Objective:To describe functional disability rate of anxiety disorders in Chinese community adults and explore related risk factors of functional disability.Methods:To conduct in-depth data analysis on China Mental Health Survey(CMHS).The diagnostic tool for anxiety disorders was the Composite International Diagnostic Inter-view-3.0,according to the Diagnostic and Statistical Manual for Mental Disorders,Fourth Edition(DSM-Ⅳ).The World Health Organization Disability Assessment Schedule,2nd edition,was the functional disability assessment standard for anxiety disorders.Weighted 12-month functional disability rate of DSM-Ⅳ anxiety disorder with co-morbidities and only anxiety disorder in population and those in patients,as well as days of partial disability were calculated.The effects of anxiety disorders comorbid other mental disorders and physical diseases and demographic factors on the severity and occurrence of functional disability were analyzed by multiple linear regression and logis-tic regression.Results:The functional disability rate of anxiety disorder with comorbidities in population was 1.7％,and 42.2％in patients,in which constituent rate of grade-four disability was the highest as 84.1％.The functional disability rate of only anxiety disorder in population was 0.3％,and 17.8％in patients.The medians of days of partial disability days in the past 30 days were from 0 to 14.42.Multiple linear regression showed a positive association between comorbid anxiety disorder with other mental disorders and physical diseases(β=0.24),comor-bid other mental disorders and physical diseases(β=0.21),physical diseases(β=0.18),comorbid anxiety disor-der and physical diseases(β=0.15),comorbid anxiety disorder with other mental disorders(β=0.08),other men-tal disorders(β=0.07),only anxiety disorder(β=0.06),lower education level(β=0.12),lower economic status(β=0.08),older age(β=0.06),non-marital status(β=0.06),male(β=0.02)and the severity of functional dis-ability.Logistic regression showed that comorbid anxiety with other mental disorders and physical diseases(OR=64.07),comorbid anxiety disorders with other mental disorders(OR=36.75),comorbid other mental disorders with physical diseases(OR=20.60),comorbid anxiety with physical diseases(OR=18.88),anxiety disorder(OR=9.20),other mental disorders(OR=6.65),physical diseases(OR=4.00),65 years old and over(OR=4.40),50 to 64 years old(OR=2.33),low economic status(OR=2.10),illiterate and below primary school educational level(OR=1.89),middle economic status(OR=1.70),elementary school educational level(OR=1.59),non-marital status(OR=1.47),male(OR=1.16)were the risk factors of the occurrence of functional disability.Conclusion:Comorbidity of anxiety disorders and other mental disorders,and physical diseases increases severity and occurrence of functional disability.Comorbidity,male,gender,older age,lower economic and educa-tional level and non-marital are risk factors of anxiety disorder functional disability.

With the advance of the economy and population aging, the acceleration of urbanization and the change of people's lifestyles, the prevalence of chronic diseases has become very serious. However, the etiologies and pathogeneses of the diseases are not yet clear, and the evidence of effective prevention and treatment strategies is lacking. Cohort study is an important method for exploring etiology and pathogenesis. Therefore, based on the support of the Ministry of Science and Technology for precision medicine in 2016, we launched a prospective cohort study of common chronic and non-communicable diseases in three provinces (Hubei, Hunan and Henan) in central China. Three independent and integratable sub-cohorts consisting of 115 424 participants at baseline survey and 107 252 participants in follow up were established, including dynamic measurements in 39 000 subjects in Dongfeng-Tongji prospective cohort. Each participant was asked to complete a questionnaire survey, an anthropometric measurement, a laboratory measurement, and blood and urine samples were collected from them. The cohort study contributes greatly to elucidating the etiologies and pathogeneses of common chronic and non-communicable disease in Chinese population and the development of precision medicine in China. This paper briefly introduces the design concept, basic information, major achievements and progress, and challenges of the prospective cohort study of common chronic and non-communicable diseases in central China.

