With the acceleration of global population aging， the assessment and prediction of brain aging have become an important research direction in neuroscience. Brain age， as an indicator for measuring the biological age of the brain， can be used to assess individual cognitive function and predict the risk of neurodegenerative diseases. Neuroimaging techniques can reveal the structure and functional state of the brain， providing an important basis for brain age prediction. The hypoxic environment at high altitudes may accelerate brain aging， and its neuroimaging features provide a unique perspective for assessing brain aging. This article reviews the latest research advances in brain aging and brain age prediction under a high-altitude hypoxia environment， with a focus on the construction of brain age prediction models， the application of sMRI/DTI/fMRI， and the impact of high-altitude hypoxia on brain structure， function， and mechanisms， in order to provide a reference and directions for future research.
Neuroimaging

Objective To understand the equity and influencing factors of maternal health service utilization in Changning District, Shanghai. Methods A convenience sampling method was used to conduct a questionnaire survey among mothers of children aged 1 to 1.5 years old who received health services from the child health care clinics and EPI clinics of 10 community health service centers in Changning District, Shanghai from March to April 2022. Count data was expressed by frequency and percentage. Chi-square analysis, binomial logistic regression analysis, and multivariate logistic regression analysis were used to analyze fairness-related factors. Rate difference, rate ratio and concentration index were used to represent fairness. Results A total of 696 subjects were investigated, with an average age of (33.35±4.76) years. There were statistically significant differences in service utilization among women with different household registrations only in early pregnancy registration (χ²=11.026, P=0.001) and postpartum visits (χ²=4.989, P=0.026). Women with a career showed differently in folic acid supplement (χ²=6.247, P=0.012), early pregnancy registration (χ²=12.989, P=0.002), physical examination in 42 days postpartum (χ²=4.446, P=0.035) and postpartum contraception (χ²=4.061, P=0.044), and the differences were statistically significant. Women with different monthly family income had a statistically significant difference in pre-pregnancy examination (χ²=8.977, P=0.030) and postpartum visit (χ²=16.114, P=0.001). There was a statistically significant difference between women with maternity insurance or not in the early pregnancy registration (χ²=10.576, P=0.001) and physical examination in 42 days postpartum (χ²=8.166, P=0.004). The results of the multivariate analysis showed that occupation (OR=2.616, 95% CI: 1.142-5.990) and maternity insurance (OR=4.490, 95% CI: 1.992~10.120) affected the utilization of service in early pregnancy registration. The monthly household income (OR=0.278, 95% CI: 0.124-0.625) affected the utilization of services in postpartum visit. At the same time, the monthly household income (10,000-19,999: OR=0.286, 95% CI: 0.090-0.907; ≥30,000: OR=0.180, 95% CI: 0.041-0.801) also affected the utilization of service in physical examination in 42 days postpartum. Conclusion The equity of maternal health care service utilization overall is good in central area in Shanghai, but there is still room for improvement. It is necessary to strengthen community mobilization, propagandize maternal health services, and expand the coverage of maternity insurance to improve the equity of maternal health service utilization and provide equal access to maternity health services.

