Congenital blood group chimerism refers to the coexistence of two or more distinct blood types within an individual, resulting from the presence of hematopoietic cell populations with different genotypes. Consequently, red blood cells in such individuals may express different blood group antigens. Based on the timing and mechanism of formation, blood group chimerism can be classified as either congenital or acquired. Although congenital blood group chimerism is rare and involves complex mechanisms, it holds significant implications in transfusion medicine, transplantation, and obstetrics. This article reviews the formation mechanisms, detection methods, and clinical significance of congenital blood group chimerism in transfusion medicine. Particular emphasis is placed on the principles, advantages, and limitations of various detection techniques. Furthermore, the potential applications of these technologies in clinical diagnosis are discussed, providing a technical foundation for the development of precise transfusion strategies.

OBJECTIVE To evaluate the efficacy and safety of immune checkpoint inhibitors （ICIs） combined with neoadjuvant chemotherapy in the treatment of early triple-negative breast cancer （TNBC）. METHODS Randomized controlled trials （RCTs） comparing ICIs combined with neoadjuvant chemotherapy （experimental group） versus neoadjuvant chemotherapy alone （control group） were retrieved from PubMed， Cochrane Library， Embase， Web of Science， CNKI， Wanfang Data， and VIP databases， as well as relevant studies published at oncology academic conferences. The search period was from database inception to June 30， 2025. After literature screening， data extraction， and quality assessment， a meta-analysis was performed by using RevMan 5.4 software. RESULTS A total of 6 RCTs involving 3 786 patients were finally included. The meta-analysis results showed that the experimental group had superior event-free survival [HR＝0.73， 95%CI （0.62， 0.85）， P＜0.000 1]， overall survival [HR＝0.69， 95%CI （0.57， 0.84）， P＝0.000 3]， and pathological complete response （pCR） [OR＝1.57， 95%CI （1.37， 1.80）， P＜0.000 01] compared to the control group. The incidence of ≥grade 3 adverse event （AE）， severe AE （SAE）， and ≥ grade 3 immune-related adverse event （irAE） in the experimental group was significantly higher than that in the control group. There was no statistically significant difference between the two groups in the incidence of any AE or any irAE （P＞0.05）. Subgroup analysis revealed that， regardless of programmed cell death ligand 1 expression status （negative or positive），the pCR in the experimental group was significantly higher than that in the control group （P＜0.05）. Additionally， the pCR of the patients with positive lymph nodes in the experimental group was significantly higher to that in the ontrol group （P＜0.05）. There was no statistically significant difference in pCR between the two groups with negative lymph nodes （P＝0.09）. CONCLUSIONS ICIs combined with neoadjuvant chemotherapy can significantly improve event-free survival and overall survival in patients with TNBC， providing patients with long-term survival benefits. However， the risk of ≥ grade 3 AE， SAE and ≥ grade 3 irAE has increased.

