Objective:To investigate the clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene. Methods:The clinical data and whole exome sequencing results of 2 patients who were diagnosed as developmental and epileptic encephalopathy related to the EEF1A2 gene in the Children′s Hospital, Capital Institute of Pediatrics in June 2016 and August 2018 were retrospectively analyzed. Relevant literatures were retrieved using " EEF1A2" and "epileptic encephalopathy" or "epilepsy" as key words in Online Mendelian Inheritance in Man, PubMed, CNKI and Wanfang databases (literatures searching from establishment of these databases to June 2024). The clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene were summarized based on literature reports and the data of these 2 patients. Results:Patient 1 was a 9 months old male infant. He presented with global developmental delay. He developed myoclonic seizures at 4 months old. Valproic acid, clonazepam, topiramate and vagus nerve stimulation were all ineffective. Both of his hands had transverse palmar crease. The de novo c.364G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Patient 2 was a 2 years and 2 months old boy. He presented with global developmental delay. Myoclonic seizures occurred when he was 2 years and 3 months old, and various anti-epileptic drugs were ineffective. He had left eye esotropia and low muscle tone in the extremities. He died at the age of 4. The de novo c.208G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Eight literatures on developmental and epileptic encephalopathy related to the EEF1A2 gene (all in English) were retrieved, reporting 28 cases (totally 30 patients, including 2 cases in this study). The main clinical manifestations were psychomotor developmental delay (30/30, 100.0%), facial dysmorphism (15/30, 50.0%), refractory epilepsy (14/26, 53.8%), myoclonic seizures (19/26, 73.1%), and movement disorders (8/16). A total of 15 mutation sites in the EEF1A2 gene were reported, all of which were missense mutations. Conclusions:Developmental and epileptic encephalopathy related to the EEF1A2 gene is primarily characterized by delayed psychomotor development, distinctive facial features, drug-resistant epilepsy, myoclonic seizures, and movement disorders. Variants in the EEF1A2 gene are predominantly missense mutations, and identifying these variants plays a crucial role in accurate diagnosis of the disease.

Objective:To summarize the clinical phenotype and genetic features of patients with relapsing encephalopathy with cerebellar ataxia (RECA) caused by ATP1A3 gene R756 variants. Methods:A retrospective analysis was performed on patients carrying the ATP1A3 gene R756 variants, identified by whole-exome sequencing of family members, at Capital Center for Children′s Health, Capital Medical University and Children's Medical Center, Peking University First Hospital from August 2005 to February 2024. Their clinical, laboratory, neuroimaging, electrophysiological and genetic characteristics were summarized. Results:A total of 13 RECA patients were enrolled in this study, including 8 males and 5 females. The age of onset was 8 months to 5 years, with a median age of onset of 18 months. All of 13 patients presented paroxysmal episodes of neurological decompensations triggered by fever and residual symptoms following the acute phase. During acute attack stage, ataxia was observed in all 13 cases, muscle weakness in 12 cases, dysarthria in 12 cases, altered consciousness in 10 cases, dysphagia in 10 cases, dystonic episodes in 4 cases, abnormal eye movement in 2 cases, choreoathetosis in 2 cases, and epileptic seizures in 1 case. All 13 patients had residual symptoms during the nonparoxysmal period, of whom 9 patients had ataxia, 9 patients had dysarthria, 4 patients had dystonia, 3 patients had cognitive disorders, and 1 patient had epileptic seizures. All 13 cases had ATP1A3 missense variants, and variant c.2266C>T/p.R756C was found in 6 cases, c.2267G>A/p.R756H in 5 cases, and c.2267G>T/p.R756L in 2 cases. Nine cases carried de novo variants, 4 with inherited variants. Conclusions:RECA caused by variants of ATP1A3 in residue 756 typically presents with an acute onset during infancy or early childhood, precipitated by febrile episodes and characterized by recurrent episodes of ataxia, with bulbar paralysis, muscle weakness and altered consciousness. Recurrence is common, and the most common persistent symptoms are cerebellar ataxia and dysarthria. A few patients have cognitive impairment. Three types of ATP1A3 gene variants R756C, R756H and R756L are related with RECA, and R756C is the most common variant.

Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.

Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.

