1.The effect of Ba Duan Jin on the balance of community-dwelling older adults: a cluster randomized control trial
Leilei DUAN ; Yubin ZHAO ; Yuliang ER ; Pengpeng YE ; Wei WANG ; Xin GAO ; Xiao DENG ; Ye JIN ; Yuan WANG ; Cuirong JI ; Xinyan MA ; Cong GAO ; Yuhong ZHAO ; Suqiu ZHU ; Shuzhen SU ; Xin'e GUO ; Juanjuan PENG ; Yan YU ; Chen YANG ; Yaya SU ; Ming ZHAO ; Lihua GUO ; Yiping WU ; Yangnu LUO ; Ruilin MENG ; Haofeng XU ; Huazhang LIU ; Huihong RUAN ; Bo XIE ; Huimin ZHANG ; Yuhua LIAO ; Yan CHEN ; Linhong WANG
Chinese Journal of Epidemiology 2024;45(2):250-256
Objective:To assess the effectiveness of a 6-month Ba Duan Jin exercise program in improving the balance of community-dwelling older adults.Methods:A two arms, parallel-group, cluster randomized controlled trial was conducted in 1 028 community residents aged 60-80 years in 40 communities in 5 provinces of China. Participants in the intervention group (20 communities, 523 people) received Ba Duan Jin exercise 5 days/week, 1 hour/day for 6 months, and three times of falls prevention health education, and the control group (20 communities, 505 people) received falls prevention health education same as the intervention group. The Berg balance scale (BBS) score was the leading outcome indicator, and the secondary outcome indicators included the length of time of standing on one foot (with eyes open and closed), standing in a tandem stance (with eyes open and closed), the closed circle test, and the timed up to test.Results:A total of 1 028 participants were included in the final analysis, including 731 women (71.11%) and 297 men (28.89%), and the age was (69.87±5.67) years. After the 3-month intervention, compared with the baseline data, the BBS score of the intervention group was significantly higher than the control group by 3.05 (95% CI: 2.23-3.88) points ( P<0.001). After the 6-month intervention, compared with the baseline data, the BBS score of the intervention group was significantly higher than the control group by 4.70 (95% CI: 4.03-5.37) points ( P<0.001). Ba Duan Jin showed significant improvement ( P<0.05) in all secondary outcomes after 6 months of exercise in the intervention group compared with the control group. Conclusions:This study showed that Ba Duan Jin exercise can improve balance in community-dwelling older adults aged 60-80. The longer the exercise time, the better the improvement.
2.Phenotype and genotype analysis of progressive familial intrahepatic cholestasis type 4
Tingting YANG ; Shuzhen MA ; Ling LYU ; Yuan CHEN ; Ya′nan ZHANG ; Xinli BAI
Chinese Journal of Applied Clinical Pediatrics 2023;38(6):457-460
Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.
3.Comparison between laparoscopic-assisted natural orifice specimen extraction surgery and conventional laparoscopic surgery for left colorectal cancer: 5-year follow-up results of a randomized controlled study
Zhizheng CHEN ; Zhijie DING ; Zhenfa WANG ; Shuzhen XU ; Shifeng ZHANG ; Sibo YUAN ; Feng YAN ; Guoyan LIU ; Xingfeng QIU ; Jianchun CAI
Chinese Journal of Gastrointestinal Surgery 2023;26(8):768-772
Objective:To evaluate the long-term efficacy of laparoscopic-assisted natural orifice specimen extraction surgery (NOSES) colectomy using Cai tube for treating left-sided colorectal cancer.Methods:This was a randomized controlled trial. Inclusion criteria were as follows: preoperative pathological diagnosis of left-sided colorectal adenocarcinoma (rectal, sigmoid colon, descending colon, or left transverse colon cancer with the caudad margin ≥8 cm from the anal margin); preoperative abdominal and pelvic computed tomography (or magnetic resonance imaging) showing maximum tumor diameter <4.5 cm; and BMI <30 kg/m 2. Patients with synchronous multiple primary cancers or recurrent cancers, a history of neoadjuvant chemoradiotherapy, preoperative evidence of significant local infiltration, distant metastasis, or complications such as intestinal obstruction and intestinal perforation, or who were not otherwise considered suitable for laparoscopic surgery were excluded. A random number table was used to randomize sequential patients to NOSES surgery using Cai tube (non-assisted incision anal sleeve: patent number ZL201410168748.2) (NOSES group) or traditional laparoscopic-assisted surgery (CLS group). Relevant clinical data of the two groups of patients were analyzed, the main outcomes being disease-free survival, overall survival, overall recurrence rate, and local recurrence rate 5 years after surgery. Results:Patients in both study groups completed the surgery successfully with no requirement for additional surgery. After mean 70 (7–83) months postoperative follow-up, the 5-year overall postoperative survival in the NOSES and CLS groups was 90.0% and 83.3%, respectively ( P=0.455); disease free survival was 90.0% and 83.3%, respectively ( P=0.455); overall recurrence rate 6.6% and 10.0%, respectively ( P=0.625); and local recurrence rate both were 3.3% ( P=0.990), respectively. None of these differences was statistically significant. Conclusions:NOSES and CLS have similar long-term efficacy, and NOSES deserves to be used in clinical practice.
