Objective: To investigate the distribution characteristics of ABO and Rh blood group antigen phenotypes among blood donors in the Yantai, Shandong. Methods: Blood samples from 310 180 voluntary blood donors in Yantai collected from January 2019 to December 2023 were tested for ABO and Rh blood group antigens using standard serological methods. RhD-negative samples were further typed for C, c, E, and e antigens. Population genetic analysis of blood groups was performed: allele frequencies were inferred from ABO phenotypes, and Rh allele/haplotype frequencies were estimated based on the proportion of RhD-negative donors and CcEe antigen typing, followed by Hardy-Weinberg equilibrium testing. Results: The phenotypic distribution frequency of ABO blood groups was B(32.72%)>O(28.93%)>A(27.65%)>AB(10.70%). The inferred allele frequencies were r(53.74%)>q(24.78%)>p(21.48%), consistent with Hardy-Weinberg equilibrium (P>0.05). A total of 1 872 Rh-negative donors (0.603%) were identified. The most common Rh phenotypes were ccdee (59.56%) and Ccdee (30.18%). The distribution of Rh antigen phenotypes deviated significantly from Hardy-Weinberg equilibrium (χ =37.15, P<0.001), with the cde haplotype showing the highest frequency. There was no statistically significant difference in ABO blood group distribution between RhD-positive and RhD-negative donors (P>0.05). Conclusion: The ABO blood group distribution among voluntary blood donors in Yantai is generally stable and consistent with population genetic equilibrium, whereas the Rh antigen phenotype distribution deviates from equilibrium, indicating potential underlying genetic structural differences.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

Eight amide alkaloids(1-8) were isolated from the 70% ethanol extract of Cannabis Fructus using silica gel column chromatography, MCI column chromatography, and semi-preparative high-performance liquid chromatography(HPLC). Their structures were identified as hempspiramide A(1), N-[(4-hydroxyphenyl)ethyl]formamide(2), N-acetyltyramide(3), N-trans-p-coumaroyltyramine(4), N-trans-caffeoyltyramine(5), N-trans-feruloyltyramine(6), N-cis-p-coumaroyltyramine(7), N-cis-feruloyltyramine(8) by using spectroscopic methods such as NMR and MS. Among these compounds, compound 1 was a new amide alkaloid, while compounds 2 and 3 were isolated from Cannabis Fructus for the first time. Some of the isolates were assayed for their α-glucosidase inhibitory activity. Compounds 5-7 displayed significant inhibitory activity against α-glucosidase with IC_(50) values ranging from 1.07 to 4.63 μmol·L~(-1).
Cannabis/chemistry* ; Alkaloids/pharmacology* ; Amides/isolation & purification* ; Drugs, Chinese Herbal/isolation & purification* ; Fruit/chemistry* ; Molecular Structure ; alpha-Glucosidases/chemistry* ; Chromatography, High Pressure Liquid

Cemental tear is a rare and indetectable condition unless obvious clinical signs present with the involvement of surrounding periodontal and periapical tissues. Due to its clinical manifestations similar to common dental issues, such as vertical root fracture, primary endodontic diseases, and periodontal diseases, as well as the low awareness of cemental tear for clinicians, misdiagnosis often occurs. The critical principle for cemental tear treatment is to remove torn fragments, and overlooking fragments leads to futile therapy, which could deteriorate the conditions of the affected teeth. Therefore, accurate diagnosis and subsequent appropriate interventions are vital for managing cemental tear. Novel diagnostic tools, including cone-beam computed tomography (CBCT), microscopes, and enamel matrix derivatives, have improved early detection and management, enhancing tooth retention. The implementation of standardized diagnostic criteria and treatment protocols, combined with improved clinical awareness among dental professionals, serves to mitigate risks of diagnostic errors and suboptimal therapeutic interventions. This expert consensus reviewed the epidemiology, pathogenesis, potential predisposing factors, clinical manifestations, diagnosis, differential diagnosis, treatment, and prognosis of cemental tear, aiming to provide a clinical guideline and facilitate clinicians to have a better understanding of cemental tear.
