1.Exploration on the Mechanism of Yizhu Wendan Decoction in Treating Eczema Based on GEO Database Combined with Network Pharmacology and Experimental Verification
Yijie WANG ; Tingting GUO ; Yongjun LI ; Ziyi LI ; Meng ZHANG ; Mengdi SHI ; Shengnan GU ; Youpeng WANG ; Zhijun LI
Chinese Journal of Information on Traditional Chinese Medicine 2025;32(4):32-41
Objective To explore the mechanism of Yizhu Wendan Decoction in treating eczema through GEO database combined with network pharmacology and experimental verification.Methods TCMSP,BATMAN-TCM and ETCM databases were used to screen the active components of Yizhu Wendan Decoction.Disease target information related to eczema was collected through GEO database.The drug-component-target network and PPI network were constructed by intersections of active component targets and disease targets.GO and KEGG pathway enrichment analyses were performed using DAVID database.CCK-8 method was used to screen out the optimal intervention concentration of freeze-dried powder of Yizhu Wendan Decoction.HaCaT cells were divided into control group,model group,Yizhu Wendan Decoction low concentration group,Yizhu Wendan Decoction high concentration group,si-IL-17RA group,si-IL-17RA+Yizhu Wendan Decoction low concentration group,si-IL-17RA+Yizhu Wendan Decoction high concentration group,Dexamethasone group,si-IL-17RA+Dexamethasone group.Each group was given relevant intervention.The expressions of chemokines and inflammatory factors were detected by qPCR.EdU and Annexin V-FITC/PI double staining were used to detect cell proliferation and apoptosis.Western blot was performed to detect the expressions of proteins related to apoptosis,skin barrier and IL-17 signaling pathway.Results By using databases,180 active components of Yizhu Wendan Decoction were obtained.Combined with GEO database microarrays related to eczema(GSE6012 and GSE57225),8 potential targets of Yizhu Wendan Decoction in the treatment of eczema were obtained.KEGG enrichment pathway mainly involved IL-17 signaling pathway,lipid and atherosclerotic,TNF signaling pathway,fluid shear stress and atherosclerotic,etc.When Yizhu Wendan Decoction freeze-dried powder concentration was 100 μg/mL,cell viability was the strongest.Yizhu Wendan Decoction could significantly inhibit the mRNA expressions of chemokines and inflammatory factors CCL17,CCL22,IL-1β,TNF-α,IL-6,IFN-γ,and increase the mRNA expression of IL-4 in eczema.It promoted the proliferation of HaCaT cells,increased the protein expression of Bcl-2,and reduced the protein expressions of Bad and Cleaved Caspase-3,thus inhibiting HaCaT cells apoptosis;promoted the protein expressions of FLG and LOR,and reduced the expression of MMP9,MMP1,CCL2,FOSL1,IL-17RA proteins in IL-17 signaling pathway.Conclusion Yizhu Wendan Decoction can treat eczema with multiple components,multiple pathways and multiple targets,promote the proliferation of HaCaT cells,inhibit their apoptosis,and restore the skin barrier.Its mechanism may be related to inhibiting the activation of IL-17 signaling pathway.
2.Regulatory role of miRNA in the interaction between Pseudopleuronectes yoko-hamae and Edwardsiella tarda
Yile CHAI ; Huijie WANG ; Jian HAN ; Zhizhi GU ; Wei WANG ; Shengnan CAO
Chinese Journal of Veterinary Science 2025;45(11):2372-2379
Pseudopleuronectes yokohamae is an important marine economic fish species in northern China and is vulnerable to various pathogens during the breeding process.To investigate the viru-lence of Edwardsiella tarda on Pseudopleuronectes yokohamae and elucidate the role of miRNAs in their interaction,we conducted pathological analyses on various tissues of Pseudopleuronectes yokohamae larvae pre-and post-infection with Edwardsiella tarda.Subsequently,Illumina high-throughput sequencing was employed to identify and functionally characterize differentially ex-pressed miRNAs in liver and kidney tissues.The results demonstrated that infection with Ed-wardsiella tarda led to ulceration,hemorrhaging,significant hepatomegaly,nephromegaly,and as-cites in the abdominal cavity.Histopathological examination revealed swollen hepatocytes with vac-uolization,minor blood cell infiltration,and enlarged renal corpuscles with signs of cellular lysis.miRNA sequencing analysis indicated that 24 miRNAs were significantly upregulated and 45 miR-NAs were significantly downregulated in the liver,while in the kidney,6 miRNAs were upregulat-ed and 58 were downregulated following infection.Functional enrichment analysis revealed signifi-cant enrichment of differentially expressed miRNAs in Toll and IMD signaling pathways,HIF-1 signaling pathway,Rap1 signaling pathway,MAPK signaling pathway,and Apelin signaling path-way.These findings suggest the involvement of these miRNAs in host metabolism,pathogen rec-ognition,and immune response in the interaction between Pseudopleuronectes yokohamae and Ed-wardsiella tarda.This research lays a foundation for elucidating the mechanisms underlying bacte-rial disease susceptibility and resistance in Pseudopleuronectes yokohamae.