ObjectiveTo investigate the clinical features of tumor-induced acute pancreatitis （TIAP）， to construct and validate a predictive model for TIAP， and to provide help for early identification in clinical practice. MethodsA retrospective analysis was performed for the clinical data of 3 051 patients with acute pancreatitis （AP） who were admitted to The First Affiliated Hospital of Xinjiang Medical University from January 2020 to January 2026， among whom there were 72 patients with TIAP. To reduce class imbalance， 216 patients with non-tumor-related AP （2 979 patients） were randomly selected as conventional group using sex-stratified sampling， resulting in a cohort of 288 patients， and this cohort was randomly divided into a training set with 201 patients and a test set with 87 patients at a ratio of 7∶3. The two groups were compared in terms of general information and laboratory markers. The independent-samples t test was used for comparison of normally distributed continuous data between two groups， and the Mann-Whitney U test was used for comparison of non-normally distributed continuous data between two groups； the chi-square test was used for comparison of categorical data between two groups. Recursive feature elimination and least absolute shrinkage and selection operator regression were used for screening of characteristic variables， and five machine learning models were constructed， i.e.， logistic regression model， random forest model， support vector machine model， extreme gradient boosting model， and light gradient boosting machine model. The receiver operating characteristic curve and the precision-recall curve were used to assess model performance； the calibration curve was used to assess goodness of fit； decision curve analysis was used to evaluate clinical applicability and practicality； Shapley additive explanations were used to assess model interpretability. ResultsIn the training set of 201 patients， there were 52 patients （25.9%） in the TIAP group， and in the test set of 87 patients， there were 20 patients （23.0%） in the TIAP group. Compared with the conventional group， the TIAP group had a significantly higher proportion of patients with pancreatic duct dilatation （χ²=79.474， P<0.05）， a significantly higher age （Z=-5.838， P<0.05）， and significantly lower levels of white blood cell count （Z=5.630， P<0.05）， amylase （Z=2.606， P<0.05）， hemoglobin （Z=5.038， P<0.05）， and neutrophil percentage （Z=5.269， P<0.05）， as well as a lower level of direct bilirubin （Z=0.936， P>0.05）. The five machine learning models constructed based on these seven variables had a certain predictive ability， among which the logistic regression model had the best performance in the test set， with an area under the curve of 0.893 （95% confidence interval： 0.821 — 0.953）， an average precision of 0.654 in the precision-recall curve， good calibration， and good clinical benefits based on the decision curve analysis. ConclusionThe predictive model for TIAP based on pancreatic duct dilatation， age， white blood cell count， amylase， hemoglobin， neutrophil percentage， and direct bilirubin shows good predictive performance and can provide important guidance for the early diagnosis of TIAP.

Objective To explore the method for establishing a pig left lung orthotopic transplantation model. Methods A total of 4 male Yorkshire pigs weighing (40.0±2.5) kg underwent surgical procedures, including anesthesia, tracheal intubation, donor lung procurement, and recipient lung transplantation. Histological morphology and blood gas analysis of the transplanted lungs were assessed 2 hours after reperfusion to evaluate the histological changes and function of the transplanted lungs. Results The pigs underwent left lung in situ transplantation, effectively simulating conditions relevant to human lung transplantation. Two hours after the transplantation, arterial blood gas analysis showed that arterial partial pressure of oxygen was 155.4-178.6 mm Hg, arterial partial pressure of carbon dioxide was 53.1-62.4 mm Hg, and the oxygenation index was 310.8-357.2 mm Hg. Hematoxylin and eosin staining indicated a low degree of pulmonary edema and minimal cellular infiltration. Conclusion The pig left lung orthotopic transplantation model possesses strong operability and stability. Researchers can replicate this model according to the described methods and further conduct basic research and explore clinical translational applications.

Objective To screen antidepressant-active compounds from Polygonati Rhizoma and explore their effects and possible mechanisms against depression induced by simulated weightlessness.Methods A systems pharmacology approach was used to screen potential antidepressant-active compounds and their targets from Polygonati Rhizoma.The hindlimb unloading(HLU)rat model was employed for the study.Twenty-four healthy male Sprague-Dawley rats were randomly divided into three groups:control group(administered 0.5%carboxymethylcellulose by gavage),HLU group(hindlimb unloading),and HLU+treatment group(hindlimb unloading+active compound gavage),with 8 rats in each group.After 28 days of hindlimb unloading,depressive-like behaviors in rats were evaluated using the forced swimming test and tail suspension test.Hippocampal morphology was examined with H&E staining,and GO and KEGG enrichment analyses were conducted on the targets of active compounds.Results A total of 38 active compounds were screened from Polygonati Rhizoma,among which apigenin had an oral bioavailability of 23.06%and a drug-likeness score of 0.21.Compound-target network analysis indicated that apigenin had the highest degree and betweenness centrality values,suggesting it might be the key active component with antidepressant potential in Polygonati Rhizoma.In the forced swimming and tail suspension tests,rats in the HLU group showed a significant increase in immobility time compared to the control group,indicating successful establishment of the depression model.However,compared to the HLU group,rats in the HLU plus apigenin group exhibited significantly reduced immobility time.The H&E staining results of hippocampal tissue showed a significant reduction in the number of hippocampal neurons,along with numerous shrunken neurons and small vacuoles in nerve fibers in the HLU group.In contrast,the treatment group exhibited an increased number of hippocampal neurons,with improved cellular morphology.Target enrichment analysis indicated that apigenin targets were mainly involved in the regulation of apoptosis and cancer-related signaling pathways.Conclusion Apigenin significantly improved depressive-like behaviors in rats subjected to hindlimb unloading,and it has a protective effect on hippocampal tissue.It may provide a new natural active compound for the treatment of depression caused by spaceflight-induced weightlessness.

