1.Associations of systemic immune-inflammation index and systemic inflammation response index with maternal gestational diabetes mellitus: Evidence from a prospective birth cohort study.
Shuanghua XIE ; Enjie ZHANG ; Shen GAO ; Shaofei SU ; Jianhui LIU ; Yue ZHANG ; Yingyi LUAN ; Kaikun HUANG ; Minhui HU ; Xueran WANG ; Hao XING ; Ruixia LIU ; Wentao YUE ; Chenghong YIN
Chinese Medical Journal 2025;138(6):729-737
BACKGROUND:
The role of inflammation in the development of gestational diabetes mellitus (GDM) has recently become a focus of research. The systemic immune-inflammation index (SII) and systemic inflammation response index (SIRI), novel indices, reflect the body's chronic immune-inflammatory state. This study aimed to investigate the associations between the SII or SIRI and GDM.
METHODS:
A prospective birth cohort study was conducted at Beijing Obstetrics and Gynecology Hospital from February 2018 to December 2020, recruiting participants in their first trimester of pregnancy. Baseline SII and SIRI values were derived from routine clinical blood results, calculated as follows: SII = neutrophil (Neut) count × platelet (PLT) count/lymphocyte (Lymph) count, SIRI = Neut count × monocyte (Mono) count/Lymph count, with participants being grouped by quartiles of their SII or SIRI values. Participants were followed up for GDM with a 75-g, 2-h oral glucose tolerance test (OGTT) at 24-28 weeks of gestation using the glucose thresholds of the International Association of Diabetes and Pregnancy Study Groups (IADPSG). Logistic regression was used to analyze the odds ratios (ORs) (95% confidence intervals [CIs]) for the the associations between SII, SIRI, and the risk of GDM.
RESULTS:
Among the 28,124 women included in the study, the average age was 31.8 ± 3.8 years, and 15.76% (4432/28,124) developed GDM. Higher SII and SIRI quartiles were correlated with increased GDM rates, with rates ranging from 12.26% (862/7031) in the lowest quartile to 20.10% (1413/7031) in the highest quartile for the SII ( Ptrend <0.001) and 11.92-19.31% for the SIRI ( Ptrend <0.001). The ORs (95% CIs) of the second, third, and fourth SII quartiles were 1.09 (0.98-1.21), 1.21 (1.09-1.34), and 1.39 (1.26-1.54), respectively. The SIRI findings paralleled the SII outcomes. For the second through fourth quartiles, the ORs (95% CIs) were 1.24 (1.12-1.38), 1.41 (1.27-1.57), and 1.64 (1.48-1.82), respectively. These associations were maintained in subgroup and sensitivity analyses.
CONCLUSION
The SII and SIRI are potential independent risk factors contributing to the onset of GDM.
Humans
;
Female
;
Pregnancy
;
Diabetes, Gestational/immunology*
;
Prospective Studies
;
Adult
;
Inflammation/immunology*
;
Glucose Tolerance Test
;
Birth Cohort
2.A study on electroencephalogram characteristics of depression in patients with aphasia based on resting state and emotional Stroop task.
Siyuan DING ; Yan ZHU ; Chang SHI ; Banghua YANG
Journal of Biomedical Engineering 2025;42(3):488-495
Post-stroke aphasia is associated with a significantly elevated risk of depression, yet the underlying mechanisms remain unclear. This study recorded 64-channel electroencephalogram data and depression scale scores from 12 aphasic patients with depression, 8 aphasic patients without depression, and 12 healthy controls during resting state and an emotional Stroop task. Spectral and microstate analyses were conducted to examine brain activity patterns across conditions. Results showed that depression scores significantly negatively explained the occurrence of microstate class C and positively explained the transition probability from microstate class A to B. Furthermore, aphasic patients with depression exhibited increased alpha-band activation in the frontal region. These findings suggest distinct neural features in aphasic patients with depression and offer new insights into the mechanisms contributing to their heightened vulnerability to depression.