3.Regulatory role of miRNA in the interaction between Pseudopleuronectes yoko-hamae and Edwardsiella tarda
Yile CHAI ; Huijie WANG ; Jian HAN ; Zhizhi GU ; Wei WANG ; Shengnan CAO
Chinese Journal of Veterinary Science 2025;45(11):2372-2379
Pseudopleuronectes yokohamae is an important marine economic fish species in northern China and is vulnerable to various pathogens during the breeding process.To investigate the viru-lence of Edwardsiella tarda on Pseudopleuronectes yokohamae and elucidate the role of miRNAs in their interaction,we conducted pathological analyses on various tissues of Pseudopleuronectes yokohamae larvae pre-and post-infection with Edwardsiella tarda.Subsequently,Illumina high-throughput sequencing was employed to identify and functionally characterize differentially ex-pressed miRNAs in liver and kidney tissues.The results demonstrated that infection with Ed-wardsiella tarda led to ulceration,hemorrhaging,significant hepatomegaly,nephromegaly,and as-cites in the abdominal cavity.Histopathological examination revealed swollen hepatocytes with vac-uolization,minor blood cell infiltration,and enlarged renal corpuscles with signs of cellular lysis.miRNA sequencing analysis indicated that 24 miRNAs were significantly upregulated and 45 miR-NAs were significantly downregulated in the liver,while in the kidney,6 miRNAs were upregulat-ed and 58 were downregulated following infection.Functional enrichment analysis revealed signifi-cant enrichment of differentially expressed miRNAs in Toll and IMD signaling pathways,HIF-1 signaling pathway,Rap1 signaling pathway,MAPK signaling pathway,and Apelin signaling path-way.These findings suggest the involvement of these miRNAs in host metabolism,pathogen rec-ognition,and immune response in the interaction between Pseudopleuronectes yokohamae and Ed-wardsiella tarda.This research lays a foundation for elucidating the mechanisms underlying bacte-rial disease susceptibility and resistance in Pseudopleuronectes yokohamae.
4.Exploration on the Mechanism of Yizhu Wendan Decoction in Treating Eczema Based on GEO Database Combined with Network Pharmacology and Experimental Verification
Yijie WANG ; Tingting GUO ; Yongjun LI ; Ziyi LI ; Meng ZHANG ; Mengdi SHI ; Shengnan GU ; Youpeng WANG ; Zhijun LI
Chinese Journal of Information on Traditional Chinese Medicine 2025;32(4):32-41
Objective To explore the mechanism of Yizhu Wendan Decoction in treating eczema through GEO database combined with network pharmacology and experimental verification.Methods TCMSP,BATMAN-TCM and ETCM databases were used to screen the active components of Yizhu Wendan Decoction.Disease target information related to eczema was collected through GEO database.The drug-component-target network and PPI network were constructed by intersections of active component targets and disease targets.GO and KEGG pathway enrichment analyses were performed using DAVID database.CCK-8 method was used to screen out the optimal intervention concentration of freeze-dried powder of Yizhu Wendan Decoction.HaCaT cells were divided into control group,model group,Yizhu Wendan Decoction low concentration group,Yizhu Wendan Decoction high concentration group,si-IL-17RA group,si-IL-17RA+Yizhu Wendan Decoction low concentration group,si-IL-17RA+Yizhu Wendan Decoction high concentration group,Dexamethasone group,si-IL-17RA+Dexamethasone group.Each group was given relevant intervention.The expressions of chemokines and inflammatory factors were detected by qPCR.EdU and Annexin V-FITC/PI double staining were used to detect cell proliferation and apoptosis.Western blot was performed to detect the expressions of proteins related to apoptosis,skin barrier and IL-17 signaling pathway.Results By using databases,180 active components of Yizhu Wendan Decoction were obtained.Combined with GEO database microarrays related to eczema(GSE6012 and GSE57225),8 potential targets of Yizhu Wendan Decoction in the treatment of eczema were obtained.KEGG enrichment pathway mainly involved IL-17 signaling pathway,lipid and atherosclerotic,TNF signaling pathway,fluid shear stress and atherosclerotic,etc.When Yizhu Wendan Decoction freeze-dried powder concentration was 100 μg/mL,cell viability was the strongest.Yizhu Wendan Decoction could significantly inhibit the mRNA expressions of chemokines and inflammatory factors CCL17,CCL22,IL-1β,TNF-α,IL-6,IFN-γ,and increase the mRNA expression of IL-4 in eczema.It promoted the proliferation of HaCaT cells,increased the protein expression of Bcl-2,and reduced the protein expressions of Bad and Cleaved Caspase-3,thus inhibiting HaCaT cells apoptosis;promoted the protein expressions of FLG and LOR,and reduced the expression of MMP9,MMP1,CCL2,FOSL1,IL-17RA proteins in IL-17 signaling pathway.Conclusion Yizhu Wendan Decoction can treat eczema with multiple components,multiple pathways and multiple targets,promote the proliferation of HaCaT cells,inhibit their apoptosis,and restore the skin barrier.Its mechanism may be related to inhibiting the activation of IL-17 signaling pathway.