Objective:To investigate the clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene. Methods:The clinical data and whole exome sequencing results of 2 patients who were diagnosed as developmental and epileptic encephalopathy related to the EEF1A2 gene in the Children′s Hospital, Capital Institute of Pediatrics in June 2016 and August 2018 were retrospectively analyzed. Relevant literatures were retrieved using " EEF1A2" and "epileptic encephalopathy" or "epilepsy" as key words in Online Mendelian Inheritance in Man, PubMed, CNKI and Wanfang databases (literatures searching from establishment of these databases to June 2024). The clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene were summarized based on literature reports and the data of these 2 patients. Results:Patient 1 was a 9 months old male infant. He presented with global developmental delay. He developed myoclonic seizures at 4 months old. Valproic acid, clonazepam, topiramate and vagus nerve stimulation were all ineffective. Both of his hands had transverse palmar crease. The de novo c.364G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Patient 2 was a 2 years and 2 months old boy. He presented with global developmental delay. Myoclonic seizures occurred when he was 2 years and 3 months old, and various anti-epileptic drugs were ineffective. He had left eye esotropia and low muscle tone in the extremities. He died at the age of 4. The de novo c.208G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Eight literatures on developmental and epileptic encephalopathy related to the EEF1A2 gene (all in English) were retrieved, reporting 28 cases (totally 30 patients, including 2 cases in this study). The main clinical manifestations were psychomotor developmental delay (30/30, 100.0%), facial dysmorphism (15/30, 50.0%), refractory epilepsy (14/26, 53.8%), myoclonic seizures (19/26, 73.1%), and movement disorders (8/16). A total of 15 mutation sites in the EEF1A2 gene were reported, all of which were missense mutations. Conclusions:Developmental and epileptic encephalopathy related to the EEF1A2 gene is primarily characterized by delayed psychomotor development, distinctive facial features, drug-resistant epilepsy, myoclonic seizures, and movement disorders. Variants in the EEF1A2 gene are predominantly missense mutations, and identifying these variants plays a crucial role in accurate diagnosis of the disease.

Objective:To summarize the clinical phenotype and genetic features of patients with relapsing encephalopathy with cerebellar ataxia (RECA) caused by ATP1A3 gene R756 variants. Methods:A retrospective analysis was performed on patients carrying the ATP1A3 gene R756 variants, identified by whole-exome sequencing of family members, at Capital Center for Children′s Health, Capital Medical University and Children's Medical Center, Peking University First Hospital from August 2005 to February 2024. Their clinical, laboratory, neuroimaging, electrophysiological and genetic characteristics were summarized. Results:A total of 13 RECA patients were enrolled in this study, including 8 males and 5 females. The age of onset was 8 months to 5 years, with a median age of onset of 18 months. All of 13 patients presented paroxysmal episodes of neurological decompensations triggered by fever and residual symptoms following the acute phase. During acute attack stage, ataxia was observed in all 13 cases, muscle weakness in 12 cases, dysarthria in 12 cases, altered consciousness in 10 cases, dysphagia in 10 cases, dystonic episodes in 4 cases, abnormal eye movement in 2 cases, choreoathetosis in 2 cases, and epileptic seizures in 1 case. All 13 patients had residual symptoms during the nonparoxysmal period, of whom 9 patients had ataxia, 9 patients had dysarthria, 4 patients had dystonia, 3 patients had cognitive disorders, and 1 patient had epileptic seizures. All 13 cases had ATP1A3 missense variants, and variant c.2266C>T/p.R756C was found in 6 cases, c.2267G>A/p.R756H in 5 cases, and c.2267G>T/p.R756L in 2 cases. Nine cases carried de novo variants, 4 with inherited variants. Conclusions:RECA caused by variants of ATP1A3 in residue 756 typically presents with an acute onset during infancy or early childhood, precipitated by febrile episodes and characterized by recurrent episodes of ataxia, with bulbar paralysis, muscle weakness and altered consciousness. Recurrence is common, and the most common persistent symptoms are cerebellar ataxia and dysarthria. A few patients have cognitive impairment. Three types of ATP1A3 gene variants R756C, R756H and R756L are related with RECA, and R756C is the most common variant.