Humans
;
Electroencephalography
;
Aphasia/etiology*
;
Stroop Test
;
Emotions/physiology*
;
Depression/etiology*
;
Male
;
Female
;
Middle Aged
;
Stroke/complications*
;
Brain/physiopathology*
;
Aged
;
Adult
;
Rest/physiology*
3.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
4.Clinical and Laboratory Characteristics of Cold Agglutinin Disease Patients with Positive Results of Acidified-Serum Lysis Test.
Zhao WANG ; Xiao-Xue WANG ; Run-Lin AN ; Li-Jin BO ; Yu-Ping ZHAO
Journal of Experimental Hematology 2025;33(2):575-579
OBJECTIVE:
To analyze the clinical features and laboratory characteristics of patients with cold agglutinin disease (CAD)/cold agglutinin syndrome (CAS) who were positive for acidified-serum lysis test (Ham test), and to compare them with Ham test negative CAD/CAS patients and paroxysmal nocturnal hemoglobinuria (PNH) patients, in order to provide references for the differential diagnosis of these diseases.
METHODS:
53 patients diagnosed with CAD/CAS and 67 patients diagnosed with classic PNH in our hospital from January 2015 to December 2020 were retrospectively analyzed. The patients were grouped according to clinical diagnosis and results of cold agglutinin test (CAT), direct antiglobulin test (DAT), Ham test and PNH clone detection. The clinical and laboratory characteristics of each group were compared.
RESULTS:
The patients were grouped as follows: Ham- CAD/CAS group, CAD/CAS patients negative for Ham test (n=36); Ham+ CAD/CAS group, CAD/CAS patients positive for Ham test (n=17); classic PNH group (n=67). Compared with the classic PNH group, the Ham+ CAD/CAS group had a higher median age (P =0.024), weaker positivity of Ham test, higher positive rates of CAT and DAT, and lower positive rate of PNH clone detection (all P <0.001). The proportions of patients with splenomegaly and cyanosis in Ham+ CAD/CAS group were significantly higher than those in classic PNH group (P =0.002 and P <0.001). Ham+ CAD/CAS group displayed lower red blood cell count (RBC) and lactate dehydrogenase (LDH) level (P =0.007 and P <0.001), and higher mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), and indirect bilirubin (IBIL) level (P =0.003, P =0.004 and P =0.006) than those in classic PNH group. The levels of serum complement C3 and C4 in Ham+ CAD/CAS group were lower than those in classic PNH group (P =0.001 and P <0.001). The positive rate of urinary occult blood in Ham+ CAD/CAS group was lower than that in classic PNH group (P =0.010). The clinical and laboratory characteristics of Ham+ CAD/CAS group were similar to those of Ham- CAD/CAS group, except for median age, hemoglobin (Hb), MCHC, mean corpuscular volume (MCV), reticulocyte ratio (Ret), Ham test results, DAT positive types, and proportion of splenomegaly.
CONCLUSION
Some clinical features and laboratory indicators of CAD/CAS patients with positive results of Ham test are different from those of classic PNH patients, but relatively similar to those of CAD/CAS patients with negative results of Ham test. These results may provide a reference for differential diagnosis of related diseases.
Humans
;
Anemia, Hemolytic, Autoimmune/blood*
;
Retrospective Studies
;
Hemoglobinuria, Paroxysmal/diagnosis*
;
Female
;
Male
;
Coombs Test
;
Diagnosis, Differential
;
Middle Aged
;
Adult
5.Clinical application of dynamic visual acuity testing in patients with vestibular migraine.