4.Comparison between laparoscopic-assisted natural orifice specimen extraction surgery and conventional laparoscopic surgery for left colorectal cancer: 5-year follow-up results of a randomized controlled study
Zhizheng CHEN ; Zhijie DING ; Zhenfa WANG ; Shuzhen XU ; Shifeng ZHANG ; Sibo YUAN ; Feng YAN ; Guoyan LIU ; Xingfeng QIU ; Jianchun CAI
Chinese Journal of Gastrointestinal Surgery 2023;26(8):768-772
Objective:To evaluate the long-term efficacy of laparoscopic-assisted natural orifice specimen extraction surgery (NOSES) colectomy using Cai tube for treating left-sided colorectal cancer.Methods:This was a randomized controlled trial. Inclusion criteria were as follows: preoperative pathological diagnosis of left-sided colorectal adenocarcinoma (rectal, sigmoid colon, descending colon, or left transverse colon cancer with the caudad margin ≥8 cm from the anal margin); preoperative abdominal and pelvic computed tomography (or magnetic resonance imaging) showing maximum tumor diameter <4.5 cm; and BMI <30 kg/m 2. Patients with synchronous multiple primary cancers or recurrent cancers, a history of neoadjuvant chemoradiotherapy, preoperative evidence of significant local infiltration, distant metastasis, or complications such as intestinal obstruction and intestinal perforation, or who were not otherwise considered suitable for laparoscopic surgery were excluded. A random number table was used to randomize sequential patients to NOSES surgery using Cai tube (non-assisted incision anal sleeve: patent number ZL201410168748.2) (NOSES group) or traditional laparoscopic-assisted surgery (CLS group). Relevant clinical data of the two groups of patients were analyzed, the main outcomes being disease-free survival, overall survival, overall recurrence rate, and local recurrence rate 5 years after surgery. Results:Patients in both study groups completed the surgery successfully with no requirement for additional surgery. After mean 70 (7–83) months postoperative follow-up, the 5-year overall postoperative survival in the NOSES and CLS groups was 90.0% and 83.3%, respectively ( P=0.455); disease free survival was 90.0% and 83.3%, respectively ( P=0.455); overall recurrence rate 6.6% and 10.0%, respectively ( P=0.625); and local recurrence rate both were 3.3% ( P=0.990), respectively. None of these differences was statistically significant. Conclusions:NOSES and CLS have similar long-term efficacy, and NOSES deserves to be used in clinical practice.
5.Clinical observation of belimumab in the treatment of 12 children with active lupus nephritis
Yuan CHEN ; Linxiaoyu KONG ; Shuzhen SUN ; Li WANG ; Qian LI ; Jing WANG ; Lichun YU ; Zhenle YANG
Chinese Pediatric Emergency Medicine 2022;29(12):981-984
Objective:To analyze the clinical data of children with active lupus nephritis(LN) with poor first-line treatment and further treatment with belimumab, and explore the efficacy and safety of belimumab in the treatment of children with LN, so as to provide experience and guidance for clinical treatment of children with LN.Methods:From August 2020 to September 2021, 12 children with LN whose systemic lupus erythematosus disease activity index(SLEDAI)score was ≥8 and with poor first-line treatment were collected, and their clinical manifestations, treatment process, SLEDAI score, complement C3, complement C4, anti-dsDNA antibody titer, and proteinuria relief were analyzed retrospectively.Results:Before treatment with belimumab, the SLEDAI score was 8 in 3 cases, 10 in 5 cases, 12 in 2 cases and 16 in 2 cases.Theurine protein was positive in 6 cases.The anti-dsDNA antibody titer was higher than normal value in 8 cases.The complement C3 decreased in 8 cases and the complement C4 decreased in 6 cases.The SLEDAI scores and the anti-dsDNA antibody of 12 children and 24-hour urine protein quantification of 6 children with positive urine protein began to decrease within 4 weeks after treatment with belimumab.Anti-dsDNA antibody decreased to normal in 12th week and 24 h urine protein decreased to normal in 16th week.The levels of complement C3 and C4 began to rise within 4 weeks, complement C3 returned to normal within 24 weeks, and complement C4 returned to normal within 28 weeks.Conclusion:For LN children with poor response to first-line therapy or persistent disease activity, the addition of belimumab resulted in increased complement, decreased disease activity index and anti-dsDNA antibody titer, and effective relief of proteinuria.The application of belimumab has a certain effect on active LN children with poor response to first-line therapy, which is worthy of clinical promotion.
