ObjectiveTo identify the direct target proteins for the anti-obesity effect of resveratrol （Res） via chemical proteomic analysis and systematically explore the molecular mechanisms by which Res inhibits lipid accumulation in adipocytes from mitochondrial function regulation， adipocyte browning， and inflammation inhibition， thus providing new targets and experimental evidence for the prevention and treatment of obesity and related metabolic diseases. MethodsThe cell counting kit-8 （CCK-8） assay was adopted to detect the safe and effective doses （7.5， 15， 30 μmol·L^-1） of Res for treating 3T3-L1 cells based on the cell survival rate. After being induced to differentiate into mature adipocytes， the cells were assigned into the blank ［treated with dimethyl sulfoxide （DMSO）］ group and the Res （7.5， 15， 30 μmol·L^-1） groups and treated for 48 h. Oil red O staining and total triglyceride （TG） content were assessed to measure lipid accumulation in adipocytes. Target protein identification of Res was conducted through IAA-P-based chemical proteomics combined with high-resolution mass spectrometry. Target proteins of Res were validated by cellular thermal shift assay （CETSA） combined with Western blot analysis. Furthermore， the expression of browning markers peroxisome proliferator-activated receptor γ coactivator-1α （PGC-1α） and mitochondrial uncoupling protein 1 （UCP1）， as well as the target proteins NADH-ubiquinone oxidoreductase core subunit S8 （NDUFS8） and high-mobility group protein B1 （HMGB1） were determined by Western blot. The ATP assay kit was used to measure the ATP concentration. Mitochondrial biogenesis was characterized with MitoTracker Green， on the basis of which the regulatory effect of Res on mitochondrial function was analyzed. The level of the inflammatory cytokine tumor necrosis factor-α （TNF-α） was measured by enzyme-linked immunosorbent assay （ELISA）， on the basis of which the anti-inflammatory effect of Res on adipocytes was evaluated. ResultsCompared with the control group， Res demonstrated safety and efficacy within the range of 7.5-30 μmol·L^-1， without significantly affecting cell viability. Compared with the control group， different concentrations of Res reduced lipid accumulation in 3T3-L1 adipocytes （P<0.01）， promoted the expression of NDUFS8 （P<0.01）， increased the ATP concentration and the protein levels of UCP1 and PGC-1α， elevated the level of TNF-α （P<0.05， P<0.01）. ConclusionNDUFS8 and HMGB1were identified as the target proteins of Res in mitigating obesity. Res promotes mitochondrial biogenesis to induce the browning of 3T3-L1 adipocytes via targeting NDUFS8 and it inhibits the TNF-α-mediated inflammatory signaling via targeting HMGB1， thus inhibiting lipid accumulation and ameliorating obesity.