Objective:To summarize the clinical manifestations, diagnosis, treatment and prognosis of acute flaccid myelitis (AFM) in children.Methods:Clinical characteristics of 4 AFM cases from Department of Neurology, Children′s Hospital Affiliated to Capital Institute of Pediatrics, from September 2018 to November 2022, were analyzed retrospectively.Results:The age of 4 children with AFM was 7 years, 4 years and 3 months, 7 years and 1 month, 6 years and 5 months, respectively. There were 2 boys and 2 girls. Prodromal infection status showed 3 children of respiratory tract infection and 1 child of digestive tract infection. The main manifestation was asymmetrical limb weakness after infection, and the affected limb range was from monoplegia to quadriplegia. Cranial nerve injury was involved in 1 child, no encephalopathy. Magnetic resonance imaging in the spinal cord of all 4 children showed long T1 and T2 signals, mainly involving gray matter. Cerebrospinal fluid cell-protein separation was observed in 2 children. Pathogen detected in 1 child pharyngeal swab was enterovirus D68. Antibody IgM to adenovirus was positive in the blood of 1 child. Antibody IgG against Echo and Coxsackie B virus were positive in the blood of another child. After glucocorticoid, human immunoglobulin or simple symptomatic treatment and at the same time under later rehabilitation training, muscle strength recovered to different degrees, but there were disabilities left in 3 children.Conclusions:AFM should be considered in children with acute and asymmetrical flaccid paralysis accompanied by abnormal magnetic resonance imaging signal in the central region of spinal cord, especially post-infection. The effective treatment is limited and the prognosis is poor.

Objective:To analyze the clinical manifestations, gene mutation characteristics and treatment effects of patients with GATOR1 complex-related epilepsy, and to explore the diagnosis and treatment of this disease.Methods:The medical history, electroencephalogram, brain imaging, genetic test results, treatment and follow-up data of patients with GATOR1 complex-related epilepsy who attended the Children′s Hospital Affiliated to Capital Institute of Pediatrics, Beijing Tsinghua Changgung Hospital, and Shanghai Deji Hospital from May 2017 to July 2022 were retrospectively analyzed.Results:A total of 16 patients with GATOR1 complex-related epilepsy were collected, including 7 males and 9 females. The age of onset of epilepsy was from 2 months to 14 years. Ten cases had focal seizures only, 2 cases had generalized seizures only, and 4 cases had coexistence of focal seizures and generalized seizures, of which generalized seizures included generalized tonic-clonic seizure, spastic seizure, and myoclonic seizure. Among the 16 patients, 2 had infantile spasms, 3 had familial focal epilepsy with variable focus, and 1 had sleep related hyperkinetic epilepsy. Electroencephalogram intervals suggested multiple brain areas discharge or diffuse discharge. A total of 13 DEPDC5 gene mutation sites, 1 NPRL2 gene mutation site, and 2 NPRL3 gene mutation sites were found; 4 sites of DEPDC5 gene were reported sites, the rest were unreported; all mutations had pathogenic significance; 8 cases had nonsense mutation, 1 case had large fragment deletion, 4 cases had frameshift mutation, 1 case had integer mutation, 2 cases had splicing mutation; 13 cases′ mutation was inherited from parents, 2 cases had new mutation, and 1 case had unverified mutation. Magnetic resonance imaging (MRI) showed 5 of the 16 patients were normal, and 11 had abnormal cerebral cortex structure, manifested as bottom-of-sulcus focal cortical dysplasia (FCD), abnormal formation of sulci and (or) gyri with or without ill-defined gray-white matter and malformation of cortical dysplasia of the bilateral brain. Seven patients underwent stereotactic electroencephalogram (SEEG) monitoring, and the SEEG showed low-amplitude fast rhythm at the beginning in 6 patients, of whom 5 cases started from the frontal lobe, and 1 case started from the parietal lobe. Eight patients were only treated with drugs, 1 with single-drug therapy and the rest with multi-drug combination therapy. Eight patients underwent surgery. Among them, 5 patients with DEPDC5 gene mutation underwent epileptogenic cortex excising after SEEG monitoring, and postoperative pathological examinations showed FCDⅡ, FCDⅢ or non-specific changes; 1 patient was waiting for surgery. One patient with NPRL3 gene mutation underwent epileptogenic foci resection and postoperative pathological examinations showed FCDⅡa; the other patient with NPRL3 gene mutation underwent radiofrequency thermocoagulation after SEEG monitoring. Follow-up showed that 3 patients were seizure-free with drug treatment, and 4 patients had fewer seizures after drug treatment. Six cases underwent epileptic foci resection. Five of them were assisted by SEEG to locate the epileptic foci before surgery and were seizure-free after the operation, but the range of surgical resection was wider than the abnormal range shown by MRI; whereas 1 case who was not assisted by SEEG showed no improvement. There was still 1 case who underwent SEEG-guided radiofrequency thermocoagulation and had no improvement after operation. Conclusions:GATOR1 complex-related epilepsy mostly manifests as focal seizures. SEEG shows that seizures originate from the frontal lobe more often, and cortical developmental abnormalities are often found. DEPDC5 gene mutations are the most common ones, mostly inherited from parents, with high incomplete penetrance rate. Therefore, genetic testing is recommended for non-acquired brain structural abnormalities. For those who are refractory to drugs, a radical cure can be obtained by resection of the epileptogenic foci after preoperative evaluation.

