2024 criteria. Agreement between tests was assessed using McNemar’s test and Cohen’s kappa. Diagnostic accuracy was evaluated via receiver operating characteristic (ROC) curve analysis. Cost-effectiveness was determined using reagent cost only. Results: The majority of the 310 participants were female (71.6%), Malay (87.1%), with average age of 40. The 1HOGTT identified prediabetes in 21.6% (n = 67) compared to 17.1% (n = 53) by HbA1c and 2.6% (n = 8) by 2HOGTT. McNemar’s test confirmed statistically significant discordance between 1HOGTT and 2HOGTT (chi-square = 53.397, p <0.001): 61 participants were prediabetic by 1HOGTT but normal by 2HOGTT, versus only 2 in the reverse direction. No significant discordance was found between 1HOGTT and HbA1c (chi-square = 2.817, p = 0.093). 1HOGTT demonstrated excellent discriminatory ability against 2HOGTT (AUC = 0.908; 95% CI: 0.837–0.978), significantly outperforming HbA1c (AUC = 0.664; CI: 0.462– 0.867; DeLong p = 0.012). In a population-level cost analysis, 1HOGTT achieved lowest cost per prediabetes case detected (RM 5.79) – approximately 8.3 times and 8.1 times more cost-effective than 2HOGTT (RM 48.08) and HbA1c (RM 46.78) respectively. Conclusion 1HOGTT identifies a significant proportion of individuals with prediabetes missed by 2HOGTT and HbA1c. Incorporating 1HOGTT enhances the detection of prediabetes, is cost-effective, and enables timely preventive measures in our population with high diabetes burden.
Glucose Tolerance Test ; Glycated Hemoglobin ; Prediabetic State

Objective:To investigate the potential characteristic manifestations and application value of the Dynamic Visual Acuity Test（DVAT） in vestibular migraine（VM）. Methods:A total of 50 VM patients（case group） and 50 healthy subjects（control group） diagnosed at the Department of Otorhinolaryngology Head and Neck Surgery, First Hospital of Shanxi Medical University between November 1, 2023, and December 31, 2024, were enrolled. The case group underwent DVAT, video head impulse test（vHIT）, caloric test, and Dizziness Handicap Inventory（DHI） assessment, whereas the control group only received DVAT. Group-based analyses were conducted to examine the effect of age on Dynamic Visual Acuity Loss（DVALoss）, as well as the correlations of DVALoss with vestibular function tests and DHI scores. Results:DVALoss in the case group was significantly higher than that in the control group（P<0.001）. In both groups, age was significantly and positively correlated with DVALoss（P<0.001）. Within the case group, DVALoss was strongly and positively correlated with DHI scores（r=0.807, P<0.001）; it was negatively correlated with the vestibulo-ocular reflex（VOR） gain in vHIT, though without clinical significance, and showed no significant association with the caloric test. Age and DVALoss collectively accounted for 71.3% of the variance in DHI scores（R²=0.713）, with age exerting a relatively minor actual impact. Conclusion:DVAT can sensitively identify the core functional impairments of VM. DVALoss, as a direct functional reflection of the pathological mechanism of VM, is strongly correlated with DHI scores. Incorporating DVALoss into standardized assessments may provide an objective basis for the diagnosis and management of VM.
Humans ; Migraine Disorders/diagnosis* ; Visual Acuity ; Case-Control Studies ; Head Impulse Test ; Vestibular Function Tests ; Female ; Male ; Adult ; Vestibular Diseases/physiopathology* ; Middle Aged ; Caloric Tests