Objective To explore the mechanism of Yizhu Wendan Decoction in treating eczema through GEO database combined with network pharmacology and experimental verification.Methods TCMSP,BATMAN-TCM and ETCM databases were used to screen the active components of Yizhu Wendan Decoction.Disease target information related to eczema was collected through GEO database.The drug-component-target network and PPI network were constructed by intersections of active component targets and disease targets.GO and KEGG pathway enrichment analyses were performed using DAVID database.CCK-8 method was used to screen out the optimal intervention concentration of freeze-dried powder of Yizhu Wendan Decoction.HaCaT cells were divided into control group,model group,Yizhu Wendan Decoction low concentration group,Yizhu Wendan Decoction high concentration group,si-IL-17RA group,si-IL-17RA+Yizhu Wendan Decoction low concentration group,si-IL-17RA+Yizhu Wendan Decoction high concentration group,Dexamethasone group,si-IL-17RA+Dexamethasone group.Each group was given relevant intervention.The expressions of chemokines and inflammatory factors were detected by qPCR.EdU and Annexin V-FITC/PI double staining were used to detect cell proliferation and apoptosis.Western blot was performed to detect the expressions of proteins related to apoptosis,skin barrier and IL-17 signaling pathway.Results By using databases,180 active components of Yizhu Wendan Decoction were obtained.Combined with GEO database microarrays related to eczema(GSE6012 and GSE57225),8 potential targets of Yizhu Wendan Decoction in the treatment of eczema were obtained.KEGG enrichment pathway mainly involved IL-17 signaling pathway,lipid and atherosclerotic,TNF signaling pathway,fluid shear stress and atherosclerotic,etc.When Yizhu Wendan Decoction freeze-dried powder concentration was 100 μg/mL,cell viability was the strongest.Yizhu Wendan Decoction could significantly inhibit the mRNA expressions of chemokines and inflammatory factors CCL17,CCL22,IL-1β,TNF-α,IL-6,IFN-γ,and increase the mRNA expression of IL-4 in eczema.It promoted the proliferation of HaCaT cells,increased the protein expression of Bcl-2,and reduced the protein expressions of Bad and Cleaved Caspase-3,thus inhibiting HaCaT cells apoptosis;promoted the protein expressions of FLG and LOR,and reduced the expression of MMP9,MMP1,CCL2,FOSL1,IL-17RA proteins in IL-17 signaling pathway.Conclusion Yizhu Wendan Decoction can treat eczema with multiple components,multiple pathways and multiple targets,promote the proliferation of HaCaT cells,inhibit their apoptosis,and restore the skin barrier.Its mechanism may be related to inhibiting the activation of IL-17 signaling pathway.

Pseudopleuronectes yokohamae is an important marine economic fish species in northern China and is vulnerable to various pathogens during the breeding process.To investigate the viru-lence of Edwardsiella tarda on Pseudopleuronectes yokohamae and elucidate the role of miRNAs in their interaction,we conducted pathological analyses on various tissues of Pseudopleuronectes yokohamae larvae pre-and post-infection with Edwardsiella tarda.Subsequently,Illumina high-throughput sequencing was employed to identify and functionally characterize differentially ex-pressed miRNAs in liver and kidney tissues.The results demonstrated that infection with Ed-wardsiella tarda led to ulceration,hemorrhaging,significant hepatomegaly,nephromegaly,and as-cites in the abdominal cavity.Histopathological examination revealed swollen hepatocytes with vac-uolization,minor blood cell infiltration,and enlarged renal corpuscles with signs of cellular lysis.miRNA sequencing analysis indicated that 24 miRNAs were significantly upregulated and 45 miR-NAs were significantly downregulated in the liver,while in the kidney,6 miRNAs were upregulat-ed and 58 were downregulated following infection.Functional enrichment analysis revealed signifi-cant enrichment of differentially expressed miRNAs in Toll and IMD signaling pathways,HIF-1 signaling pathway,Rap1 signaling pathway,MAPK signaling pathway,and Apelin signaling path-way.These findings suggest the involvement of these miRNAs in host metabolism,pathogen rec-ognition,and immune response in the interaction between Pseudopleuronectes yokohamae and Ed-wardsiella tarda.This research lays a foundation for elucidating the mechanisms underlying bacte-rial disease susceptibility and resistance in Pseudopleuronectes yokohamae.