Hongyan SHI ; Yujun LI ; Wanting ZHANG ; Jie YANG ; Jiaxin WU ; Yulin LI ; Liyuan ZHOU ; Ying LI ; Ganggang CHEN
Journal of Clinical Otorhinolaryngology Head and Neck Surgery 2025;39(10):912-917
Objective:To investigate the potential characteristic manifestations and application value of the Dynamic Visual Acuity Test(DVAT) in vestibular migraine(VM). Methods:A total of 50 VM patients(case group) and 50 healthy subjects(control group) diagnosed at the Department of Otorhinolaryngology Head and Neck Surgery, First Hospital of Shanxi Medical University between November 1, 2023, and December 31, 2024, were enrolled. The case group underwent DVAT, video head impulse test(vHIT), caloric test, and Dizziness Handicap Inventory(DHI) assessment, whereas the control group only received DVAT. Group-based analyses were conducted to examine the effect of age on Dynamic Visual Acuity Loss(DVALoss), as well as the correlations of DVALoss with vestibular function tests and DHI scores. Results:DVALoss in the case group was significantly higher than that in the control group(P<0.001). In both groups, age was significantly and positively correlated with DVALoss(P<0.001). Within the case group, DVALoss was strongly and positively correlated with DHI scores(r=0.807, P<0.001); it was negatively correlated with the vestibulo-ocular reflex(VOR) gain in vHIT, though without clinical significance, and showed no significant association with the caloric test. Age and DVALoss collectively accounted for 71.3% of the variance in DHI scores(R²=0.713), with age exerting a relatively minor actual impact. Conclusion:DVAT can sensitively identify the core functional impairments of VM. DVALoss, as a direct functional reflection of the pathological mechanism of VM, is strongly correlated with DHI scores. Incorporating DVALoss into standardized assessments may provide an objective basis for the diagnosis and management of VM.
Humans
;
Migraine Disorders/diagnosis*
;
Visual Acuity
;
Case-Control Studies
;
Head Impulse Test
;
Vestibular Function Tests
;
Female
;
Male
;
Adult
;
Vestibular Diseases/physiopathology*
;
Middle Aged
;
Caloric Tests
6.Value of 6-Minute Walking Test in Predicting Acute Mountain Sickness.
Yu-Fan JIANG ; Qiang MA ; Hai-Wei CHEN ; Bao-Shi HAN ; Bin FENG ; Yun-Dai CHEN
Acta Academiae Medicinae Sinicae 2025;47(4):535-541
Objective To evaluate the value of pre-ascent 6-minute walking test performed at a high altitude in predicting the incidence of acute mountain sickness(AMS)induced by rapid ascent to a very high altitude.Methods After baseline information was collected,participants completed the 6-minute walking test at a high altitude of 2 900 m.Then,they rapidly ascended to a very high altitude of 5 000 m.The Lake Louise score was recorded to assess AMS.Results The AMS group showed a shorter pre-ascent 6-minute walking distance(6MWD)at the high altitude than the non-AMS group[480.00(450.00,521.75)m vs.546.00(516.50,568.50)m,P=0.006].No difference was observed regarding the pre-ascent heart rate or peripheral oxygen saturation(both P>0.05).The pre-ascent 6MWD at the high altitude was negatively correlated with the Lake Louise score assessed after rapid ascent to the very high altitude(r=-0.497,P=0.012).Logistic regression analysis confirmed that the pre-ascent 6MWD at the high altitude was associated with the risk of AMS induced by rapid ascent to the very high altitude(OR=0.971,95% CI=0.947-0.996,P=0.022).The results indicated that the pre-ascent 6MWD demonstrated ideal prediction performance(area under receiver operating characteristic curve=0.846,P=0.006).Conclusion The pre-ascent 6MWD recorded at the high altitude is a convenient and reliable predictor of the AMS induced by rapid ascent to the very high altitude.
Humans
;
Altitude Sickness/diagnosis*
;
Male
;
Adult
;
Female
;
Young Adult
;
Middle Aged
;
Acute Disease
;
Walk Test
;
Walking
;
Altitude
;
Exercise Test
7.Evaluating serum endosialin (CD248) levels as a diagnostic marker in gestational diabetes.
Tevfik Berk BILDACI ; Can ATA ; Ufuk ATLIHAN ; Huseyin Aytug AVSAR ; Selcuk ERKILINC
Journal of the ASEAN Federation of Endocrine Societies 2025;40(2):65-68
OBJECTIVES
Gestational diabetes mellitus (GDM), a pregnancy-induced hyperglycemia, affects approximately 17% of pregnancies globally. Its pathophysiology remains unclear, with inflammation and vascular remodeling playing key roles. CD248, a glycoprotein linked to inflammation and vascular remodeling, has been implicated in various conditions, but its role in GDM is uncertain.
METHODOLOGYA prospective case-control study was conducted with 169 pregnant women aged 18 to 49 at a tertiary hospital. Serum CD248 levels were assessed at 24 to 28 weeks of gestation prior to the oral glucose tolerance test (OGTT). Statistical analyses evaluated the association between CD248 levels, BMI and GDM status.
