With the acceleration of global population aging， the assessment and prediction of brain aging have become an important research direction in neuroscience. Brain age， as an indicator for measuring the biological age of the brain， can be used to assess individual cognitive function and predict the risk of neurodegenerative diseases. Neuroimaging techniques can reveal the structure and functional state of the brain， providing an important basis for brain age prediction. The hypoxic environment at high altitudes may accelerate brain aging， and its neuroimaging features provide a unique perspective for assessing brain aging. This article reviews the latest research advances in brain aging and brain age prediction under a high-altitude hypoxia environment， with a focus on the construction of brain age prediction models， the application of sMRI/DTI/fMRI， and the impact of high-altitude hypoxia on brain structure， function， and mechanisms， in order to provide a reference and directions for future research.
Neuroimaging

AIM: To investigate the correlation between different severity grades of obstructive sleep apnea-hypopnea syndrome(OSAHS)and visual field defects as well asvisual evoked potential(VEP)parameters in patients with anterior ischemic optic neuropathy(AION). METHODS: A retrospective case-control study. Patients diagnosed with AION complicated by OSAHS at the Department of Ophthalmology, the Affiliated Xuzhou Municipal Hospital of Xuzhou Medical University, between June 2022 and October 2025 were selected as the study subjects. According to the AHI and mSaO2, the patients were divided into three groups: a mild group(AHI 5-15 events/h, mSaO2 85%-90%), moderate group(AHI 16-30 events/h, mSaO2 80%-85%), and severe group(AHI >30 events/h, mSaO2 <80%). General demographic data, retinal nerve fiber layer(RNFL)thickness, visual field defect indicators including mean defect(MD)and pattern standard deviation(PSD), as well as VEP parameters(P100 latency and amplitude)were compared among the three groups. RESULTS: This study included a total of 110 patients with AION complicated by OSAHS. Based on the severity of OSAHS, the patients were divided into a mild group of 37 patients(21 men and 16 women, mean age 62.15±9.37 y), a moderate group of 35 patients(20 men, 15 women; mean age 61.82±8.94 y), and a severe group of 38 patients(22 men, 16 women; mean age 63.02±9.61 y). There were no significant differences among the three groups in terms of age, sex, TG, TC, LDL-C, HDL-C levels, or AION severity(all P>0.05); however, there were significant differences in history of hypertension, history of diabetes, systolic blood pressure, diastolic blood pressure, and FPG levels(all P<0.05). The mean RNFL thickness in the severe group(63.27±5.58 μm)was significantly lower than that in the moderate group(74.14±6.28 μm)and the mild group(83.22±7.02 μm), and the moderate group was lower than the mild group(all P<0.05); The MD value(-11.57±1.82 dB)and PSD value(7.35±0.87 dB)in the severe group were both higher than those in the moderate group [(-7.62±1.31 dB),(4.89±0.62 dB)] and the mild group [(-4.38±1.05 dB),(2.57±0.45 dB)](all P<0.05); the P100 latency in the severe group(132.41±8.57 ms)was longer than that in the moderate group(118.75±7.32 ms)and the mild group(105.62±6.14 ms), and the amplitude(7.65±1.53 μV)was lower than that of the moderate group(11.24±1.89 μV)and the mild group(15.38±2.11 μV)(all P<0.05). Spearman's correlation analysis revealed that the severity of OSAHS was negatively correlated with the MD value(rs=-0.901, P<0.05)and positively correlated with the PSD value and P100 latency(rs=0.947, 0.807, P<0.05), and was negatively correlated with P100 amplitude(rs=-0.878, P<0.05). CONCLUSION:The severity of OSAHS is closely associated with RNFL thickness, visual field defects, and VEP parameters in patients with AION; the more severe the OSAHS, the more pronounced the structural and functional damage to the optic nerve. Monitoring AHI and mSaO2 can aid in assessing the condition of patients with AION and developing personalized intervention plans.