Objective To explore the mechanism of Yizhu Wendan Decoction in treating eczema through GEO database combined with network pharmacology and experimental verification.Methods TCMSP,BATMAN-TCM and ETCM databases were used to screen the active components of Yizhu Wendan Decoction.Disease target information related to eczema was collected through GEO database.The drug-component-target network and PPI network were constructed by intersections of active component targets and disease targets.GO and KEGG pathway enrichment analyses were performed using DAVID database.CCK-8 method was used to screen out the optimal intervention concentration of freeze-dried powder of Yizhu Wendan Decoction.HaCaT cells were divided into control group,model group,Yizhu Wendan Decoction low concentration group,Yizhu Wendan Decoction high concentration group,si-IL-17RA group,si-IL-17RA+Yizhu Wendan Decoction low concentration group,si-IL-17RA+Yizhu Wendan Decoction high concentration group,Dexamethasone group,si-IL-17RA+Dexamethasone group.Each group was given relevant intervention.The expressions of chemokines and inflammatory factors were detected by qPCR.EdU and Annexin V-FITC/PI double staining were used to detect cell proliferation and apoptosis.Western blot was performed to detect the expressions of proteins related to apoptosis,skin barrier and IL-17 signaling pathway.Results By using databases,180 active components of Yizhu Wendan Decoction were obtained.Combined with GEO database microarrays related to eczema(GSE6012 and GSE57225),8 potential targets of Yizhu Wendan Decoction in the treatment of eczema were obtained.KEGG enrichment pathway mainly involved IL-17 signaling pathway,lipid and atherosclerotic,TNF signaling pathway,fluid shear stress and atherosclerotic,etc.When Yizhu Wendan Decoction freeze-dried powder concentration was 100 μg/mL,cell viability was the strongest.Yizhu Wendan Decoction could significantly inhibit the mRNA expressions of chemokines and inflammatory factors CCL17,CCL22,IL-1β,TNF-α,IL-6,IFN-γ,and increase the mRNA expression of IL-4 in eczema.It promoted the proliferation of HaCaT cells,increased the protein expression of Bcl-2,and reduced the protein expressions of Bad and Cleaved Caspase-3,thus inhibiting HaCaT cells apoptosis;promoted the protein expressions of FLG and LOR,and reduced the expression of MMP9,MMP1,CCL2,FOSL1,IL-17RA proteins in IL-17 signaling pathway.Conclusion Yizhu Wendan Decoction can treat eczema with multiple components,multiple pathways and multiple targets,promote the proliferation of HaCaT cells,inhibit their apoptosis,and restore the skin barrier.Its mechanism may be related to inhibiting the activation of IL-17 signaling pathway.

Pseudopleuronectes yokohamae is an important marine economic fish species in northern China and is vulnerable to various pathogens during the breeding process.To investigate the viru-lence of Edwardsiella tarda on Pseudopleuronectes yokohamae and elucidate the role of miRNAs in their interaction,we conducted pathological analyses on various tissues of Pseudopleuronectes yokohamae larvae pre-and post-infection with Edwardsiella tarda.Subsequently,Illumina high-throughput sequencing was employed to identify and functionally characterize differentially ex-pressed miRNAs in liver and kidney tissues.The results demonstrated that infection with Ed-wardsiella tarda led to ulceration,hemorrhaging,significant hepatomegaly,nephromegaly,and as-cites in the abdominal cavity.Histopathological examination revealed swollen hepatocytes with vac-uolization,minor blood cell infiltration,and enlarged renal corpuscles with signs of cellular lysis.miRNA sequencing analysis indicated that 24 miRNAs were significantly upregulated and 45 miR-NAs were significantly downregulated in the liver,while in the kidney,6 miRNAs were upregulat-ed and 58 were downregulated following infection.Functional enrichment analysis revealed signifi-cant enrichment of differentially expressed miRNAs in Toll and IMD signaling pathways,HIF-1 signaling pathway,Rap1 signaling pathway,MAPK signaling pathway,and Apelin signaling path-way.These findings suggest the involvement of these miRNAs in host metabolism,pathogen rec-ognition,and immune response in the interaction between Pseudopleuronectes yokohamae and Ed-wardsiella tarda.This research lays a foundation for elucidating the mechanisms underlying bacte-rial disease susceptibility and resistance in Pseudopleuronectes yokohamae.

