Objective:To describe functional disability rate of anxiety disorders in Chinese community adults and explore related risk factors of functional disability.Methods:To conduct in-depth data analysis on China Mental Health Survey(CMHS).The diagnostic tool for anxiety disorders was the Composite International Diagnostic Inter-view-3.0,according to the Diagnostic and Statistical Manual for Mental Disorders,Fourth Edition(DSM-Ⅳ).The World Health Organization Disability Assessment Schedule,2nd edition,was the functional disability assessment standard for anxiety disorders.Weighted 12-month functional disability rate of DSM-Ⅳ anxiety disorder with co-morbidities and only anxiety disorder in population and those in patients,as well as days of partial disability were calculated.The effects of anxiety disorders comorbid other mental disorders and physical diseases and demographic factors on the severity and occurrence of functional disability were analyzed by multiple linear regression and logis-tic regression.Results:The functional disability rate of anxiety disorder with comorbidities in population was 1.7％,and 42.2％in patients,in which constituent rate of grade-four disability was the highest as 84.1％.The functional disability rate of only anxiety disorder in population was 0.3％,and 17.8％in patients.The medians of days of partial disability days in the past 30 days were from 0 to 14.42.Multiple linear regression showed a positive association between comorbid anxiety disorder with other mental disorders and physical diseases(β=0.24),comor-bid other mental disorders and physical diseases(β=0.21),physical diseases(β=0.18),comorbid anxiety disor-der and physical diseases(β=0.15),comorbid anxiety disorder with other mental disorders(β=0.08),other men-tal disorders(β=0.07),only anxiety disorder(β=0.06),lower education level(β=0.12),lower economic status(β=0.08),older age(β=0.06),non-marital status(β=0.06),male(β=0.02)and the severity of functional dis-ability.Logistic regression showed that comorbid anxiety with other mental disorders and physical diseases(OR=64.07),comorbid anxiety disorders with other mental disorders(OR=36.75),comorbid other mental disorders with physical diseases(OR=20.60),comorbid anxiety with physical diseases(OR=18.88),anxiety disorder(OR=9.20),other mental disorders(OR=6.65),physical diseases(OR=4.00),65 years old and over(OR=4.40),50 to 64 years old(OR=2.33),low economic status(OR=2.10),illiterate and below primary school educational level(OR=1.89),middle economic status(OR=1.70),elementary school educational level(OR=1.59),non-marital status(OR=1.47),male(OR=1.16)were the risk factors of the occurrence of functional disability.Conclusion:Comorbidity of anxiety disorders and other mental disorders,and physical diseases increases severity and occurrence of functional disability.Comorbidity,male,gender,older age,lower economic and educa-tional level and non-marital are risk factors of anxiety disorder functional disability.

Objective:To describe disability rates of dementia in community residents aged 65 years and over in China,and explore related risk factors of disability.Methods:This study conducted an in-depth data analysis of the China Mental Health Survey.World Health Organization Disability Assessment Schedule 2.0(WHODAS 2.0)was used to assess dementia disability,Community Screening Interview for Dementia(CSID)and Geriatric Mental Status Examination(GMS)were used for dementia screening and diagnosing.Univariate analysis was used to calcu-late the weighted disability rates of dementia in population and in patients,and their population distribution.Multiple linear regression and logistic regression were used to analyze the risk factors of the occurrence of dementia disability and its severity.Results:The weighted disability rate of dementia was 2.1％in population,and 38.6％in pa-tients.The disability rates of comorbid dementia in population and in patients were higher than those of patients with only dementia.Female,older age,lower education level,lower economic status,and lower cognitive test scores in CSID had higher disability rates of dementia in population.Female and urban resident had higher disability rates of dementia in patients.Multiple linear regression showed economic status(β=0.11),gender(β=0.11),age(β=0.10),and treatment in the last 12 months(β=-0.20)were statistically associated with WHODAS 2.0 scores.Multiple logistic regression showed female(OR=2.81)and treatment in the last 12 months(OR=2.38)were statistically associated with disability.Conclusions:Persons with low economic status,female and elderly peo-ple are the high-risk groups for dementia disability.It should be paid attention to prevent dementia and its conse-quential disabilities.