Humans ; Dental Cementum/injuries* ; Consensus ; Diagnosis, Differential ; Cone-Beam Computed Tomography ; Tooth Fractures/therapy*

With the growing emphasis on maternal and child oral health, the significance of managing oral health across preconception, pregnancy, and infancy stages has become increasingly apparent. Oral health challenges extend beyond affecting maternal well-being, exerting profound influences on fetal and neonatal oral development as well as immune system maturation. This expert consensus paper, developed using a modified Delphi method, reviews current research and provides recommendations on maternal and child oral health management. It underscores the critical role of comprehensive oral assessments prior to conception, diligent oral health management throughout pregnancy, and meticulous oral hygiene practices during infancy. Effective strategies should be seamlessly integrated across the life course, encompassing preconception oral assessments, systematic dental care during pregnancy, and routine infant oral hygiene. Collaborative efforts among pediatric dentists, maternal and child health workers, and obstetricians are crucial to improving outcomes and fostering clinical research, contributing to evidence-based health management strategies.
Humans ; Pregnancy ; Female ; Infant ; Consensus ; Mouth Diseases/therapy* ; Pregnancy Complications/therapy* ; Oral Health ; Infant, Newborn ; Delphi Technique ; Oral Hygiene

BACKGROUND:A network-based pharmacological approach has identified multifunctional effects of the main bioactive compounds in the Trichosanthis Fructus-Allii Macrostemonis Bulbus on coronary heart disease;however,the mechanism of its therapeutic effect on coronary heart disease has not been fully elucidated. OBJECTIVE:To investigate the role and mechanism of Trichosanthis Fructus-Allii Macrostemonis Bulbus in improving coronary heart disease by regulating the composition of gut microbiota. METHODS:Forty Sprague-Dawley rats were randomly divided into four groups:blank control group(n=10),model group(n=10),positive drug group(n=10),and medicine pair group(n=10).A rat model of coronary heart disease was established by continuous gastric perfusion of fat emulsion and injection of pituitrin.After modeling,rats in the model group were gavaged with distilled water(10 mL/kg)for control,rats in the positive drug group were gavaged with simvastatin 4 mg/kg per day,and rats in the medicine pair group were gavaged with Trichosanthis Fructus-Allii Macrostemonis Bulbus pairs 7.56 g/kg per day.All interventions lasted for 14 days.Electrocardiograms and myocardial pathology were observed,and blood lipid levels were measured.The structure of gut microbiota was analyzed using 16S rDNA sequencing technology. RESULTS AND CONCLUSION:Electrocardiogram results showed ST segment elevation in the model group.There were no significant abnormalities in the electrocardiograms of the positive drug group and medicine pair group.Compared with the blank control group,the levels of total cholesterol,triacylglycerol,and low-density lipoprotein cholesterol were significantly higher in the model group(P<0.05).Compared with the model group,the levels of total cholesterol,triacylglycerol,and low-density lipoprotein cholesterol were significantly lower in the positive drug group and medicine pair group(P<0.05).Compared with the blank control group,focal myocardial cell necrosis was observed in the model group,while partial myocardial cell disarray was observed in the positive drug group and medicine pair group.Compared with the blank control group,the Ace,Shannon,and Chao indices were increased(P<0.05)and the Simpson index was decreased(P<0.05)in the model group,positive drug group and medicine pair group.Compared with the model group,the Ace and Chao indices were decreased(P<0.05),while the Shannon index showed no significant difference(P>0.05)and the Simpson index was also decreased(P<0.05)in the positive drug group and medicine pair group.Compared with the blank control group,the relative abundances of Desulfovibrionia,Muribaculaceae_norank,etc.were increased in the model group,while those of Clostridia,[Eubacterium]_coprostanoligenes_group_norank,etc.were decreased.Compared with the model group,the relative abundances of WPS-2_norank,Muribaculaceae_norank,etc.were increased in the medicine pair group,while those of Clostridia,[Eubacterium]_coprostanoligenes_group_norank,etc.were decreased;the relative abundances of Desulfobacterota,[Eubacterium]_coprostanoligenes_group_norank,etc.were increased in the positive drug group,while those of Firmicutes,Muribaculaceae_norank,etc.were decreased.Compared with the positive drug group,the relative abundances of Desulfobacterota,Bacteroides,etc.were increased in the medicine pair group,while those of Firmicutes,[Eubacterium]_coprostanoligenes_group_norank,etc.were decreased.The LEfSe results showed that the medicine pair group had the highest microbial enrichment,followed by the blank control group and positive drug group,with the model group having the lowest microbial enrichment.To conclude,Trichosanthis Fructus-Allii Macrostemonis Bulbus pairs can improve the development of coronary heart disease by regulating gut microbiota composition,providing new insights for further research and development of Trichosanthis Fructus-Allii Macrostemonis Bulbus pairs.