6.Differential gene sequencing alignment analysis of hyperplastic stenosis in murine arteriovenous fistula
Aisha ZHANG ; Xiaolu SUI ; Yanzi ZHANG ; Yunpeng XU ; Tingfei XIE ; Shuzhen YUAN ; Qicheng ZENG ; Jiefeng ZOU ; Jihong CHEN
Chinese Journal of Nephrology 2022;38(8):699-709
Objective:To establish a mouse model of intra-jugular arteriovenous fistula (AVF) to screen differentially expressed genes in the process of intimal stenosis of AVF for investigating the abnormal expression signaling pathways and the mechanisms.Methods:Forty-six male C57BL/6 mice were randomly divided into AVF group ( n=23) and sham-operated group ( n=23). The AVF group underwent internal jugular arteriovenous fistuloplasty, and the sham-operated group separated the right external jugular vein and common carotid artery and then sutured the incision. The whole-genome sequences of mice with AVF stenosis were determined by transcriptomic reversible chain terminator and synthetic sequencing. The microarray data set was established, and the Benjamini & Hochberg method of gene microarray data analysis was applied to screen the differentially expressed genes. The differentially expressed genes were screened by R-language enrichment analysis. Then, gene ontology (GO) and Kyoto encyclopedia of genes and genomes (KEGG) were performed. The subcellular localization of the differentially expressed genes was performed by BUSCA software. The protein network interaction of differentially expressed genes was analyzed by using STRING database and Cytoscape software. Results:In the AVF group, 21 mice were successfully modeled and 2 mice failed. Therefore, there were 21 mice in the AVF group and only 21 mice in the sham-operated group. This mouse internal jugular AVF model was innovated using the continuous-interrupted suture method, which improved the success rate of modeling this model. The differential gene sequencing analysis showed that there were 2 514 differentially expressed genes in the AVF process, including 1 323 up-regulated genes and 1 191 down-regulated genes. GO functional enrichment analysis showed that the differential genes were mainly enriched in metabolic process, activation, redox, mitochondria and so on. KEGG pathway enrichment analysis showed that the differential genes were enriched in metabolism, energy substance synthesis, diabetes, oxidative stress and so on. Statistical analysis of subcellular localization showed that the differences were mainly in mitochondrial proteins (24.24%), cytoplasmic proteins (17.51%), nuclear proteins (13.13%), cell membrane proteins (11.45%), and extracellular proteins (10.77%).Conclusions:Mitochondrial oxidative stress injury may be involved in the pathological damage process of endothelial proliferation stenosis in the AVF.
7.Bone marrow mesenchymal stem cell-derived exosomes miR-183 target regulation of retinal dehydrogenase 11 to inhibit the development of retinitis pigmentosa
Yuan LI ; Tingyu QIN ; Long GUO ; Shuzhen LI ; Xiwu HOU
Chinese Journal of Ocular Fundus Diseases 2022;38(8):688-695
Objective:To observe the expressions of miR-183 and retinal dehydrogenase 11 (RDH11) in exosomes derived from bone marrow mesenchymal stem cells (BMSC), and to preliminarily explore their targeting relationship and their effects on retinal pigment epithelial (RPE) cells.Methods:BMSC from C57BL/6 (C57) mice were isolated and cultured, and BMSC-derived exosomes were identified. BMSC were divided into blank group, simulation blank control group (mimic-NC group), miR-183 simulation group (miR-183-mimic group). C57 mice and retinal degeneration 10 (rd10) mouse RPE cells were cultured with reference to literature methods. RPE cells from rd10 mice were transfected with BMSC exosomes and co-cultured and divided into control group, exosome group, mimic-NC-exosome group (mimic-NC-exo group), miR-183-mimic-exosome group (miR-183-mimic-exo group). The relative expression levels of miR-183, RDH11 mRNA and protein in C57 mice, rd10 mice and RPE cells in each group were detected by real-time quantitative polymerase chain reaction and western blotting. The targeting relationship between miR-183 and RDH11 was analyzed by bioinformatics website and dual luciferase reporter. Cell counting kit 8 was used to detect the effect of miR-183 on BMSC exosomes on RPE cell proliferation; in situ labeling end labeling method was used to detect RPE cells apoptosis. One-way ANOVA was used to