Aimed to find a safe and effective drug to replace nitroimidazole drugs in aquaculture pro-duction for the prevention and treatment of Trichomoniasis in pigeons,which can improve the eco-nomic benefits of meat pigeon breeding and ensure food safety.Firstly,Trichomonas was isolated and cultured from the crop of diseased pigeons and identified.After stable passage,a quantitative method for in vitro detection of Trichomonas was established by combining an automated cell counter and quantitative real-time PCR technology.To prepared the drug,powders of Sophora fla-vescent and Philodendron were made into herbal water extracts(SFPA)and mixed with copper sulfate(CS)solution.Then added the drug to the culture medium of Trichomonas to determine the effective concentration of it.A total of 135 pairs each of Silver King and Mimas breeding pigeons in the same laying period were selected and randomly divided into three groups,with 6 replicates in each group and 15 pairs of breeding pigeons in each replicate.Four days before brooding,the three groups were fed with 200 mL of pure water,0.5 g/L metronidazole(MDZ)solution,and a mixed solution of 30 g/L SFPA and 0.5 g/L CS,respectively.The feeding experiment lasted for 26 d.Results showed that the mixed solution of SFPA and CS had a significant killing effect on Trichomonas in vitro(P＜0.05).Feeding the drug to breeding pigeons significantly reduced the in-fection rate of breeding pigeons by Trichomonas(P＜0.05).The drug had no significant effect on the serum biochemical indexes,antioxidant properties,immunoglobulin levels of breeding pigeons,the average cage weight,immune organ indexes,meat quality and slaughter performance of squabs(P＞0.05).The results suggested that adding SFPA and CS to pigeons can effectively prevent and treat Trichomoniasis and improve production performance.It can replace nitroimidazole drugs without affecting the immune level of breeding pigeons and the weight,immune level,slaughter performance and meat quality of squabs,thereby reduce drug residues in poultry products and en-hance the food safety.

Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.

Objective To assess the marginal microleakage of specimens following aging simulation of adhesive restorations for dental defects using methacryloxylethyl cetyldimethyl ammonium chloride(DMAE-CB)and nanoparticles of amorphous calcium phosphate(NACP)binder.Methods DMAE-CB and NACP were synthesized in the laboratory.Eight groups were formed by varying the mass fraction ratios of the two components in the adhesive according to previous experiments,A:binder+3％DMAE-CB+25％NACP,B:binder+4％DMAE-CB+35％NACP,C:binder+1％DMAE-CB+15％NACP,D:binder+4％DMAE-CB+15％NACP,E:binder+1％DMAE-CB+35％NACP,F:binder+3％DMAE-CB,G:binder+25％NACP,H:SBMP binder as the control group.Forty human third molars were collected and randomly divided into 8 groups to prepare standardized Class Ⅱ preparations.Subsequent-ly,dental defect adhesive restoration specimens were made by using the 8 groups of binder,and aging simulation was performed through thermal cycling.After thermal cycling,the specimens were immersed in the dye solution.Each specimen was sectioned into 4 parts of dentin tissue slices along the gingival,proximal,and occlusal walls using a low-speed cutting machine,and the depth of dye penetration was observed under a stereomicroscope and recorded according to a unified standard for microleakage level.Finally,one randomly selected adhesive specimen from each of the 8 groups was subjected to gold sputtering and observed under scanning electron microscopy(SEM)to measure the gap width between the resin and dental tissue.Results Penetration staining showed that there were no statistically significant differences in the depth of marginal microleakage between the experimental and control groups on the gingival and occlusal walls(P＞0.05).However,there was a statistically significant difference in microleakage depth between the gingival and occlusal walls(P＜0.05).Scanning electron microscopy(SEM)results,after averaging particle size measurements,revealed no statistically significant differences in the gap width between the filling restorations and dental hard tissues between the experimental and con-trol groups(P＞0.05).Conclusion Dentin adhesives modified with DMAE-CB and NACP increase antibacterial and remineralization properties without affecting marginal microleakage in adhesive restorations,providing reliable theoretical support for their clinical appli-cation.