Objective To explore imaging characteristics of myxofibrosarcoma(MFS)and their correlations with prognosis.Methods Totally 32 patients with pathologically confirmed MFS were retrospectively enrolled and divided into poor prognosis(recurrence/metastasis)group(n=13)and good prognosis group(n=19).Preoperative imaging characteristics of lesions were analyzed and compared between groups,including the location,shape,size,margins,density/signal features of lesions,adjacent bone destruction,peritumoral edema,fascial tail sign,enhancement patterns and tumor vasculature.Results MFS predominantly involved the extremities,especially the lower limbs,and the lesions commonly appeared as iso-to hypodensity masses with internal isodensity fibrous septations on non-enhanced CT.On non-enhanced MRI,MFS commonly demonstrated iso-to hypointense signals on T1WI,markedly hyperintense signals on T2WI,low signal fibrous septa,high signals on diffusion weighted imaging(DWI),as well as tail signs and surrounding soft tissue edema.After administration of contrast agents,solid components of MFS demonstrated marked enhancement.No statistical difference of tumor vascularity was detected between groups(P=0.141,1-β=0.269).Poor prognosis group showed significantly higher rates of diffuse peritumoral edema and fascial tail signs than good prognosis group(both P＜0.05).Conclusion Imaging features of MFS had certain characteristics,and the tail sign and surrounding soft tissue edema were correlated with poor prognosis.

AIM To observe the effects of Yiqi Jiedu Tongluo Formula(YQJDTL)on renal microvascular endothelial function and prevention of renal injury in a rat model of type 2 diabetes mellitus(T2DM).METHODS The SD rats were randomly divided into a normal group and a model group.The model group was administered with high-fat diet combined with a single intraperitoneal injection of STZ to establish the T2DM model.The successfully modeled rats were randomly divided into the model group,the canagliflozin group(9 mg/kg),and the low-dose and high-dose YQJDTL groups(4.77,9.45 g/kg).The corresponding doses of the drug were administered by gavage for a total of 12 weeks,during which the rats underwent observation of their general condition and blood glucose changes.After the end of administration,the rats had their levels of renal index,24-hour UP,serum SCr,BUN,TC,TG,HDL-C,LDL-C,ET-1 and NOS measured;their changes in renal microvasculature and the degree of renal fibrosis observed using HE staining,Masson staining,PAS staining,and PASM staining;their ultrastructure of the glomeruli observed using transmission electron microscopy;their renal protein expressions of TGF-β,SMAD2,SMAD3,Col-1,VEGFA and PKC detected by immunohistochemical staining and Western blot;and their renal mRNA expressions of VEGFA,TGF-β,SMAD2 determined by RT-qPCR.RESULTS Compared with the model group,the high-dose YQJDTL group showed decreased levels of renal index,blood glucose,TG,TC,HDL,24 h UP,BUN,SCr and ET-1(P＜0.05,P＜0.01);increased LDL and NOS levels(P＜0.05,P＜0.01);reduced renal inflammatory infiltration and fibrosis degree,inhibited fusion of foot processes and thickening of basement membrane;decreased renal protein expressions of TGF-β,SMAD2,SMAD3,VEGFA,PKC and Col-1(P＜0.05,P＜0.01);and decreased mRNA expressions of VEGFA,TGF-β and SMAD2(P＜0.01).CONCLUSION In the rat models of T2DM,YQJDTL can reduce their levels of blood glucose and lipids by improving the renal indices levels and the renal microvascular endothelial functions to alleviate renal fibrosis and microangiopathy as well,and the mechanism may be associated with the down-regulated expressions of TGF-β/SMAD and VEGF pathway-related proteins.

Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.

Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.

In recent years,the incidence of heat-related diseases has been on a steady upward trend,which is closely associated with environmental factors such as climate change and air pollution.Exposure to a hot environment and/or strenuous physical activities can progress to heat stroke(HS),an acute disease that can lead to death.Current research indicates that gut injury occupies the most crucial initiating position in the pathophysiological changes and pathogenesis of HS.Probiotics can reduce the incidence and mortality of HS through maintaining the health of the gut microbiota,regulating the intestinal immune system,and other effects.In addition,the gut microbiota can construct axis systems to interact with multiple organs such as the liver,lungs,and brain,which is of great significance for alleviating the damage to distant organs caused by HS.This paper reviews the regulation of the gut microbiota by probiotics to improve the intestinal heat tolerance ability and barrier function,aiming to provide references for the prevention and treatment of heat stroke in clinical practice.