compare multiple groups.Results:Compared with C57 mouse RPE cells, the relative expression of miR-183 in rd10 mouse RPE cells was down-regulated, and the relative expression of RDH11 mRNA was up-regulated, and the differences were statistically significant ( t=5.230, 8.548; P=0.006, 0.001). Compared with the blank group and the mimic-NC group, the relative expression of miR-183 mRNA in the exosomes of the miR-183-mimics group was significantly increased ( F=60.130, P <0.05 ). After 24 h of co-culture, exosomes entered RPE cells. Compared with the mimic-NC-exo group, the relative expression of miR-183 mRNA in RPE cells in the miR-183-mimic-exo group was significantly increased, the proliferation ability was enhanced ( t=7.311, P=0.002), and the number of apoptotic cells was decreased ( F=10.949, P=0.012), and the differences were statistically significant ( t=4.571, P=0.002). Bioinformatics website and dual-luciferase report confirmed that miR-183 has a targeting relationship with RDH11. Compared with the mimic-NC group, the relative expression of RDH11 mRNA and protein in the exosomes of the miR-183-mimic group was decreased, and the difference was statistically significant ( t=5.361, 6.591; P=0.006, 0.003). After co-culture, compared with the control group, there was no significant difference in the relative expression of RDH11 mRNA and protein in RPE cells in the exosome group ( t=0.169, 1.134; P=0.874, 0.320); The relative expressions of RDH11 mRNA and protein in RPE cells in -183-mimic-exo group were decreased, and the difference was statistically significant ( t=5.554, 5.546; P=0.005, 0.005). Conclusion:Up-regulation of BMSC-derived exosomal miR-183 promote the proliferation of RPE cells in vitro by targeting the expression of RDH11 and reduce the number of apoptosis.
8.The mechanism of ischemic preconditioning renal tubular cell-derived exosomes in the repair of renal ischemia-reperfusion injury in rats
Lixiang LI ; Yanzi ZHANG ; Yunpeng XU ; Zibin XU ; Xiaolu SUI ; Qicheng ZENG ; Jiefeng ZOU ; Shuzhen YUAN ; Tingfei XIE ; Jihong CHEN
Journal of Chinese Physician 2022;24(2):260-265
Objective:Clamping bilateral renal arteries with refined surgical methods to establish the rat renal ischemia-reperfusion injury (RIRI) model, and study the protective mechanism of ischemic preconditioning renal (IPC) tubular cell-derived exosomes in RIRI.Methods:25 female Sprague Dawley (SD) rats were divided into sham group, model group, inactivated group, normoxic group, IPC group. In the sham operation group, after bilateral renal arteries were dissociated, the back incision was disinfected and closed. The model group established RIRI model; RIRI models were established in inactivated group, normoxia group and IPC group, and then 200 μg of inactivated exosomes, normal exosomes and IPC exosomes were injected into the caudal vein 24 hours after operation. Serum creatinine (Scr) and urea nitrogen (BUN) levels were detected. The pathological changes of renal tissue were observed under light microscope. Transmission electron microscopy (TEM) was used to observe the shape and size of renal tubular exosomes. Nanoparticle tracking analysis (NTA)was used to detect the concentration and size of renal tubular exosomes.Results:Compared with the sham group, the Scr and BUN levels in the model group were significantly elevated ( P<0.01). Renal pathological changes in the model group showed damaged of the tubular structure, necrosis and shedding of tubular epithelial cells, and a large number of inflammatory cells accumulated in the renal interstitial tissue with varying degrees of edema. Compared with the inactivated group, the Scr and BUN levels significantly decreased in the normoxic group and IPC group ( P<0.01). Renal pathological changes in the normoxic group and IPC group showed that the renal tubular cell necrosis alleviated, inflammatory was reduced, the improved edema. Compared with the normoxic group, the Scr and BUN levels in the IPC group were further reduced ( P<0.01). Renal pathological changes in the IPC group showed that the inflammatory cells were significantly reduced, the cell edema was significantly improved, and the cell apoptosis was significantly reduced. Conclusions:Clamping bilateral renal arteries with refined surgical methods is the main and optimal way to build a rat model of RIRI. IPC tubular cell-derived exosomes have protective and repair effects on RIRI.