Background: Acute respiratory distress syndrome induced by acute lung injury (ALI) is the main cause for the high mortality of corona-virus disease 2019 (COVID-19). Huashi Baidu formula (HSBD) with the effects of eliminating dampness, clearing heat, ventilating lung, and removing toxin has been proven to be effective in the treatment of COVID-19, especially in severe cases. However, the underlying mechanism and target proteins of HSBD remain unclear. Objective: To provide evidence and decipher the mechanism of HSBD in alleviating inflammation and ALI. Materials and methods: A mouse model of ALI was induced by lipopolysaccharide (LPS), and hematoxylin-eosin staining was used to examine the protective effects of HSBD on the model mice. The cellular thermal shift assay and proteomics analysis were used to predict the target proteins. Furthermore, the A549 cells with peroxiredoxin 5 (PRDX5) knockdown were established to validate the predicted proteins. Results: Huashi Baidu formula treatment mitigated ALI and inflammatory cytokine dysfunction in LPS-induced mice, thus exerting a therapeutic effect on COVID-19. Huashi Baidu formula could serve as a therapeutic agent to alleviate inflammation and lung injury via nuclear factor k B and phosphatidylinositol 3-kinase signaling and interleukin 17 inhibition as well as targeting PRDX5, which could be one of the promising targets for treating inflammation. In the A549 cell line with PRDX5 knockdown (si-PRDX5), the anti-inflammation effects of HSBD, including reversing LPS-induced increase in the nitric oxide level and reduction in the hydrogen peroxide content, were attenuated. Thus, HSBD protected A549 cells from LPS-induced inflammation mainly by targeting PRDX5. Conclusions: Huashi Baidu formula alleviates ALI by targeting nuclear factor κB/phosphatidylinositol 3-kinase and PRDX5, as well as inhibiting the immune response induced by IL-17.

Hepatocellular carcinoma （HCC） is the sixth most common cancer in the world. In recent years， the clinical early diagnosis and treatment protocols of HCC have been improved， whereas the prognosis of patients is still not satisfactory， which is due to the fact that the mechanism of HCC development has not been fully elucidated. Therefore， it is of great significance to explore the molecular mechanisms and key regulatory links of hepatocellular carcinoma development to further improve the diagnosis and treatment of HCC in China. Epigenetics has become a research hotspot because of its reversibility and easy regulation. According to relevant studies， HCC involves the accumulation of multiple genetic and epigenetic changes during the initiation， promotion， and progression stages. HCC is categorized as infantile malnutrition with accumulation， hypochondriac pain， tympan ites， and abdominal mass in traditional Chinese medicine （TCM）. In the treatment of HCC， TCM with low toxicity， multi-targets， and multi-mechanisms can inhibit tumor growth， alleviate the clinical symptoms， and enhance the quality of life of the patients. Chinese medicines and their active ingredients exert anti-HCC effects through epigenetic regulation of DNA methylation， histone modification， and non-coding RNA. Abnormal gene expression due to epigenetic regulation disorders is involved in all stages of HCC development. There are few studies on epigenetic regulation in TCM treatment of HCC， and there is still much room for development in basic and clinical trials. This paper reviews the mechanism of epigenetic regulation in HCC and summarizes the experimental results of TCM research on the related mechanism， with a view to providing a theoretical basis for future research on the mechanism of HCC development and clinical diagnosis and treatment of hepatocellular carcinoma with TCM.

The nucleocapsid (N) protein of SARS-CoV-2 has been reported to have a high ability of liquid-liquid phase separation, which enables its incorporation into stress granules (SGs) of host cells. However, whether SG invasion by N protein occurs in the scenario of SARS-CoV-2 infection is unknow, neither do we know its consequence. Here, we used SARS-CoV-2 to infect mammalian cells and observed the incorporation of N protein into SGs, which resulted in markedly impaired self-disassembly but stimulated cell cellular clearance of SGs. NMR experiments further showed that N protein binds to the SG-related amyloid proteins via non-specific transient interactions, which not only expedites the phase transition of these proteins to aberrant amyloid aggregation in vitro, but also promotes the aggregation of FUS with ALS-associated P525L mutation in cells. In addition, we found that ACE2 is not necessary for the infection of SARS-CoV-2 to mammalian cells. Our work indicates that SARS-CoV-2 infection can impair the disassembly of host SGs and promote the aggregation of SG-related amyloid proteins, which may lead to an increased risk of neurodegeneration.
Amyloidogenic Proteins/metabolism* ; Amyotrophic Lateral Sclerosis/genetics* ; Animals ; COVID-19 ; Cytoplasmic Granules/metabolism* ; Mammals ; SARS-CoV-2 ; Stress Granules

We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.