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To analyze the clinical features and laboratory characteristics of patients with cold agglutinin disease (CAD)/cold agglutinin syndrome (CAS) who were positive for acidified-serum lysis test (Ham test), and to compare them with Ham test negative CAD/CAS patients and paroxysmal nocturnal hemoglobinuria (PNH) patients, in order to provide references for the differential diagnosis of these diseases. METHODS: 53 patients diagnosed with CAD/CAS and 67 patients diagnosed with classic PNH in our hospital from January 2015 to December 2020 were retrospectively analyzed. The patients were grouped according to clinical diagnosis and results of cold agglutinin test (CAT), direct antiglobulin test (DAT), Ham test and PNH clone detection. The clinical and laboratory characteristics of each group were compared. RESULTS: The patients were grouped as follows: Ham^- CAD/CAS group, CAD/CAS patients negative for Ham test (n=36); Ham⁺ CAD/CAS group, CAD/CAS patients positive for Ham test (n=17); classic PNH group (n=67). Compared with the classic PNH group, the Ham⁺ CAD/CAS group had a higher median age (P =0.024), weaker positivity of Ham test, higher positive rates of CAT and DAT, and lower positive rate of PNH clone detection (all P <0.001). The proportions of patients with splenomegaly and cyanosis in Ham⁺ CAD/CAS group were significantly higher than those in classic PNH group (P =0.002 and P <0.001). Ham⁺ CAD/CAS group displayed lower red blood cell count (RBC) and lactate dehydrogenase (LDH) level (P =0.007 and P <0.001), and higher mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), and indirect bilirubin (IBIL) level (P =0.003, P =0.004 and P =0.006) than those in classic PNH group. The levels of serum complement C3 and C4 in Ham⁺ CAD/CAS group were lower than those in classic PNH group (P =0.001 and P <0.001). The positive rate of urinary occult blood in Ham⁺ CAD/CAS group was lower than that in classic PNH group (P =0.010). The clinical and laboratory characteristics of Ham⁺ CAD/CAS group were similar to those of Ham^- CAD/CAS group, except for median age, hemoglobin (Hb), MCHC, mean corpuscular volume (MCV), reticulocyte ratio (Ret), Ham test results, DAT positive types, and proportion of splenomegaly. CONCLUSION Some clinical features and laboratory indicators of CAD/CAS patients with positive results of Ham test are different from those of classic PNH patients, but relatively similar to those of CAD/CAS patients with negative results of Ham test. These results may provide a reference for differential diagnosis of related diseases.
Humans ; Anemia, Hemolytic, Autoimmune/blood* ; Retrospective Studies ; Hemoglobinuria, Paroxysmal/diagnosis* ; Female ; Male ; Coombs Test ; Diagnosis, Differential ; Middle Aged ; Adult

Objective To evaluate the value of pre-ascent 6-minute walking test performed at a high altitude in predicting the incidence of acute mountain sickness(AMS)induced by rapid ascent to a very high altitude.Methods After baseline information was collected,participants completed the 6-minute walking test at a high altitude of 2 900 m.Then,they rapidly ascended to a very high altitude of 5 000 m.The Lake Louise score was recorded to assess AMS.Results The AMS group showed a shorter pre-ascent 6-minute walking distance(6MWD)at the high altitude than the non-AMS group[480.00(450.00,521.75)m vs.546.00(516.50,568.50)m,P=0.006].No difference was observed regarding the pre-ascent heart rate or peripheral oxygen saturation(both P>0.05).The pre-ascent 6MWD at the high altitude was negatively correlated with the Lake Louise score assessed after rapid ascent to the very high altitude(r=-0.497,P=0.012).Logistic regression analysis confirmed that the pre-ascent 6MWD at the high altitude was associated with the risk of AMS induced by rapid ascent to the very high altitude(OR=0.971,95% CI=0.947-0.996,P=0.022).The results indicated that the pre-ascent 6MWD demonstrated ideal prediction performance(area under receiver operating characteristic curve=0.846,P=0.006).Conclusion The pre-ascent 6MWD recorded at the high altitude is a convenient and reliable predictor of the AMS induced by rapid ascent to the very high altitude.
Humans ; Altitude Sickness/diagnosis* ; Male ; Adult ; Female ; Young Adult ; Middle Aged ; Acute Disease ; Walk Test ; Walking ; Altitude ; Exercise Test

Post-stroke aphasia is associated with a significantly elevated risk of depression, yet the underlying mechanisms remain unclear. This study recorded 64-channel electroencephalogram data and depression scale scores from 12 aphasic patients with depression, 8 aphasic patients without depression, and 12 healthy controls during resting state and an emotional Stroop task. Spectral and microstate analyses were conducted to examine brain activity patterns across conditions. Results showed that depression scores significantly negatively explained the occurrence of microstate class C and positively explained the transition probability from microstate class A to B. Furthermore, aphasic patients with depression exhibited increased alpha-band activation in the frontal region. These findings suggest distinct neural features in aphasic patients with depression and offer new insights into the mechanisms contributing to their heightened vulnerability to depression.
Humans ; Electroencephalography ; Aphasia/etiology* ; Stroop Test ; Emotions/physiology* ; Depression/etiology* ; Male ; Female ; Middle Aged ; Stroke/complications* ; Brain/physiopathology* ; Aged ; Adult ; Rest/physiology*

OBJECTIVES

Gestational diabetes mellitus (GDM), a pregnancy-induced hyperglycemia, affects approximately 17% of pregnancies globally. Its pathophysiology remains unclear, with inflammation and vascular remodeling playing key roles. CD248, a glycoprotein linked to inflammation and vascular remodeling, has been implicated in various conditions, but its role in GDM is uncertain.

METHODOLOGY

A prospective case-control study was conducted with 169 pregnant women aged 18 to 49 at a tertiary hospital. Serum CD248 levels were assessed at 24 to 28 weeks of gestation prior to the oral glucose tolerance test (OGTT). Statistical analyses evaluated the association between CD248 levels, BMI and GDM status.