Objective:A systematic review of global academic studies on mental health policy from 1990 to 2019 analyzed the overall characteristics of research methods in this field, in order to understand the development history and current status of mental health policy research methods, and hope to provide a reference to serve for the mental health policy study in our country.Methods:By searching the Web of Science Core Collection and the Cochrane Library, literature was screened, classified and statistically analyzed by using a two-level coding.Results:1 066 articles were included for analysis. In the past 30 years, the number of literature on mental health policy research was showing an upward trend. Since 1990, literature of qualitative research was dominant in each five-year stage, and the proportion ranged from 66.1% to 92.4%. Expert opinion of qualitative research was in the leading position from 1990 to 2014, and the proportion ranged from 43.3% to 84.8%. The proportion of quantitative research increased rapidly from 7.6% in 1990-1994 to 22.6% in 2015-2019 while structural qualitative research increased from 8.6% to 34.7%. In the quantitative research, the data sources mainly included survey data and second-hand data; the designs of quantitative research were mainly longitudinal research (41.6%, n=119) and cross-sectional research (39.5%, n=113). There were also few randomized controlled trials (5.6%, n=16), cohort study (4.5%, n=13), quasi-experimental study (3.8%, n=11), systematic review (3.5%, n=10) and ecological study (1.0%, n=3). The qualitative analysis methods included literature review and systematic review, theoretical perspective/framework analysis (mainly WHO framework, Kingdon multi-source flow framework, Walt and Gilson policy analysis framework and Bronfenbrenner′s ecological model) and qualitative data analysis (mainly document content analysis and case study). Conclusions:Qualitative research has always been the main type of mental health policy research, and the data analysis methods for qualitative research have been constantly enriched; discourse analysis, ethnography, phenomenological method, etc. may become a new section of qualitative research on mental health policy. In the quantitative type of mental health policy research, cross-sectional and longitudinal research were the main methods in the early stage, and many methods have been applied in recent ten years such as randomized controlled trial, quasi-experimental study, ecological study; econometric method is a new direction in which quantitative analysis methods in this field can be expanded in the future.

Objective:A systematic review of global academic studies on mental health policy from 1990 to 2019 analyzed the overall characteristics of research methods in this field, in order to understand the development history and current status of mental health policy research methods, and hope to provide a reference to serve for the mental health policy study in our country.Methods:By searching the Web of Science Core Collection and the Cochrane Library, literature was screened, classified and statistically analyzed by using a two-level coding.Results:1 066 articles were included for analysis. In the past 30 years, the number of literature on mental health policy research was showing an upward trend. Since 1990, literature of qualitative research was dominant in each five-year stage, and the proportion ranged from 66.1% to 92.4%. Expert opinion of qualitative research was in the leading position from 1990 to 2014, and the proportion ranged from 43.3% to 84.8%. The proportion of quantitative research increased rapidly from 7.6% in 1990-1994 to 22.6% in 2015-2019 while structural qualitative research increased from 8.6% to 34.7%. In the quantitative research, the data sources mainly included survey data and second-hand data; the designs of quantitative research were mainly longitudinal research (41.6%, n=119) and cross-sectional research (39.5%, n=113). There were also few randomized controlled trials (5.6%, n=16), cohort study (4.5%, n=13), quasi-experimental study (3.8%, n=11), systematic review (3.5%, n=10) and ecological study (1.0%, n=3). The qualitative analysis methods included literature review and systematic review, theoretical perspective/framework analysis (mainly WHO framework, Kingdon multi-source flow framework, Walt and Gilson policy analysis framework and Bronfenbrenner′s ecological model) and qualitative data analysis (mainly document content analysis and case study). Conclusions:Qualitative research has always been the main type of mental health policy research, and the data analysis methods for qualitative research have been constantly enriched; discourse analysis, ethnography, phenomenological method, etc. may become a new section of qualitative research on mental health policy. In the quantitative type of mental health policy research, cross-sectional and longitudinal research were the main methods in the early stage, and many methods have been applied in recent ten years such as randomized controlled trial, quasi-experimental study, ecological study; econometric method is a new direction in which quantitative analysis methods in this field can be expanded in the future.

OBJECTIVETo explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene.

METHODSSamples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing.

RESULTSFour de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations.

CONCLUSIONThe occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.