Objective To investigate the changes in eosinophil counts and the activation of microglial cells in the brain tissues of mice at different stages of Angiostrongylus cantonensis infection, and to examine the role of microglia in regulating the progression of angiostrongyliasis and unravel the possible molecular mechanisms. Methods Fifty BALB/c mice were randomly divided into the control group and the 7-d, 14-d, 21-day and 25-d infection groups, of 10 mice in each group. All mice in infection groups were infected with 30 stage III A. cantonensis larvae by gavage, and animals in the control group was given an equal amount of physiological saline. Five mice were collected from each of infection groups on days 7, 14, 21 d and 25 d post-infection, and 5 mice were collected from the control group on the day of oral gavage. The general and focal functional impairment was scored using the Clark scoring method to assess the degree of mouse neurological impairment. Five mice from each of infection groups were sacrificed on days 7, 14, 21 d and 25 d post-infection, and 5 mice from the control group were sacrificed on the day of oral gavage. Mouse brain tissues were sampled, and the pathological changes of brain tissues were dynamically observed using hematoxylin and eosin (HE) staining. Immunofluorescence staining with eosinophilic cationic protein (ECP) and ionized calcium binding adaptor molecule 1 (Iba1) was used to assess the degree of eosinophil infiltration and the counts of microglial cells in mouse brain tissues in each group, and the morphological parameters of microglial cells (skeleton analysis and fractal analysis) were quantified by using Image J software to determine the morphological changes of microglial cells. In addition, the expression of M1 microglia markers Fcγ receptor III (Fcgr3), Fcγ receptor IIb (Fcgr2b) and CD86 antigen (Cd86), M2 microglia markers Arginase 1 (Arg1), macrophage mannose receptor C-type 1 (Mrc1), chitinase-like 3 (Chil3), and phagocytosis genes myeloid cell triggering receptor expressed on myeloid cells 2 (Trem2), CD68 antigen (Cd68), and apolipoprotein E (Apoe) was quantified using real-time quantitative reverse transcription PCR (RT-qPCR) assay in the mouse cerebral cortex of mice post-infection. Results A large number of A. cantonensis larvae were seen on the mouse meninges surface post-infection, and many neuronal nuclei were crumpled and deeply stained, with a large number of bleeding points in the meninges. The median Clark scores of mouse general functional impairment were 0 (interquartile range, 0), 0 (interquartile range, 0.5), 6 (interquartile range, 1.0), 14 (interquartile range, 8.5) points and 20 (interquartile range, 9.0) points in the control group and the 7-d, 14-d, 21-d and 25-d groups, respectively (H = 22.45, P < 0.01), and the median Clark scores of mouse focal functional impairment were 0 (interquartile range, 0), 2 (interquartile range, 2.5), 7 (interquartile range, 3.0), 18 (interquartile range, 5.0) points and 25 (interquartile range, 6.5) points in the control group and the 7-d, 14-d, 21-d and 25-d groups, respectively (H = 22.72, P < 0.01). The mean scores of mice general and focal functional impairment were all higher in the infection groups than in the control group (all P values < 0.05). Immunofluorescence staining showed a significant difference in the eosinophil counts in mouse brain tissues among the five groups (F = 40.05, P < 0.000 1), and the eosinophil counts were significantly higher in mouse brain tissues in the 14-d (3.08 ± 0.78) and 21-d infection groups (5.97 ± 1.37) than in the control group (1.00 ± 0.28) (both P values < 0.05). Semi-quantitative analysis of microglia immunofluorescence showed a significant difference in the counts of microglial cells among the five groups (F = 17.66, P < 0.000 1), and higher Iba1 levels were detected in mouse brain tissues in 14-d (5.75 ± 1.28), 21-d (6.23 ± 1.89) and 25-d infection groups (3.70 ± 1.30) than in the control group (1.00 ± 0.30) (all P values < 0.05). Skeleton and fractal analyses showed that the branch length [(162.04 ± 34.10) μm vs. (395.37 ± 64.11) μm; t = 5.566, P < 0.05] and fractal dimension of microglial cells (1.30 ± 0.01 vs. 1.41 ± 0.03; t = 5.266, P < 0.05) were reduced in mouse brain tissues in the 21-d infection group relative to the control group. In addition, there were significant differences among the 5 groups in terms of M1 and M2 microglia markers Fcgr3 (F = 48.34, P < 0.05), Fcgr2b (F = 55.46, P < 0.05), Cd86 (F = 24.44, P < 0.05), Arg1 (F = 31.18, P < 0.05), Mrc1 (F = 15.42, P < 0.05) and Chil3 (F = 24.41, P < 0.05), as well as phagocytosis markers Trem2 (F = 21.19, P < 0.05), Cd68 (F = 43.95, P < 0.05) and Apoe (F = 7.12, P < 0.05) in mice brain tissues. Conclusions A. cantonensis infections may induce severe pathological injuries in mouse brain tissues that are characterized by massive eosinophil infiltration and persistent activation of microglia cells, thereby resulting in progressive deterioration of neurological functions.

Background Air pollution remains a critical public health issue, with persistent exposure to air pollutants continuing to pose significant health risks. Currently, research investigating the association between air pollution and myocardial infarction mortality in Shenzhen remains inadequate. Objective To quantitatively assess the association between air pollutants and myocardial infarction mortality in residents. Methods Based on the mortality surveillance system of Shenzhen Center for Disease Control and Prevention, we conducted a time-stratified case-crossover study of 10089 permanent residents who died from myocardial infarction in Shenzhen between 2013 and 2022. Using residential address information, we obtained individual-level exposure data for air pollutants from the China High Air Pollutants dataset and meteorological factors from the China Meteorological Administration Land Data Assimilation System. A time-stratified case-crossover study design was employed to construct a conditional logistic regression model to assess the association between short-term exposure to air pollutants and myocardial infarction mortality. The exposure-response relationship was visualized, and a comprehensive health risk assessment was performed. Results This study included a total of 10 089 cases of myocardial infarction deaths in Shenzhen. The median [interquartile range (IQR)] concentrations of fine particulate matter (PM_2.5), inhalable particulate matter (PM₁₀), sulfur dioxide (SO₂), nitrogen dioxide (NO₂), carbon monoxide (CO), and ozone (O₃) in Shenzhen from 2013 to 2022 were 24.59 (20.19) μg·m⁻³, 42.85 (28.42) μg·m⁻³, 8.53 (3.39) μg·m⁻³, 29.47 (13.56) μg·m⁻³, 0.77 (0.27) mg·m⁻³, and 86.53 (51.39) μg·m⁻³, respectively. The moving average concentrations of PM_2.5 and PM₁₀ over the current day and the previous 2 days (lag02) showed the highest risk of myocardial infarction mortality, with an odds ratio (OR) and 95% confidence interval (95%CI) of 1.004 (1.001, 1.007) and 1.004 (1.002, 1.006), respectively. At lag05, SO₂ demonstrated the strongest association with the risk of myocardial infarction mortality, with an OR (95%CI) of 1.042 (1.019, 1.065). The exposure-response relationships of PM_2.5, PM₁₀, and SO₂ with myocardial infarction mortality were approximately linear, whereas NO₂ exhibited a nonlinear relationship. At lag05, the highest risk of myocardial infarction mortality associated with NO₂ exposure was observed when the NO₂ concentration was ≤21.92 μg·m⁻³, with an OR (95% CI) of 1.024 (1.003, 1.046). The health risk assessment indicated that, using the WHO Air Quality Guidelines as the reference, the local PM_2.5 and NO₂ exposure led to an excess mortality of 398 and 298 cases, respectively. The sensitivity analysis revealed that after adjusting for O₃ and restricting the study period to 2013—2019, the effect estimates for PM_2.5, PM₁₀, NO₂, and SO₂ on myocardial infarction mortality slightly increased. Conclusion Short-term exposure to air pollutants, including PM_2.5, PM₁₀, NO₂, and SO₂, could increase the risk of myocardial infarction mortality. This study provides important scientific evidence for environmental health risk assessment and environmental management in Shenzhen.