5.Mechanism of Treatment of Hepatocellular Carcinoma with Traditional Chinese Medicine Based on Epigenetic Regulation: A Review
Xianyu XU ; Yongping ZHU ; Yanqing LIU ; Liwei GU ; Junzhe ZHANG ; Shengnan SHEN ; Jigang WANG
Chinese Journal of Experimental Traditional Medical Formulae 2024;30(23):281-291
Hepatocellular carcinoma (HCC) is the sixth most common cancer in the world. In recent years, the clinical early diagnosis and treatment protocols of HCC have been improved, whereas the prognosis of patients is still not satisfactory, which is due to the fact that the mechanism of HCC development has not been fully elucidated. Therefore, it is of great significance to explore the molecular mechanisms and key regulatory links of hepatocellular carcinoma development to further improve the diagnosis and treatment of HCC in China. Epigenetics has become a research hotspot because of its reversibility and easy regulation. According to relevant studies, HCC involves the accumulation of multiple genetic and epigenetic changes during the initiation, promotion, and progression stages. HCC is categorized as infantile malnutrition with accumulation, hypochondriac pain, tympan ites, and abdominal mass in traditional Chinese medicine (TCM). In the treatment of HCC, TCM with low toxicity, multi-targets, and multi-mechanisms can inhibit tumor growth, alleviate the clinical symptoms, and enhance the quality of life of the patients. Chinese medicines and their active ingredients exert anti-HCC effects through epigenetic regulation of DNA methylation, histone modification, and non-coding RNA. Abnormal gene expression due to epigenetic regulation disorders is involved in all stages of HCC development. There are few studies on epigenetic regulation in TCM treatment of HCC, and there is still much room for development in basic and clinical trials. This paper reviews the mechanism of epigenetic regulation in HCC and summarizes the experimental results of TCM research on the related mechanism, with a view to providing a theoretical basis for future research on the mechanism of HCC development and clinical diagnosis and treatment of hepatocellular carcinoma with TCM.
6.Huashi Baidu formula alleviates lipopolysaccharide-induced inflammation and acute lung injury in mice by targeting nuclear factor κB/phosphatidylinositol 3-kinase and peroxiredoxin 5
Shengnan SHEN ; Liwei GU ; Qiaoli SHI ; Yongping ZHU ; Yanqing LIU ; Junzhe ZHANG ; Yuqing MENG ; Yinkwan WONG ; Wennan LUO ; Mengyao JIANG ; Ping SONG ; Jigang WANG
Science of Traditional Chinese Medicine 2024;2(1):20-28
Background: Acute respiratory distress syndrome induced by acute lung injury (ALI) is the main cause for the high mortality of corona-virus disease 2019 (COVID-19). Huashi Baidu formula (HSBD) with the effects of eliminating dampness, clearing heat, ventilating lung, and removing toxin has been proven to be effective in the treatment of COVID-19, especially in severe cases. However, the underlying mechanism and target proteins of HSBD remain unclear. Objective: To provide evidence and decipher the mechanism of HSBD in alleviating inflammation and ALI. Materials and methods: A mouse model of ALI was induced by lipopolysaccharide (LPS), and hematoxylin-eosin staining was used to examine the protective effects of HSBD on the model mice. The cellular thermal shift assay and proteomics analysis were used to predict the target proteins. Furthermore, the A549 cells with peroxiredoxin 5 (PRDX5) knockdown were established to validate the predicted proteins. Results: Huashi Baidu formula treatment mitigated ALI and inflammatory cytokine dysfunction in LPS-induced mice, thus exerting a therapeutic effect on COVID-19. Huashi Baidu formula could serve as a therapeutic agent to alleviate inflammation and lung injury via nuclear factor k B and phosphatidylinositol 3-kinase signaling and interleukin 17 inhibition as well as targeting PRDX5, which could be one of the promising targets for treating inflammation. In the A549 cell line with PRDX5 knockdown (si-PRDX5), the anti-inflammation effects of HSBD, including reversing LPS-induced increase in the nitric oxide level and reduction in the hydrogen peroxide content, were attenuated. Thus, HSBD protected A549 cells from LPS-induced inflammation mainly by targeting PRDX5. Conclusions: Huashi Baidu formula alleviates ALI by targeting nuclear factor κB/phosphatidylinositol 3-kinase and PRDX5, as well as inhibiting the immune response induced by IL-17.