RESULTSOf the participants, 32 (18.9%) were diagnosed with GDM. CD248 levels were lower in GDM patients (8.15 ± 10.16 ng/mL) than in controls (11.42 ± 15.44 ng/mL), but the difference was not statistically significant (p = 0.084). Although CD248 levels did not correlate with OGTT values, it was positively associated with BMI (pCONCLUSION
Unlike earlier findings associating elevated CD248 levels with early pregnancy GDM risk, this study found no significant relationship during later gestational stages. These results highlight a potentially complex and context-dependent role for CD248 in GDM pathophysiology.
Human ; Diabetes, Gestational ; Inflammation ; Glucose Tolerance Test
8.A systematic review of the accuracy of Insulin and C-peptide secretion ratios during the oral glucose tolerance test to diagnose insulinoma
Fransiskus Mikael Chandra ; Dicky Tahapary
Journal of the ASEAN Federation of Endocrine Societies 2024;39(1):79-83
Background:
Insulinoma is one of the causes of recurrent hypoglycemia, one of the chief complaints for emergency department admission. The gold standard in diagnosing insulinoma is a 72-hour fasting test which is inconvenient and inefficient as it requires hospitalization. Research has found that measurement of insulin and C-peptide during OGTT may help diagnose insulinoma. We aimed to assess the diagnostic value of OGTT in diagnosing insulinoma.
Methodology:
The literature search was conducted on 19 August 2022 using several databases (MEDLINE, Scopus, Embase, and ScienceDirect). All studies that measured OGTT as diagnostic tools in diagnosing insulinoma and 72-hour fasting test as reference standard were included. The quality assessment of the selected studies was based on the Centre of Evidence-Based Medicine University of Oxford and the Quality Assessment of Diagnostic Accuracy-2 tool (QUADAS-2). Analysis of the included studies was performed qualitatively. This study was registered on PROSPERO (CRD42022360205).
Results:
A total of two case-control studies (106 patients) were included, which were at risk of bias and low concern of applicability. Both studies demonstrated that the combination of insulin and C-peptide levels measured during OGTT had high specificity, sensitivity, positive predictive value, and negative predictive value in diagnosing insulinoma compared to the reference standard. A logistic regression model of 8.305 – (0.441 × insulin 2-h/0-h) – (1.679 × C-peptide 1-h/0-h) > 0.351 has the highest diagnostic value in one study (AUC 0.97, Sensitivity 86.5%, Specificity 95.2%, PPV 94.1, NPV 88.9).
Conclusion
The measurement of 0-h and 2-h insulin and C-peptide levels during 2-h OGTT was found in two small case-control studies with a total of 106 patients to have good sensitivity and specificity. However, due to these limitations, future research is still needed to validate the potential use of OGTT for the diagnosis of insulinoma.
Insulinoma
;
Glucose Tolerance Test
9.Determining the severity of symptoms among patients with eosinophilic chronic rhinosinusitis with nasal polyposis versus non-eosinophilic chronic rhinosinusitis with nasal polyposis at the Veterans Memorial Medical Center
Geoffrey John S. Hizon ; Jay P. Espanto ; Kathleen M. Rodriguez-Labrador
Philippine Journal of Otolaryngology Head and Neck Surgery 2024;39(2):17-20
Objective:
To compare the severity of symptoms of patients diagnosed with Eosinophilic Chronic Rhinosinusitis with Nasal Polyposis (eCRSwNP) versus Non - Eosinophilic Chronic Rhinosinusitis with Nasal Polyposis (non-eCRSwNP) using the Filipino Sinonasal Outcome Test (Filipino SNOT 22) and determine the most common symptoms experienced by patients with eCRSwNP versus non-eCRSwNP.
:
Methods
Design:
Cross-Sectional Study
Setting:
Tertiary Government Training Hospital
Participants:
A total of 68 patients diagnosed with Chronic Rhinosinusitis with Nasal Polyposis (CRSwNP) from November 7, 2018 to August 31, 2022 were included in the study.
