Objective To analyze the antibody types of autoimmune hemolytic anemia(AIHA)patients in Panyu dis-trict,Guangzhou and track the therapeutic effect of blood transfusion,so as to provide reference for clinical transfusion treat-ment strategy of AIHA patients.Methods From January 2021 to October 2023,96 ambiguous cross-matching blood sam-ples from Blood Transfusion Departments of local hospitals sent to Panyu Central Blood Station were analyzed,and 25 sam-ples of AIHA patients were identified.Then blood group identification,Rh system antigen phenotyping,antibody screening and cross-matching were further performed to analyze the correlation between antibody types and transfusion efficacy in AIHA patients.Results Among the 25 samples of AIHA patients,17 showed consistency between forward and reverse blood grouping and8 showed discrepancy.There were 19(19/25,76%)samples incompatible in cross match on the major side,of which 18(18/19,94.7%)were positive for direct Coombs test,autoantibodies and non-specific antibodies,and1(1/19,5.3%)was positive for autoantibody and alloantibody.There were 6(6/25,24%)samples compatible in cross match on the major side,of which 3(3/6,50%)were positive for autoantibodies,3(3/6,50%)were positive for au-toantibody and alloantibody.Of the 25 AIHA patients,20 received blood transfusion treatment and could be traced,and 5 patients did not receive blood transfusion treatment or transferred to other hospitals and could not be traced.Blood transfu-sion was effective in 11(11/20,55%)cases,partially effective in 6(6/20,30%)cases,and ineffective in 3(3/20,15%)cases.Among the ABO blood group incompatibility samples,transfusion was effective or partially effective in 17(17/20,85%)cases.Conclusion The transfusion efficacy of AIHA patients is not directly related to the results of cross-matc-hing.Under the premise of regulating the autoimmune environment and eliminating the ABO blood group incompatibility caused by unexpected alloantibodies,AIHA patients with incompatible cross-matching can be transfused when necessary,and transfusion of ABO and Rh system antigen homologous blood can improve the safety and efficiency of transfusion.

Objective:To assess the effectiveness of a 6-month Ba Duan Jin exercise program in improving the balance of community-dwelling older adults.Methods:A two arms, parallel-group, cluster randomized controlled trial was conducted in 1 028 community residents aged 60-80 years in 40 communities in 5 provinces of China. Participants in the intervention group (20 communities, 523 people) received Ba Duan Jin exercise 5 days/week, 1 hour/day for 6 months, and three times of falls prevention health education, and the control group (20 communities, 505 people) received falls prevention health education same as the intervention group. The Berg balance scale (BBS) score was the leading outcome indicator, and the secondary outcome indicators included the length of time of standing on one foot (with eyes open and closed), standing in a tandem stance (with eyes open and closed), the closed circle test, and the timed up to test.Results:A total of 1 028 participants were included in the final analysis, including 731 women (71.11%) and 297 men (28.89%), and the age was (69.87±5.67) years. After the 3-month intervention, compared with the baseline data, the BBS score of the intervention group was significantly higher than the control group by 3.05 (95% CI: 2.23-3.88) points ( P<0.001). After the 6-month intervention, compared with the baseline data, the BBS score of the intervention group was significantly higher than the control group by 4.70 (95% CI: 4.03-5.37) points ( P<0.001). Ba Duan Jin showed significant improvement ( P<0.05) in all secondary outcomes after 6 months of exercise in the intervention group compared with the control group. Conclusions:This study showed that Ba Duan Jin exercise can improve balance in community-dwelling older adults aged 60-80. The longer the exercise time, the better the improvement.

Aural vertigo frequently encountered in the otolaryngology department of traditional Chinese medicine （TCM） mainly involves peripheral vestibular diseases of Western medicine， such as Meniere's disease， benign paroxysmal positional vertigo， vestibular neuritis， and vestibular migraine， being a hot research topic in both TCM and Western medicine. Western medical therapies alone have unsatisfactory effects on recurrent aural vertigo， aural vertigo affecting the quality of life， aural vertigo not relieved after surgery， aural vertigo with complex causes， and children's aural vertigo. The literature records and clinical practice have proven that TCM demonstrates unique advantages in the treatment of aural vertigo. The China Association of Chinese medicine sponsored the "17th youth salon on the diseases responding specifically to TCM： Aural vertigo" and invited vertigo experts of TCM and Western medicine to discuss the difficulties and advantages of TCM diagnosis and treatment of aural vertigo. The experts deeply discussed the achievements and contributions of TCM and Western medicine in the diagnosis and treatment of aural vertigo， the control and mitigation of the symptoms， and the solutions to disease recurrence. The discussion clarified the positioning and advantages of TCM treatment and provided guidance for clinical and basic research on aural vertigo.