Adult ; Aged ; Female ; Genes, Neurofibromatosis 2 ; Humans ; Male ; Middle Aged ; Mutation ; Neurilemmoma ; genetics ; Spinal Cord Neoplasms ; genetics

A 50-year-old female patient with serious borderline tumor received chemotherapy with paclitaxel and carboplatin(an IV infusion of paclitaxel 198 mg and carboplatin 395 mg on the first day of treatment,the cycle of treatment was 21 d)after undergoing total hysterectomy,bilateral ovarian,and greater omentum resection. After the IV infusion of third chemotherapy cycle,the patient developed persistent and progressive numbness and pain of fingers which could radiate to the elbow. After treatment with carbamazepine and mecobalamin,the symptoms were not relieved. Thus it was considered that the adverse reactions may be caused by chemotherapy drugs. So the chemotherapy was paused temporarily,and prednisone,rebamipide,mouse nerve growth factor for injection,and mecobalamin were given. After 14 d of treatments,the patientˊ s symptoms were alleviated apparently. At half a year of follow-up,the patient developed slight atrophy in the right thenar muscle and hypoesthesia in bilateral index finger and middle finger palm.

OBJECTIVE: To analyze the relationship between the ischemic ST-T changes in electrocardiogram (ECG) and the coronary artery diseases based on the perspective of diagnostics.
 METHODS: A total of 341 patients, who underwent coronary angiography in Department of Cardiology of Xiangya Hospital, Central South University from June 2013 to April 2014, were enrolled for this study. The internationally recognized diagnostic criteria for ischemic ST-T changes in ECG and the Judkins diagnostic criteria for coronary angiography were applied, respectively. The sensitivity and specificity of ECG were analyzed.
 RESULTS: There were more ischemic ST-T changes in women than that in men (P<0.01). Ischemic changes in coronary angiography were not significantly different between male and female patients (P>0.05). For ischemic diagnostic tests by ECG ST-T, the total sensitivity and specificity was 83.6% and 54.4%, respectively. The sensitivity and specificity was 82.3% and 68.0% or 85.0% and 28.2% in the male or female group, respectively. 
 CONCLUSION Ischemic ST-T changes in ECG possess important value in the diagnosis of the coronary artery diseases. The sensitivity of ECG in the diagnosis of myocardial ischemia in women was higher than that in men, whereas the specificity of ECG in the diagnosis of myocardial ischemia in men was higher than that in women.
Coronary Angiography ; Coronary Artery Disease ; diagnosis ; Electrocardiography ; Female ; Humans ; Male ; Myocardial Ischemia ; diagnosis ; Sensitivity and Specificity

A 50-year-old female patient with serious borderline tumor received chemotherapy with paclitaxel and carboplatin(an IV infusion of paclitaxel 198 mg and carboplatin 395 mg on the first day of treatment,the cycle of treatment was 21 d)after undergoing total hysterectomy,bilateral ovarian,and greater omentum resection. After the IV infusion of third chemotherapy cycle,the patient developed persistent and progressive numbness and pain of fingers which could radiate to the elbow. After treatment with carbamazepine and mecobalamin,the symptoms were not relieved. Thus it was considered that the adverse reactions may be caused by chemotherapy drugs. So the chemotherapy was paused temporarily,and prednisone,rebamipide,mouse nerve growth factor for injection,and mecobalamin were given. After 14 d of treatments,the patientˊ s symptoms were alleviated apparently. At half a year of follow-up,the patient developed slight atrophy in the right thenar muscle and hypoesthesia in bilateral index finger and middle finger palm.

Objective:To assess mental health literacy of urban porpulation and its related factors.Method:Subjects were sampled from 3 cities in the east(Wuxi),central(Changsha)and west(Xi'an)part of China.Subjects were asked to answer a questionnaire which included 5 vignettes of mental disorders and related questions.Results:54.1% of 7309 participants correctly recognized the cases of mania,but only 11.2% correctly recognized the cases of schizophrenia with negative symptoms.The average rate of correct recognition for all 5 vignettes was 41.7%.Participants with higher education level recognized the vignettes more correctly.Ill-character,stress and the pressure from work were reported to be the 3 main reasons of mental disorders.There were strong negative attitudes toward psychiatric patients,especially those with schizophrenia and mania.Conclusion:While the rate of correct recognition of mental disorders is acceptable when compared with similar studies in other parts of the world,negative attitude toward patients with mental disorder is still prevalent in China.

Objective: To study the relationship of the mood and behavior types in patients with coronary heart disease, to supply the foundation of psychotherapy in patients with coronary heart disease. Methods: 81 patients with coronary heart disease and 59 normal healthy people were evaluated by Type A Behavior Scale, Hospital anxiety and depression scales. To analyse the relationship between the behavior type and mood disorder. Results: The rates of Type A behavior and anxious mood disorder were significantly higher in the study group than the contrast group (P