Results:
Of the 68 patients included in the study, 33 (48.5%) had non-eCRSwNP while 35 (51.5%) had eCRSwNP. The age of the patients with non-eCRSwNP group was 50.6 + 18.45 and those with eCRSwNP was 52.9 + 16.6 years old. Non-eCRSwNP patients had a lower mean Filipino SNOT 22 score of 39.7 ± 16.1 compared with eCRSwNP with a score of 62.7± 13.5. The non-eCRSwNP patients had symptom severity classified as mild in 2 (6.1%), moderate in 25 (75.8%) and severe in 6 (18.2%) based on Filipino SNOT-22. Among the eCRSwNP group, majority of the patients, 29 (82.9%) were classified as severe, 6 (17.1%) as moderate, and none with mild severity. Using the Filipino SNOT 22, the most common symptoms of patients with eCRSwNP were item 2 (baradong ilong; nasal blockage) at 28.6%, then item 7 (malapot na sipon; thick nasal discharge) at 25.7%, Item 8 (pagbabara ng tenga; ear fullness) and item 12 (pagkawala/ pagkabawas ng panlasa/ pang amoy; decreased sense of smell/taste) were tied at 14.3%, item 13 (hirap sa pagtulog; difficulty falling asleep) at 25.7%, and item 17 (pagkapagod; fatigue during the day) at 31.4% while patients with no-eCRSwNP were noted with item 2 (baradong ilong; nasal blockage) at 48.5%, followed by item 4 (hindi tumitigil na pagtulo ng sipon; runny nose) at 21.2%, item 11 (pananakit ng mukha; facial pain) at 33.3%, Item 7 (malapot na sipon; thick nasal discharge) at 18.2%, and item 20 (pagiging irritable/pagkainis; irritability) at 21.2%.
Conclusion
Our present study suggests that the higher the SNOT 22 score, the more likely it is to be eosinophilic chronic rhinosinusitis. Although nasal blockage was the most common symptom found in both patients with eCRSwNP and non-eCRSwNP, patients with thick nasal discharge, decreased sense of smell/taste and ear fullness were more likely to be suffering from eCRSwNP, while patients with runny nose, facial pain and thick nasal discharge were more likely to have non-eCRSwNP.
Sinusitis
;
Endoscopic Surgical Procedure
;
Endoscopy
;
SNOT-22
;
Sino-Nasal Outcome Test
;
Nasal Blockage
;
Nasal Obstruction
10.Knowledge, attitudes, and practices of women regarding pap smear in Surallah, South Cotabato
Von Charlene Faye A. Miguel ; Jade B. Alivar ; Arl Jeane T. Ramales ; Allya Bianca B. Sumbillo ; Efren II C. Deocades
Philippine Journal of Health Research and Development 2024;28(2):13-19
Background:
Cervical cancer is the fourth leading cause of cancer deaths in women worldwide and second in the Philippines. However, Pap smear test, a common screening test procedure for the detection of cervical cancer, remains underutilized, contributing to the increasing incidence of cervical cancer. Women's knowledge, attitudes, and practices (KAP) must be measured to ensure good,
targeted interventions; and increase screening and detection of cervical cancer cases.
Objectives:
The study aims to determine the KAPof women in Surallah, South Cotabato, towards Pap smear. It also aims to help the local government, college administrators, and rural health unit create programs to enhance women's KAPin the municipality.
Methodology:
The study used a descriptive, cross-sectional design, employing questionnaires manually distributed to determine the
KAPof women in Surallah, South Cotabato.
Results:
The study included 375 respondents. Most know the purpose and importance of a Pap smear but are in need of better understanding
of the procedure and the timing of the test. Most of the respondents also had varied reactions toward the test toward the test; some had
positive attitudes, and others had negative attitudes. The respondents didn't undergo the procedure despite having a good knowledge of it.
Conclusion
Most respondents correctly understood the importance of the procedure but needed to learn how it was done. They also
have a fair to commendable attitude towards the test. However, despite these, the respondents still practice poorly due to
misconceptions and misinformation
Health Knowledge, Attitudes, Practice
;
Papanicolaou Test
;
Uterine Cervical Neoplasms
;
Surveys and Questionnaires


Result Analysis
Print
Save
E-mail