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

Objective:To analyze the expression of cell division cycle associated protein 5 (CDCA5) in pancreatic cancer tissues and its correlation with prognosis based on the bioinformatics.Methods:The RNA sequencing data (HTSeq-FPKM) and corresponding clinical information of 168 pancreatic cancer samples from January to December 2021 were downloaded from the Cancer Genome Atlas (TCGA) database, and the data of 179 pancreatic patients from January to December 2021 were downloaded from the GEPIA2 database, and 171 normal pancreatic tissues from TCGA and GTEx databases were simultaneously integrated. The relative expression level of CDCA5 mRNA in pancreatic cancer patients in GEPIA2 database and its relationship with overall survival (OS) and disease-free survival (DFS) were explored. Combined with the clinical data of the patients, univariate and multivariate Cox regression model analysis was used to analyze the factors influencing the OS of pancreatic cancer patients. Gene set enrichment analysis (GSEA) was performed to investigate the possibly involved signal pathways of CDCA5 in pancreatic cancer.Results:In the GEPIA2 database, the relative expression level of CDCA5 mRNA in pancreatic cancer tissues was higher than that in normal pancreatic tissues, and the difference was statistically significant ( P < 0.05). The pancreatic cancer patients were divided into the high CDCA5 mRNA expression group (89 cases) and the low CDCA5 mRNA expression group (89 cases) according to the median of relative expression level of CDCA5 mRNA (the case equal to the median value was not subgrouped). Survival analysis showed that patients with high CDCA5 mRNA expression had shorter OS ( P = 0.024) and DFS ( P = 0.025) compared with those with low CDCA5 mRNA expression. Multivariate Cox analysis showed that in TCGA database, N staging ( HR = 2.15, 95% CI 1.24-3.72, P = 0.006) and CDCA5 expression ( HR = 1.71, 95% CI 1.23-2.38, P = 0.001) were independent influencing factors of OS for pancreatic cancer patients. The results of GSEA enrichment analysis indicated that high CDCA5 mRNA expression was enriched in 13 biological pathways [all P < 0.05, false discovery rate (FDR) < 0.005] including cell cycle, DNA replication, homologous recombination, pyrimidine metabolism, mismatch repair, pentose phosphate pathway, glycolysis gluconeogenesis and p53. The expression of CDCA5 mRNA was positively correlated with the expressions of HK2, PKM, PGK1, ALDOA, EN01 and LDHA (all P < 0.05). Conclusions:CDCA5 is highly expressed in pancreatic cancer tissues and is associated with poor prognosis of patients, and it can be used as a prognostic marker for pancreatic cancer.