9.Uric acid induces inflammatory injury in HK-2 cells via PI3K/AKT/NF-κB signaling pathway
Tingfei XIE ; Shuzhen YUAN ; Xiaolu SUI ; Fengjuan GU ; Aisha ZHANG ; Yunpeng XU ; Qicheng ZENG ; Jiefeng ZOU ; Jihong CHEN
Chinese Journal of Nephrology 2021;37(1):36-42
Objective:To investigate the effects and underlying mechanisms of phosphoinositide 3-kinase (PI3K)/protein kinase B (AKT)/NF-κB signaling pathway in human kidney-2(HK-2) cells of hyperuricemic nephropathy.Methods:HK-2 cells were cultured in vitro and randomly divided into control group and experimental group. The experimental group was induced by high uric acid (720 μmol/L) immersion for 48 h to establish a cell model of hyperuricemic nephropathy in vitro and subsequently divided into hyperuricemic group, overexpressed protease activated receptor 2 (PAR2) and knockdown PAR2 group. The expressions of PAR2, PI3K, AKT, NF-κB mRNA were measured by real-time PCR. The expressions of PAR2, PI3K, AKT and NF-κB protein were measured by Western blotting. The expressions of tumor necrosis factor-α (TNF-α), monocyte chemotactic protein-1 (MCP-1), interleukin-6 (IL-6), pro-interleukin-1β (pro-IL-1β), interleukin-1β (IL-1β) and transforming growth factor-β1 (TGF-β1) were detected by enzyme linked immunosorbent assay (ELISA). Results:(1) Compared with the control group, the expressions of PAR2, PI3K, AKT and NF-κB mRNA and protein in hyperuricemic group were significantly increased (all P<0.05), the expressions of TNF-α, MCP-1, IL-6, pro-IL-1β, IL-1β and TGF-β1 in the supernatant in hyperuricemic group were significantly increased (all P<0.01). (2) Compared with the hyperuricemic group, the expressions of PAR2, PI3K, AKT and NF-κB mRNA and protein in overexpressed PAR2 group were significantly increased (all P<0.05), the expressions of TNF-α, MCP-1, IL-6, IL-1β and TGF-β1 in the supernatant were significantly increased (all P<0.05). (3) Compared with the hyperuricemic group, the expression of PAR2, PI3K, AKT and NF-κB mRNA and protein in knockdown PAR2 group were significantly decreased (all P<0.05), the expressions of IL-6, pro-IL-1β, IL-1β and TGF-β1 in the supernatant were significantly decreased (all P<0.05). Conclusions:In the process of uric acid-induced HK-2 cell damage, uric acid significantly up-regulates the expression of PI3K/AKT/NF-κB signaling pathway by activating PAR2, leading to a marked increase in inflammatory damage. Knocking down PAR2 inhibits the expression of PI3K/AKT/NF-κB signaling pathway, which can effectively reduce the inflammatory damage of HK-2 cells.
10.Clinical analysis of nine cases of childhood malignancy who initially present with arthritis
Zhenle YANG ; Lichun YU ; Li WANG ; Jing WANG ; Qian LI ; Yuan CHEN ; Shuzhen SUN
Chinese Pediatric Emergency Medicine 2021;28(6):521-525
Objective:To explore the clinical characteristics of malignant tumors with arthritis as the first symptom in children, so as to strengthen the early recognition of juvenile idiopathic arthritis(JIA) and avoid misdiagnosis and treatment.Methods:Nine cases of children with malignant tumor with arthritis as the first symptom were collected from February 2015 to August 2019 in our hospital.The clinical manifestations, laboratory and imaging features of nine cases were analyzed retrospectively.Results:There were nine children, including five males and four females, with an average age of 6.2 years and an average course of 61.4 days.There were seven cases of acute lymphoblastic leukemia(ALL), one case of neuroblastoma(NB) and one case of anaplastic large cell lymphoma(ALCL). Joint symptoms: polyarthritis in four cases and oligoarthritis in five cases.Eight cases had extraarticular symptoms.Nine cases had elevated inflammatory indexes, six cases had mild abnormal blood routine examination, one case was positive for HLA-B27, and other rheumatoid factor, anti CCP antibody, RA33 antibody and antinuclear antibodies spectrum were negative.Bone destruction was found in five cases.There was no significant difference in clinical manifestations and examinations between nine cases of children with malignant tumor and JIA.Conclusion:Arthritis can be the first manifestation of malignant tumor in children.However, JIA lacks specific diagnostic indicators.In clinical practice, malignant tumors with the first manifestation of arthritis can be regarded as JIA and treatment will be delayed.Clinicians need to raise awareness.

Result Analysis
Print
Save
E-mail