RESULTS

Of the participants, 32 (18.9%) were diagnosed with GDM. CD248 levels were lower in GDM patients (8.15 ± 10.16 ng/mL) than in controls (11.42 ± 15.44 ng/mL), but the difference was not statistically significant (p = 0.084). Although CD248 levels did not correlate with OGTT values, it was positively associated with BMI (pCONCLUSION

Unlike earlier findings associating elevated CD248 levels with early pregnancy GDM risk, this study found no significant relationship during later gestational stages. These results highlight a potentially complex and context-dependent role for CD248 in GDM pathophysiology.

Human ; Diabetes, Gestational ; Inflammation ; Glucose Tolerance Test

BACKGROUND: The role of inflammation in the development of gestational diabetes mellitus (GDM) has recently become a focus of research. The systemic immune-inflammation index (SII) and systemic inflammation response index (SIRI), novel indices, reflect the body's chronic immune-inflammatory state. This study aimed to investigate the associations between the SII or SIRI and GDM. METHODS: A prospective birth cohort study was conducted at Beijing Obstetrics and Gynecology Hospital from February 2018 to December 2020, recruiting participants in their first trimester of pregnancy. Baseline SII and SIRI values were derived from routine clinical blood results, calculated as follows: SII = neutrophil (Neut) count × platelet (PLT) count/lymphocyte (Lymph) count, SIRI = Neut count × monocyte (Mono) count/Lymph count, with participants being grouped by quartiles of their SII or SIRI values. Participants were followed up for GDM with a 75-g, 2-h oral glucose tolerance test (OGTT) at 24-28 weeks of gestation using the glucose thresholds of the International Association of Diabetes and Pregnancy Study Groups (IADPSG). Logistic regression was used to analyze the odds ratios (ORs) (95% confidence intervals [CIs]) for the the associations between SII, SIRI, and the risk of GDM. RESULTS: Among the 28,124 women included in the study, the average age was 31.8 ± 3.8 years, and 15.76% (4432/28,124) developed GDM. Higher SII and SIRI quartiles were correlated with increased GDM rates, with rates ranging from 12.26% (862/7031) in the lowest quartile to 20.10% (1413/7031) in the highest quartile for the SII ( Ptrend <0.001) and 11.92-19.31% for the SIRI ( Ptrend <0.001). The ORs (95% CIs) of the second, third, and fourth SII quartiles were 1.09 (0.98-1.21), 1.21 (1.09-1.34), and 1.39 (1.26-1.54), respectively. The SIRI findings paralleled the SII outcomes. For the second through fourth quartiles, the ORs (95% CIs) were 1.24 (1.12-1.38), 1.41 (1.27-1.57), and 1.64 (1.48-1.82), respectively. These associations were maintained in subgroup and sensitivity analyses. CONCLUSION The SII and SIRI are potential independent risk factors contributing to the onset of GDM.
Humans ; Female ; Pregnancy ; Diabetes, Gestational/immunology* ; Prospective Studies ; Adult ; Inflammation/immunology* ; Glucose Tolerance Test ; Birth Cohort

BACKGROUND: The prevalence of pre-diabetes and diabetes mellitus type 2 (DMT2) among Filipinos exceeds 20%. Progressive loss of insulin sensitivity can occur with fasting blood sugar (FBS) ≥90 mg/dL. Studies among Asians with pre- diabetes show a higher prevalence of DMT2 diagnosed by 75 g oral glucose tolerance test (OGTT), the gold standard, which remains underutilized. OBJECTIVE: This prospective, observational, single-center study included adult patients admitted between January 2022 to August 2022 who were diagnosed with ARF type 1 and/or 2 and who were hooked to NIV as oxygen supplementation. METHODOLOGY: This cross-sectional analysis was conducted in the outpatient departments of two hospitals in Cebu City. Ninety-five adult Filipino patients with FBS < 126 mg/dL but with risk factors for DMT2 had HbA1c and 75 g OGTT taken. Test performance and receiver operating characteristic curves were computed for the optimal FBS and HbA1c threshold. RESULTS: Pre-diabetes or DMT2 was prevalent among 66% of participants. Using 75 g OGTT, 23% reached levels indicative of DMT2 but had normal or impaired fasting glucose, while this was found in 20% with pre-diabetic glycated hemoglobin (HbA1c) levels. HbA1c was more accurate than FBS. CONCLUSION Performing 75 g OGTT for high-risk Filipinos with FBS ≥94.2 mg/dL or HbA1c ≥5.6% is highly predictive of a change in glucose tolerance status to pre-diabetes, while an FBS ≥106 mg/dL or HbA1c ≥5.8% is predictive of DMT2. Lower cut-off levels promote earlier detection and intervention. Hypertension and age ≥35 years old were significantly associated with such conditions.
Human ; Diabetes Mellitus ; Prediabetic State ; Glycated Hemoglobin ; Glucose Tolerance Test