Genitourinary system tumors, as a major clinical challenge posing a serious threat to human health, urgently require breakthroughs in the construction of a precision diagnosis and treatment system. The innovative application of molecular imaging technologies, particularly the development of novel molecular probes, is revolutionizing the diagnostic and therapeutic paradigms for urinary tumors. The application of novel molecular probes in the early diagnosis and staging of genitourinary tumors, the role of multimodal molecular imaging probes in guiding precision surgery/radiotherapy, and the clinical translation challenges and strategies for theranostic-integrated probes are systematically reviewed in this article to provide valuable insights and references for related research and clinical practice.

BACKGROUND: The available evidence regarding the benefits of percutaneous coronary intervention (PCI) on patients receiving dialysis with coronary artery disease (CAD) is limited and inconsistent. This study aimed to evaluate the association between PCI and clinical outcomes as compared with medical therapy alone in patients undergoing dialysis with CAD in China. METHODS: This multicenter, retrospective study was conducted in 30 tertiary medical centers across 12 provinces in China from January 2015 to June 2021 to include patients on dialysis with CAD. The primary outcome was major adverse cardiovascular events (MACE), defined as a composite of cardiovascular death, non-fatal myocardial infarction, and non-fatal stroke. Secondary outcomes included all-cause death, the individual components of MACE, and Bleeding Academic Research Consortium criteria types 2, 3, or 5 bleeding. Multivariable Cox proportional hazard models were used to assess the association between PCI and outcomes. Inverse probability of treatment weighting (IPTW) and propensity score matching (PSM) were performed to account for potential between-group differences. RESULTS: Of the 1146 patients on dialysis with significant CAD, 821 (71.6%) underwent PCI. After a median follow-up of 23.0 months, PCI was associated with a 43.0% significantly lower risk for MACE (33.9% [ n  = 278] vs . 43.7% [ n  = 142]; adjusted hazards ratio 0.57, 95% confidence interval 0.45-0.71), along with a slightly increased risk for bleeding outcomes that did not reach statistical significance (11.1% vs . 8.3%; adjusted hazards ratio 1.31, 95% confidence interval, 0.82-2.11). Furthermore, PCI was associated with a significant reduction in all-cause and cardiovascular mortalities. Subgroup analysis did not modify the association of PCI with patient outcomes. These primary findings were consistent across IPTW, PSM, and competing risk analyses. CONCLUSION This study indicated that PCI in patients on dialysis with CAD was significantly associated with lower MACE and mortality when comparing with those with medical therapy alone, albeit with a slightly increased risk for bleeding events that did not reach statistical significance.
Humans ; Percutaneous Coronary Intervention/methods* ; Male ; Female ; Coronary Artery Disease/drug therapy* ; Retrospective Studies ; Renal Dialysis/methods* ; Middle Aged ; Aged ; China ; Proportional Hazards Models ; Treatment Outcome