Objective:To observe the occurrence and closure of iatrogenic atrial septal defect (IASD) after left atrial appendage occlusion (LAAo) and atrial fibrillation cryoballoon ablation (CBA), and to identify potential factors that may affect the occurrence of IASD.Methods:A total of 383 patients who underwent successful LAAo surgery in the Department of Cardiology at the Nanjing Hospital Affiliated to Nanjing Medical University from June 7, 2016 to December 2, 2020, and atrial fibrillation CBA surgery from December 29, 2016 to September 10, 2020 were retrospectively selected. Patients were followed up with echocardiography at 1 month, 3 months, 6 months, 1 year, and>1 year after surgery to determine the occurrence of IASD. The incidence of IASD between the two groups was compared, and clinical data between the two groups with and without IASD were analyzed to identify the relevant factors for the occurrence of IASD.Results:One month after CBA surgery for atrial fibrillation [73.8%(138/187) vs 47.9%(67/140), P<0.001], 3 months [39.0%(57/146) vs 13.6%(16/118), P<0.001], 6 months [17.7%(22/124) vs 3.6%(4/110), P=0.001], 1 year [11.8%(15/127) vs 1.8%(2/112), P=0.003], and one year later [9.8%(13/133) vs 0.9%(1/116), P=0.002], the incidence of IASD was significantly higher than those in LAAo. Compared with the non IASD group, the IASD group had a lower proportion of males [59.0%(121/205) vs 83.6%(102/122), P<0.001], and a higher proportion of paroxysmal atrial fibrillation [61.5%(126/205) vs 45.9%(56/122), P=0.006]. Logistic regression analysis found a significant correlation between women and CBA with postoperative IASD. Conclusions:Compared with LAAo, the incidence of IASD after CBA for atrial fibrillation is higher, and some IASD persist for more than 1 year after surgery. Women are significantly associated with IASD.

With the advance of the economy and population aging, the acceleration of urbanization and the change of people's lifestyles, the prevalence of chronic diseases has become very serious. However, the etiologies and pathogeneses of the diseases are not yet clear, and the evidence of effective prevention and treatment strategies is lacking. Cohort study is an important method for exploring etiology and pathogenesis. Therefore, based on the support of the Ministry of Science and Technology for precision medicine in 2016, we launched a prospective cohort study of common chronic and non-communicable diseases in three provinces (Hubei, Hunan and Henan) in central China. Three independent and integratable sub-cohorts consisting of 115 424 participants at baseline survey and 107 252 participants in follow up were established, including dynamic measurements in 39 000 subjects in Dongfeng-Tongji prospective cohort. Each participant was asked to complete a questionnaire survey, an anthropometric measurement, a laboratory measurement, and blood and urine samples were collected from them. The cohort study contributes greatly to elucidating the etiologies and pathogeneses of common chronic and non-communicable disease in Chinese population and the development of precision medicine in China. This paper briefly introduces the design concept, basic information, major achievements and progress, and challenges of the prospective cohort study of common chronic and non-communicable diseases in central China.

Objective:To investigate the English learning efficacy and autonomous learning proficiency of postgraduates in universities of Traditional Chinese Medicine (TCM), explore whether there is a correlation between English learning efficacy and autonomous learning ability, and to analyze the influence of English learning efficacy on autonomous learning ability.Methods:A questionnaire survey was carried out to assess the levels of English learning efficacy and English autonomous learning in two levels of belief and behavior among 207 postgraduates in TCM universities. Statistical methods such as independent sample t-test, one-way ANOVA, nonparametric Mann-Whitney U-test, and Kruskal Wallis H-test were applied to analyze the data collected in the questionnaire survey. Results:The average score of subjects' English learning efficacy was 2.82 ± 0.60 (1 ≤ ≤ 5), and the average score of subjects' English autonomous learning ability was 3.24 ± 0.53 (1 ≤ ≤ 5). The scores of their autonomous English learning in the level of belief was significantly higher than those of the level of behavior ( t =14.10, P < 0.001). The scores of autonomous learning ability of subjects in Batch 2020 were significantly lower than those in Batch 2021 ( t = 2.64, P = 0.009). Linear correlation analysis showed that there was a moderately positive correlation between English learning efficacy and autonomous learning ability. Conclusion:The English learning efficacy of postgraduates in TCM universities is at the middle-low level and their English autonomous learning ability is at the middle level. Moreover, their English autonomous learning in the level of behavior underperforms the English autonomous learning in the level of belief, and the English autonomous learning ability decreases with the increase of the grades. In addition, the English learning efficacy has a moderate positive influence on autonomous English learning ability.

OBJECTIVETo explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene.

METHODSSamples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing.

RESULTSFour de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations.

CONCLUSIONThe occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.