Objective:To examine the expression of transmembrane emp24 domain-containing protein 4(TMED4) in liver tissue of patients with hepatocellular carcinoma, and to investigate the effects of TMED4 gene on the proliferation and migration of hepatocellular carcinoma cells and related molecular mechanisms. Methods:The expression of TMED4 at protein level in liver cancer tissue and paracancerous tissue of patients with hepatocellular carcinoma were detected by Western blotting and immunohistochemical stainning, and the correlation between its expression and clinicopathological features was analyzed. The effects of TMED4 overexpression or knockdown on proliferation, migration and healing ability of hepatocellular carcinoma cells in vitro and in vivo were determined by cell proliferation test, Transwell test, wound healing test and subcutaneous tumor formation in nude mice. The molecular mechanism of TMED4 in regulating the biological behavior of hepatocellular carcinoma cells was preliminarily explored by pathway analysis. Independent sample t test, Mann-Whitney U test and chi-square test were used for statistical analysis. Results:The results of Western blotting showed that the expression of TMED4 at protein level in hepatocellular carcinoma tissue was lower than that in paracancerous tissue(0.52±0.29 vs. 0.83±0.22), and the difference was statistically significant( t=2.54, P=0.022). The results of immunohistochemical examination indicated that the expression of TMED4 at protein level in liver cancer tissue was lower than that in paracancerous tissue(5.46±3.37 vs. 7.58±3.08), and the difference was statistically significant( t=3.49, P<0.001). The expression of TMED4 at protein level was significantly correlated with vascular invasion and Barcelona clinic liver cancer stage( χ2=6.83 and 4.20, P=0.009 and 0.040). The results of cell proliferation assay showed that the absorbance value of SMMC-7721 cells in TMED4 overexpression group was lower than that in control group(1.38±0.05 vs. 2.37±0.08), while the optical density value of HepG2 in TMED4 knockdown group was higher than that in control group(0.76±0.04 vs. 0.54±0.01), and the differences were statistically significant( t=18.23 and 8.85, both P<0.001). The results of Transwell test showed that the number of migrated SMMC-7721 cells in TMED4 overexpression group was less than that in control group(286.30±13.01 vs. 439.70±12.34), while the number of migrated HepG2 cells in TMED4 knockdown group was higher than that in control group(249.00±6.00 vs. 160.00±6.56), and the differences were statistically significant( t=14.81 and 17.34, both P<0.001). The wound healing test showed that the healing rate of SMMC-7721 cells in TMED4 overexpression group was lower than that in control group((0.21±0.01)% vs.(0.45±0.01)%), the healing rate of HepG2 cells in TMED4 knockdown group was higher than that in control group((0.46±0.01)% vs.(0.20±0.01)%), and the differences were statistically significant( t=200.10 and 30.46, both P<0.001). The results of subcutaneous tumor formation assay in nude mice showed that the growth rate of cells in TMED4 overexpression group was slower than that in control group. After cell inoculation for 6 weeks, the subcutaneous tumor volume of mice in TMED4 overexpression group was smaller than that in control group(27.36 mm 3(138.70 mm 3) vs. 1 741.62 mm 3(1 783.39 mm 3)), the tumor weight was lower than that in control group(0.06 g(0.14 g) vs. 1.46 g(1.09 g)), and the differences were statistically significant(both Z=-2.31, both P<0.001). The results of Western blotting showed that the expression of Snail at protein level in SMMC-7721 cells of the TMED4 overexpression group was lower than that of the control group(0.32±0.01 vs. 0.90±0.03), the protein level of Snail in HepG2 cells of TMED4 knockdown group was higher than that of control group(1.03±0.01 vs. 0.97±0.01), and the differences were statistically significant( t=28.49 and 12.31, both P<0.001). The results of real time fluorescent quantitative polymerase chain reaction showed that the expression of Snail at mRNA level in SMMC-7721 cells of TMED4 overexpression group was lower than that of control group(0.13±0.05 vs. 1.00±0.15), the expression of Snail at mRNA level in HepG2 cells of TMED4 knockdown group was higher than that of control group(1.25±0.32 vs. 0.21±0.14), and the differences were statistically significant( t=9.62 and 5.10, P<0.001 and P=0.007). Conclusion:TMED4 may affect the proliferation and migration of hepatocarcinoma cells by regulating the expression of Snail, and which is expected to become a potentially therapeutic target for hepatocellular carcinoma.

Objective:A retrospective analysis was performed on clinical characteristics and deoxyguanosine kinase DGUOK gene mutations in a family with hepatocerebral mitochondrial DNA depletion syndrome (MTDPS). Methods:The clinical data, treatment process and gene detection results of a child with MTDPS in the second hospital of Hebei Medical University in April 2019 were analyzed and summarized.Results:Proband was a girl.From the first week of infantile, she suffered from recurrent hypoglycemia, hyperlactic acid, progressive cholestatic liver dysfunction, coagulopathy, difficult feeding, slow growth of body mass, microcephaly, hypotonia, and gradul intermittent binocular tremors, and eventually failed to thrive.Gene testing identified two compound heterozygous mutations c. 42-c.43insTTCA(p.F15fs129X)/c.808-1(IVS6)G>A in DGUOK gene.The former was a frame-shift mutation resulted in truncated protein and the later was a splicing mutation resulted in abnormal splicing.Each parent was a heterozygous carrier, and there were no mutations in the two sites with her elder sister. Conclusions:Both mutations were first reported worldwide. DGUOK gene mutations with MTDPS are important causes of infant liver failure.When hypoglycemia, hyperlactic acidemia and liver dysfunction occur in newborn and infant, MTDPS related gene DGUOK gene sequencing screening should be considered for early definitive diagnosis, or, when acute liver failure happen in infant and childhood, neuromuscular involvement is insufficient.