Objective:To investigate the clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene. Methods:The clinical data and whole exome sequencing results of 2 patients who were diagnosed as developmental and epileptic encephalopathy related to the EEF1A2 gene in the Children′s Hospital, Capital Institute of Pediatrics in June 2016 and August 2018 were retrospectively analyzed. Relevant literatures were retrieved using " EEF1A2" and "epileptic encephalopathy" or "epilepsy" as key words in Online Mendelian Inheritance in Man, PubMed, CNKI and Wanfang databases (literatures searching from establishment of these databases to June 2024). The clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene were summarized based on literature reports and the data of these 2 patients. Results:Patient 1 was a 9 months old male infant. He presented with global developmental delay. He developed myoclonic seizures at 4 months old. Valproic acid, clonazepam, topiramate and vagus nerve stimulation were all ineffective. Both of his hands had transverse palmar crease. The de novo c.364G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Patient 2 was a 2 years and 2 months old boy. He presented with global developmental delay. Myoclonic seizures occurred when he was 2 years and 3 months old, and various anti-epileptic drugs were ineffective. He had left eye esotropia and low muscle tone in the extremities. He died at the age of 4. The de novo c.208G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Eight literatures on developmental and epileptic encephalopathy related to the EEF1A2 gene (all in English) were retrieved, reporting 28 cases (totally 30 patients, including 2 cases in this study). The main clinical manifestations were psychomotor developmental delay (30/30, 100.0%), facial dysmorphism (15/30, 50.0%), refractory epilepsy (14/26, 53.8%), myoclonic seizures (19/26, 73.1%), and movement disorders (8/16). A total of 15 mutation sites in the EEF1A2 gene were reported, all of which were missense mutations. Conclusions:Developmental and epileptic encephalopathy related to the EEF1A2 gene is primarily characterized by delayed psychomotor development, distinctive facial features, drug-resistant epilepsy, myoclonic seizures, and movement disorders. Variants in the EEF1A2 gene are predominantly missense mutations, and identifying these variants plays a crucial role in accurate diagnosis of the disease.

Objective To understand the equity and influencing factors of maternal health service utilization in Changning District, Shanghai. Methods A convenience sampling method was used to conduct a questionnaire survey among mothers of children aged 1 to 1.5 years old who received health services from the child health care clinics and EPI clinics of 10 community health service centers in Changning District, Shanghai from March to April 2022. Count data was expressed by frequency and percentage. Chi-square analysis, binomial logistic regression analysis, and multivariate logistic regression analysis were used to analyze fairness-related factors. Rate difference, rate ratio and concentration index were used to represent fairness. Results A total of 696 subjects were investigated, with an average age of (33.35±4.76) years. There were statistically significant differences in service utilization among women with different household registrations only in early pregnancy registration (χ²=11.026, P=0.001) and postpartum visits (χ²=4.989, P=0.026). Women with a career showed differently in folic acid supplement (χ²=6.247, P=0.012), early pregnancy registration (χ²=12.989, P=0.002), physical examination in 42 days postpartum (χ²=4.446, P=0.035) and postpartum contraception (χ²=4.061, P=0.044), and the differences were statistically significant. Women with different monthly family income had a statistically significant difference in pre-pregnancy examination (χ²=8.977, P=0.030) and postpartum visit (χ²=16.114, P=0.001). There was a statistically significant difference between women with maternity insurance or not in the early pregnancy registration (χ²=10.576, P=0.001) and physical examination in 42 days postpartum (χ²=8.166, P=0.004). The results of the multivariate analysis showed that occupation (OR=2.616, 95% CI: 1.142-5.990) and maternity insurance (OR=4.490, 95% CI: 1.992~10.120) affected the utilization of service in early pregnancy registration. The monthly household income (OR=0.278, 95% CI: 0.124-0.625) affected the utilization of services in postpartum visit. At the same time, the monthly household income (10,000-19,999: OR=0.286, 95% CI: 0.090-0.907; ≥30,000: OR=0.180, 95% CI: 0.041-0.801) also affected the utilization of service in physical examination in 42 days postpartum. Conclusion The equity of maternal health care service utilization overall is good in central area in Shanghai, but there is still room for improvement. It is necessary to strengthen community mobilization, propagandize maternal health services, and expand the coverage of maternity insurance to improve the equity of maternal health service utilization and provide equal access to maternity health services.