Adult ; Aged ; Female ; Genes, Neurofibromatosis 2 ; Humans ; Male ; Middle Aged ; Mutation ; Neurilemmoma ; genetics ; Spinal Cord Neoplasms ; genetics

Objective:To know about the prevalence of depression,anxiety,and suicidal behaviors among newly diagnosed HIV-positive men who have sex with men.Methods:A cross-sectional study with a consecutive sample was conducted in the HIV/AIDS Voluntary Counseling and Testing Clinic of the Center for Disease Control and Prevention.A standard set of questionnaires,namely,the Patient Health Questionnaire Depression Scale (PHQ9),Generalized Anxiety Disorder Scale (GAD-7),and a self-designed suicidal behavior questionnaire were used to assess the subjects'emotional problems.Results:Among 321 newly diagnosed HIV-positive men who had sex with men,the positive rate of depression and anxiety were 41.1％ (132/321) and 31.5％ (101/321),respectively.The rate suicidal ideation after HIV diagnosis was 27.7％ (89/321).Individuals who were living with others,had HIV related clinical symptoms,higher HIV/AIDS related stress,and lower social support were more likely to have positive depressive symptoms.Individuals who were unmarried,had lower HIV/AIDS related stress,and lower social support were more likely to have positive anxiety.The prevalence of suicidal ideation after HIV diagnosis was higher among individuals who were unwilling to join in HIV/AIDS support groups,had HIV related clinical symptoms,higher HIV/AIDS related stress,lower social support,and both positive depression and anxiety symptoms.Conclusion:The prevalence of emotional problems is high among newly diagnosed HIV-positive men who have sex with men.It is warranted to promote mental health service for this vulnerable group.

Objective To explore the status of depression in patients with advanced schistosomiasis and its influencing fac-tors,so as to provide the evidence for improving psychological interventions. Methods A total of 206 patients with advanced schistosomiasis were investigated with the self-designed general information questionnaire,the Self-Rating Depression Scale,and WHOQOL-BREF Form. Results Among the 206 cases,the incidence of depression was 69.4%,and depression was negatively related to the quality of life(P = 0.000). The multiple logistic regression analysis showed that the times of hospitalization(β=0.442,P=0.007)was a risk factor for depression,while the high education levels(β=-0.583,P=0.011)and the history of por-tal hypertension operation(β=-0.917,P=0.000)were the protective factors. Conclusion The incidence of depression in ad-vanced schistosomiasis patients is high,and it is influenced by various factors. Therefore,we should take corresponding interven-tions to reduce its occurrence.

Objective To explore the influence of peritumoral edema (PTE) on the tendency of recurrent location and morphological character after total resection using MRI. Methods MRI data was collected from 43 patients with recur-rent brain glioma after total resection from four clinical centers and then the influence of of PTE on recurrence patterns af-ter total resection was retrospectively analyzed based on the T2 weighted image. Results The PTE had a significant influ-ence on the recurrent patterns of brain gliomas after total resection. When PTE was mild, the shapes of recurrent gliomas tended to be focal (6/8) and the recurrent locations tended to be local (5/8). When PTE was severe, the shapes of the recur- rent gliomas tended to be spread(30/35 and the recurrent locations tended to be distant (25/35), followed by marginal (7/35), In addition, the morphological patterns and locations of recurrent gliomas were significantly different among different PTE types (all P<0.001). When PTE was ring shape, the shapes of recurrent gliomas tended to be focal (7/9) and the recur-rent locations tended to be local (6/9), followed by marginal (2/9) and distant (1/9). When PTE was irregular shape, most of recurrent locations tended to be distant (25/34), followed by marginal (7/34) but rarely local (2/34). Conclusions The de-grees and the types of brain glioma PTE can significantly influence the locations and morphological patterns of recurrent gliomas after total resection.

Objective To understand the epidemiological characteristics of patients with advanced schistosomiasis in Hunan Province,so as to provide the evidence for formulating the advanced schistosomiasis prevention strategies and measures. Meth-ods The data of advanced schistosomiasis patients were collected and analyzed retrospectively with the cross section research method and description method in Hunan Province,2012. Results There were 5 722 advanced schistosomiasis patients in Hu-nan Province,and among them,4 112 patients were male(71.86%),and 1 610 were female(28.14%). Totally 5 311 patients came from the schistosomiasis endemic areas(92.82%)and 411 patients from non-schistosomiasis endemic areas(7.18%). The prevalence rate of advanced schistosomiasis was 8.46/10 000. The mean age of advanced schistosomiasis patients was 60.30 ± 11.63 years,and the youngest was 17 years old and the oldest 92 years old. In the age composition of advanced schistosomiasis pa-tients,the greatest number of cases was in the 60-70 years age group (32.72%). There were 3 595 cases of ascites type (62.83%),2107 cases of splenomegaly type(36.82%),11 cases of dwarf type(0.16%),and 11 cases of colon proliferation type (0.35%). Conclusion The prevalence rate of advanced schistosomiasis is relatively stable in Hunan Province,and the age of the patients showed an old aging trend. The salvation of advanced schistosomiasis patients in non-endemic areas should be strength-ened.