Objective:To observe the effect of observing good swallowing on the swallowing action of stroke survivors with dysphagia.Methods:Eighteen stroke survivors with dysphagia were randomly divided into a treatment group ( n=9) and a control group ( n=9). In addition to routine swallowing rehabilitation therapy, the treatment group was asked to simulate swallowing after watching a video of normal people′s swallowing action. They did so 5 times a week for 10 minutes, while the control group just watched landscape videos at the same time. The treatment lasted 8 weeks. Before and after the treatment, both groups were assessed using the eating assessment tool (EAT-10), the functional oral intake scale (FOIS) and the penetration and aspiration scale (PAS). Functional magnetic resonance imaging (fMRI) was also used to observe their swallowing action. Results:There was no significant difference between the two groups in any of the measurements before the treatment. After the 8 weeks of treatment the average EAT-10, FOIS and PAS scores of the treatment group were all significantly better than before the treatment and better than the control group′s averages at the time. fMRI showed significantly more areas activated in the precuneus, parietal lobe, posterior central gyrus, BA7, BA5, frontal lobe and paracentral lobule in the treatment group compared with before the intervention and also more than in the control group.Conclusions:Observing proper swallowing action can improve dysphagia and activation of the swallowing-related brain areas of stroke survivors.

Objective:To systematically review and synthesize qualitative researches on self-management experience of home-based rehabilitation for patients with chronic diseases and focus on obstacles and promoting factors in the process of home self-management, so as to provide evidence for construction of self-management system of home rehabilitation for chronic diseases.Methods:Cochrane Library, Embase, Medline, PsycINFO, Scopus, PubMed, Web of Science, China National Knowledge Infrastructure (CNKI) , Wanfang Database, VIP and China Biology Medicine disc (CBMdisc) were searched by computer to collect qualitative studies related to self-management experience of home rehabilitation for patients with chronic diseases. The retrieval time was from construction of the database to May 31, 2020. The quality evaluation was carried out using quality evaluation standard for qualitative research (2016) in Australian Joanna Briggs Institute (JBI) Evidence-Based Health Care Center, and the Meta synthesis was carried out using integrative synthesis method.Results:A total of 23 researches were included and 82 results were extracted. Those researches were included into 9 classifications and were synthesized into 4 integrated results, including multiple stresses in home-based rehabilitation self-management of chronic disease, inadequate supportive resources related to home-based rehabilitation self-management of chronic disease, home-based rehabilitation self-management level of patients with chronic diseases to be further improved and positive experience of home self-management of patients with chronic diseases.Conclusions:Home-based rehabilitation for patients with chronic diseases face multiple obstacles in the process of self-management. Nursing staff should efficiently integrate the available home-based rehabilitation self-management medical resources in the area, accurately connect home-based rehabilitation self-management needs of patients and early identify potential risks in home-based rehabilitation self-management process, so as to improve their home self-management effect.

Objective:To understand the expectations and needs of patients with chronic diseases for the home rehabilitation resource integration and analyze the available resources and integration methods of chronic disease home rehabilitation projects so as to provide a reference for establishing a complete chronic disease home rehabilitation service system.Methods:The research adopted the phenomenological research method in qualitative research. From October to December 2019, the purpose sampling was used to select 16 chronic disease patients with home rehabilitation who were followed up by the Chronic Disease Management Center of a comprehensive Class Ⅲ Grade A hospital in Shanghai for semi-structured in-depth interviews. The Colaizzi 7-step analysis method was used to organize the interview results and refine the theme.Results:A total of 4 themes of the expectations and needs of patients with chronic diseases for the home rehabilitation resource integration were extracted including that the effective resource for home rehabilitation of chronic diseases was limited; the level of home rehabilitation of chronic diseases needed to be improved; resources related to home rehabilitation of chronic diseases were obviously fragmented; the government and primary medical institutions should strengthen the importance of home rehabilitation of chronic diseases.Conclusions:At present, patients with chronic diseases have high expectations and needs for the home rehabilitation resource integration. The medical resources available in the region should be effectively integrated, and a resource sharing platform should be formed to improve the home rehabilitation effect of patients with chronic diseases so as to promote the overall development of chronic disease home rehabilitation projects.