OBJECTIVE: To observe the clinical efficacy of warming acupuncture combined with western medication for oligoasthenoteratozoospermia of kidney-yang insufficiency and its effects on the levels of interleukin (IL)-6 and IL-10 in seminal plasma. METHODS: A total of 60 patients with oligoasthenoteratozoospermia of kidney-yang insufficiency were randomly divided into a combination group and a medication group, with 30 cases in each group. The medication group was treated with levocarnitine oral solution orally, 10 mL once, 3 times a day. On the basis of the treatment in the medication group, warming acupuncture was applied at Baihui (GV20), Guanyuan (CV4) and Mingmen (GV4) in the combination group, once every other day, 3 times a week. Both groups were treated for 12 weeks. Before and after treatment, the TCM syndrome score was observed, the semen routine indexes (the sperm concentration, progressive [PR] sperm motility, PR + non-progressive [NP] sperm motility and sperm malformation rate), the serum sex hormones indexes (follicle-stimulating hormone [FSH], luteinizing hormone [LH], testosterone [T] and estradiol [E₂]), as well as the IL-6 and IL-10 levels in seminal plasma were detected, and the clinical efficacy was evaluated after treatment in the two groups. RESULTS: After treatment, except for the hyposexuality score in the medication group, the each item scores and total scores of TCM syndrome were decreased compared with those before treatment (P<0.01, P<0.05), the sperm malformation rates, serum FSH and LH levels, IL-6 levels in the seminal plasma were decreased compared with those before treatment (P<0.01, P<0.05), the PR sperm motility, PR + NP sperm motility, serum T levels, IL-10 levels in the seminal plasma were increased compared with those before treatment (P<0.01, P<0.05) in the two groups; the sperm concentration was increased compared with that before treatment in the combination group (P<0.01). After treatment, compared with the medication group, except for the hyposexuality and frequent nocturia scores, the each item scores and total score of TCM syndrome were lower (P<0.01, P<0.05); the sperm concentration, PR sperm motility and PR + NP sperm motility, serum T level, IL-10 level in the seminal plasma were higher (P<0.01, P<0.05); sperm malformation rate, serum FSH and LH levels, IL-6 level in the seminal plasma were lower (P<0.01, P<0.05) in the combination group. The total effective rate was 83.8% (25/30) in the combination group, which was superior to 60.0% (18/30) in the medication group (P<0.05). CONCLUSION Warming acupuncture combined with western medication can effectively treat oligoasthenoteratozoospermia of kidney-yang insufficiency, regulate the levels of sex hormones, and its mechanism may be related to the down-regulation of IL-6 level and the up-regulation of IL-10 level in seminal plasma.
Humans ; Male ; Interleukin-10/genetics* ; Interleukin-6/genetics* ; Adult ; Semen/metabolism* ; Acupuncture Therapy ; Oligospermia/drug therapy* ; Yang Deficiency/physiopathology* ; Kidney/physiopathology* ; Young Adult ; Asthenozoospermia/drug therapy* ; Combined Modality Therapy ; Treatment Outcome

Cold has been a long-term survival challenge in the evolutionary process of mammals. In response to cold stress, in addition to brown adipose tissue (BAT) dissipating energy as heat through glucose and lipid oxidation to maintain body temperature, cold stimulation can strongly activate thermogenesis and energy expenditure in beige fat cells, which are widely distributed in the subcutaneous layer. However, the effects of cold stimulation on other tissues and systemic lipid metabolism remain unclear. Our previous research indicated that, under cold stress, BAT not only produces heat but also secretes numerous exosomes to mediate BAT-liver crosstalk. Whether subcutaneous fat has a similar mechanism is still unknown. Therefore, this study aimed to investigate the alterations in lipid metabolism across various tissues under cold exposure and to explore whether subcutaneous fat regulates systemic glucose and lipid metabolism via exosomes, thereby elucidating the regulatory mechanisms of lipid metabolism homeostasis under physiological stress. RT-qPCR, Western blot, and H&E staining methods were used to investigate the physiological changes in lipid metabolism in the serum, liver, epididymal white adipose tissue, and subcutaneous fat of mice under cold stimulation. The results revealed that cold exposure significantly enhanced the thermogenic activity of subcutaneous adipose tissue and markedly increased exosome secretion. These exosomes were efficiently taken up by hepatocytes, where they profoundly influenced hepatic lipid metabolism, as evidenced by alterations in the expression levels of key genes involved in lipid synthesis and catabolism pathways. This study has unveiled a novel mechanism by which subcutaneous fat regulates lipid metabolism through exosome secretion under cold stimulation, providing new insights into the systemic regulatory role of beige adipocytes under cold stress and offering a theoretical basis for the development of new therapeutic strategies for obesity and metabolic diseases.
Animals ; Lipid Metabolism/physiology* ; Mice ; Exosomes/metabolism* ; Cold Temperature ; Subcutaneous Fat/physiology* ; Thermogenesis/physiology* ; Adipose Tissue, Brown/metabolism* ; Male

Eight butyl-phthalides, senkyunolide K(1), senkyunolide N(2), butylphthalide(3), senkyunolide I(4), senkyunolide H(5),(Z)-butylidenephthalide(6),(Z)-ligustilide(7), and 3-butylidene-7-hydroxyphthalide(8) were isolated from the aerial part of Ligusticum sinense by column chromatography on silica gel column, ODS, Sephadex LH-20 and semi-preparative HPLC. Their structures were elucidated on the basis of spectroscopic and chemical data, especially NMR and MS. Compound 1 was a new butyl-phthalide and compounds 2-8 were isolated from the aerial part of L. sinense for the first time. Furthermore, the inhibitory activities of compounds 1-8 against the nitric oxide(NO) production induced by lipopolysaccharide(LPS) in mouse RAW264.7 macrophages in vitro were evaluated. The results showed that compounds 1-8 exerted inhibitory activities on NO production with IC_(50) of 19.34-42.16 μmol·L~(-1).
Animals ; Mice ; Nitric Oxide/biosynthesis* ; Ligusticum/chemistry* ; Benzofurans/isolation & purification* ; Drugs, Chinese Herbal/isolation & purification* ; Macrophages/immunology* ; RAW 264.7 Cells ; Molecular Structure