Objective: To explore the correlation between ATP1A3 genotype and phenotype in children with alternating hemiplegia of childhood (AHC). Methods: This was a retrospective study. The clinical data and peripheral blood DNA of AHC patients were collected in Peking University First Hospital from August 2005 to December 2017. ATP1A3 gene mutations were screened by Sanger sequencing or next generation sequencing (NGS). AHC patients were divided into difference groups according to different hotspot mutations. SPSS 23.0 was used to analyze the correlation between genotype and phenotype. Variance analysis was used to compare the measurement data between groups. Chi square test was used to compare the categorical data between groups. Kruskal-Wallis test was used to compare the unidirectional ordered data between groups. Least-significant difference(LSD) was used to compare the data between two groups. Results: A total of 119 AHC patients were recruited, including 68 males and 51 females. The onset age of 113 (95.0%) patients was within 18 months. There were 119 cases (100.0%) with hemiplegic seizures, 109 cases (91.6%) with abnormal eyeball movements, 104 cases (87.4%) with dystonia, 31 cases (26.1%) with autonomic neurological symptoms, 31 cases (26.1%) with epileptic seizures and 117 cases (98.3%) with long-term developmental delay. In 113 patients (95.0%) with ATP1A3 gene mutations, 111 were de novo mutation and 2 were genetic mutations. A total of 39 mutation types were found, including 37 missense mutations and 2 deletion mutations. Seventeen of them were novel mutations. The three hotspot mutations were D801N (n=34, 30.1%), E815K (n=20, 17.7%) and G947R (n=13, 11.5%). The age of onset of D801N and E815K were earlier than G947R ((3.1±2.1)and (2.3±2.3)vs.(6.4±7.7) months, P=0.004 and 0.003). The age of first hemiplegic events of D801N and E815K were earlier than G947R((6.4±3.1) and (6.8±3.3) vs. (11.4±10.1) months, P=0.004 and 0.016). More patients with E815K mutations presented epilepsy than those with D801N (P=0.003) and G947R (P=0.001). More patients with E815K mutations presented greater motor and intellectual disability than the patients with D801N (P=0.001) and G947R mutations (P=0.001). Conclusions ATP1A3 gene is the main causative gene of AHC. Three hotspot mutations, D801N, E815K and G947R, were found. Hotspot mutation E815K is associated with the most severe phenotype, which presented an earlier age at the time of the first paroxysmal manifestation and first hemiplegic event, severer developmental delay and a greater proportion of epilepsy.

Objective To investigate the effective rate of Flunarizine in treating alternating hemiplegia during childhood (AHC) kids,and to analyze the related factors influencing efficacy.Methods The clinical data and peripheral blood DNA of AHC patients at the Outpatient and Inpatient Ward of Department of Pediatrics,Peking University First Hospital from August 2005 to May 2016 were collected,and the A TP1A3 gene mutations were screened.Clinical efficacy of oral administration of Flunarizine for improving paroxysmal symptoms such as alternating hemiplegia in AHC patients was followed up.Results A total of 96 AHC patients were collected,and among them,75 cases received oral administration of flunarizine were followed up for 1-11 years.The age of last follow-up was 1-21 years old (the median age was 5 years old).Fifty of these 75 patients (66.7％) were improved,while 25 patients were not alleviated (33.3％).In 50 improved patients,43 patients (86.0％) reduced the frequency of hemiplegia attacks,28 patients (56.0％) reduced the duration,and 3 patients (6.0％) alleviated the severity.Univariate analysis between the effective group and ineffective group showed that differences in age of onset,age of initial treatment,dose and carrying D801N,E815K or G947R mutation of ATP1A3 gene were not statistically significant(all P ＞0.05).The findings by multivariate analysis indicated that age of onset,age of initial treatment,dose and carrying D801N,E815K or G947R mutation of ATP1A3 gene were not related to the efficacy of Flunarizine.Conclusion Flunarizine is effective for most AHC children,which can reduce the frequency of hemiplegia attacks,shorten the duration,and alleviate the severity of attacks.Age of onset,age of initial treatment,dose and carrying D801N,E815K or G947R mutation of gene A TP1A3 are not factors influencing efficacy.