Objective:To investigate the clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene. Methods:The clinical data and whole exome sequencing results of 2 patients who were diagnosed as developmental and epileptic encephalopathy related to the EEF1A2 gene in the Children′s Hospital, Capital Institute of Pediatrics in June 2016 and August 2018 were retrospectively analyzed. Relevant literatures were retrieved using " EEF1A2" and "epileptic encephalopathy" or "epilepsy" as key words in Online Mendelian Inheritance in Man, PubMed, CNKI and Wanfang databases (literatures searching from establishment of these databases to June 2024). The clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene were summarized based on literature reports and the data of these 2 patients. Results:Patient 1 was a 9 months old male infant. He presented with global developmental delay. He developed myoclonic seizures at 4 months old. Valproic acid, clonazepam, topiramate and vagus nerve stimulation were all ineffective. Both of his hands had transverse palmar crease. The de novo c.364G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Patient 2 was a 2 years and 2 months old boy. He presented with global developmental delay. Myoclonic seizures occurred when he was 2 years and 3 months old, and various anti-epileptic drugs were ineffective. He had left eye esotropia and low muscle tone in the extremities. He died at the age of 4. The de novo c.208G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Eight literatures on developmental and epileptic encephalopathy related to the EEF1A2 gene (all in English) were retrieved, reporting 28 cases (totally 30 patients, including 2 cases in this study). The main clinical manifestations were psychomotor developmental delay (30/30, 100.0%), facial dysmorphism (15/30, 50.0%), refractory epilepsy (14/26, 53.8%), myoclonic seizures (19/26, 73.1%), and movement disorders (8/16). A total of 15 mutation sites in the EEF1A2 gene were reported, all of which were missense mutations. Conclusions:Developmental and epileptic encephalopathy related to the EEF1A2 gene is primarily characterized by delayed psychomotor development, distinctive facial features, drug-resistant epilepsy, myoclonic seizures, and movement disorders. Variants in the EEF1A2 gene are predominantly missense mutations, and identifying these variants plays a crucial role in accurate diagnosis of the disease.

Objective:To investigate the genetic etiology of 15 patients with suspected Marfan syndrome(MFS).Methods:Fifteen patients clinically suspected of having MFS who attended the Women and Children′s Hospital Affiliated to Qingdao University between January 2020 and August 2024 were enrolled. Amniotic fluid samples from fetuses and EDTA-anticoagulated peripheral blood samples from the patients and their family members were collected. Genomic DNA was extracted and subjected to whole exome sequencing(WES). Variants identified in positive cases were further validated by Sanger sequencing. The pathogenicity of the detected variants was assessed according to the guidelines and supplemental criteria of the American College of Medical Genetics and Genomics(ACMG).Results:All 15 patients were found to carry variants in the FBN1 gene, including 9 pathogenic variants, 5 likely pathogenic variants, and 1 variant of uncertain significance(VUS). Notably, eight novel pathogenic or likely pathogenic variants not previously reported in the literature were identified: c. 213G>C, c. 469G>T, c. 3337+ 2dup, c. 4087+ 1G>T, c. 7331_7334dup, c. 8146del, c. 8227dup, and c. 8425_8426insG. According to the revised Ghent criteria(2010), only 2 patients could be clinically diagnosed with MFS prior to WES. However, after incorporating WES-derived molecular evidence, 8 patients fulfilled the diagnostic criteria for MFS.Conclusion:The combination of WES and clinical phenotype assessment can substantially improve the diagnostic yield for MFS. Furthermore, the identification of these novel FBN1 variants expands the mutational spectrum of the gene and provides valuable evidence for future genetic counselling, prenatal diagnosis, and pathogenicity interpretation of neighboring variants.