Objective:To investigate the clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene. Methods:The clinical data and whole exome sequencing results of 2 patients who were diagnosed as developmental and epileptic encephalopathy related to the EEF1A2 gene in the Children′s Hospital, Capital Institute of Pediatrics in June 2016 and August 2018 were retrospectively analyzed. Relevant literatures were retrieved using " EEF1A2" and "epileptic encephalopathy" or "epilepsy" as key words in Online Mendelian Inheritance in Man, PubMed, CNKI and Wanfang databases (literatures searching from establishment of these databases to June 2024). The clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene were summarized based on literature reports and the data of these 2 patients. Results:Patient 1 was a 9 months old male infant. He presented with global developmental delay. He developed myoclonic seizures at 4 months old. Valproic acid, clonazepam, topiramate and vagus nerve stimulation were all ineffective. Both of his hands had transverse palmar crease. The de novo c.364G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Patient 2 was a 2 years and 2 months old boy. He presented with global developmental delay. Myoclonic seizures occurred when he was 2 years and 3 months old, and various anti-epileptic drugs were ineffective. He had left eye esotropia and low muscle tone in the extremities. He died at the age of 4. The de novo c.208G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Eight literatures on developmental and epileptic encephalopathy related to the EEF1A2 gene (all in English) were retrieved, reporting 28 cases (totally 30 patients, including 2 cases in this study). The main clinical manifestations were psychomotor developmental delay (30/30, 100.0%), facial dysmorphism (15/30, 50.0%), refractory epilepsy (14/26, 53.8%), myoclonic seizures (19/26, 73.1%), and movement disorders (8/16). A total of 15 mutation sites in the EEF1A2 gene were reported, all of which were missense mutations. Conclusions:Developmental and epileptic encephalopathy related to the EEF1A2 gene is primarily characterized by delayed psychomotor development, distinctive facial features, drug-resistant epilepsy, myoclonic seizures, and movement disorders. Variants in the EEF1A2 gene are predominantly missense mutations, and identifying these variants plays a crucial role in accurate diagnosis of the disease.

In recent years,the incidence of heat-related diseases has been on a steady upward trend,which is closely associated with environmental factors such as climate change and air pollution.Exposure to a hot environment and/or strenuous physical activities can progress to heat stroke(HS),an acute disease that can lead to death.Current research indicates that gut injury occupies the most crucial initiating position in the pathophysiological changes and pathogenesis of HS.Probiotics can reduce the incidence and mortality of HS through maintaining the health of the gut microbiota,regulating the intestinal immune system,and other effects.In addition,the gut microbiota can construct axis systems to interact with multiple organs such as the liver,lungs,and brain,which is of great significance for alleviating the damage to distant organs caused by HS.This paper reviews the regulation of the gut microbiota by probiotics to improve the intestinal heat tolerance ability and barrier function,aiming to provide references for the prevention and treatment of heat stroke in clinical practice.

Objective To explore imaging characteristics of myxofibrosarcoma(MFS)and their correlations with prognosis.Methods Totally 32 patients with pathologically confirmed MFS were retrospectively enrolled and divided into poor prognosis(recurrence/metastasis)group(n=13)and good prognosis group(n=19).Preoperative imaging characteristics of lesions were analyzed and compared between groups,including the location,shape,size,margins,density/signal features of lesions,adjacent bone destruction,peritumoral edema,fascial tail sign,enhancement patterns and tumor vasculature.Results MFS predominantly involved the extremities,especially the lower limbs,and the lesions commonly appeared as iso-to hypodensity masses with internal isodensity fibrous septations on non-enhanced CT.On non-enhanced MRI,MFS commonly demonstrated iso-to hypointense signals on T1WI,markedly hyperintense signals on T2WI,low signal fibrous septa,high signals on diffusion weighted imaging(DWI),as well as tail signs and surrounding soft tissue edema.After administration of contrast agents,solid components of MFS demonstrated marked enhancement.No statistical difference of tumor vascularity was detected between groups(P=0.141,1-β=0.269).Poor prognosis group showed significantly higher rates of diffuse peritumoral edema and fascial tail signs than good prognosis group(both P＜0.05).Conclusion Imaging features of MFS had certain characteristics,and the tail sign and surrounding soft tissue edema were correlated with poor prognosis.

Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.