7.I n situ synthesis and unidirectional insertion of membrane proteins in liposome-immobilized silica stationary phase for rapid preparation of microaffinity chromatography.
Yanqiu GU ; Rong WANG ; Panpan CHEN ; Shengnan LI ; Xinyi CHAI ; Chun CHEN ; Yue LIU ; Yan CAO ; Diya LV ; Zhanying HONG ; Zhenyu ZHU ; Yifeng CHAI ; Yongfang YUAN ; Xiaofei CHEN
Acta Pharmaceutica Sinica B 2022;12(9):3682-3693
Cell membrane affinity chromatography has been widely applied in membrane protein (MP)-targeted drug screening and interaction analysis. However, in current methods, the MP sources are derived from cell lines or recombinant protein expression, which are time-consuming for cell culture or purification, and also difficult to ensure the purity and consistent orientation of MPs in the chromatographic stationary phase. In this study, a novel in situ synthesis membrane protein affinity chromatography (iSMAC) method was developed utilizing cell-free protein expression (CFE) and covalent immobilized affinity chromatography, which achieved efficient in situ synthesis and unidirectional insertion of MPs into liposomes in the stationary phase. The advantages of iSMAC are: 1) There is no need to culture cells or prepare recombinant proteins; 2) Specific and purified MPs with stable and controllable content can be obtained within 2 h; 3) MPs maintain the transmembrane structure and a consistent orientation in the chromatographic stationary phase; 4) The flexible and personalized construction of cDNAs makes it possible to analyze drug binding sites. iSMAC was successfully applied to screen PDGFRβ inhibitors from Salvia miltiorrhiza and Schisandra chinensis. Micro columns prepared by in-situ synthesis maintain satisfactory analysis activity within 72 h. Two new PDGFRβ inhibitors, salvianolic acid B and gomisin D, were screened out with K D values of 13.44 and 7.39 μmol/L, respectively. In vitro experiments confirmed that the two compounds decreased α-SMA and collagen Ӏ mRNA levels raised by TGF-β in HSC-T6 cells through regulating the phosphorylation of p38, AKT and ERK. In vivo, Sal B could also attenuate CCl4-induced liver fibrosis by downregulating PDGFRβ downstream related protein levels. The iSMAC method can be applied to other general MPs, and provides a practical approach for the rapid preparation of MP-immobilized or other biological solid-phase materials.
8.SARS-CoV-2 impairs the disassembly of stress granules and promotes ALS-associated amyloid aggregation.
Yichen LI ; Shuaiyao LU ; Jinge GU ; Wencheng XIA ; Shengnan ZHANG ; Shenqing ZHANG ; Yan WANG ; Chong ZHANG ; Yunpeng SUN ; Jian LEI ; Cong LIU ; Zhaoming SU ; Juntao YANG ; Xiaozhong PENG ; Dan LI
Protein & Cell 2022;13(8):602-614
The nucleocapsid (N) protein of SARS-CoV-2 has been reported to have a high ability of liquid-liquid phase separation, which enables its incorporation into stress granules (SGs) of host cells. However, whether SG invasion by N protein occurs in the scenario of SARS-CoV-2 infection is unknow, neither do we know its consequence. Here, we used SARS-CoV-2 to infect mammalian cells and observed the incorporation of N protein into SGs, which resulted in markedly impaired self-disassembly but stimulated cell cellular clearance of SGs. NMR experiments further showed that N protein binds to the SG-related amyloid proteins via non-specific transient interactions, which not only expedites the phase transition of these proteins to aberrant amyloid aggregation in vitro, but also promotes the aggregation of FUS with ALS-associated P525L mutation in cells. In addition, we found that ACE2 is not necessary for the infection of SARS-CoV-2 to mammalian cells. Our work indicates that SARS-CoV-2 infection can impair the disassembly of host SGs and promote the aggregation of SG-related amyloid proteins, which may lead to an increased risk of neurodegeneration.
Amyloidogenic Proteins/metabolism*
;
Amyotrophic Lateral Sclerosis/genetics*
;
Animals
;
COVID-19
;
Cytoplasmic Granules/metabolism*
;
Mammals
;
SARS-CoV-2
;
Stress Granules
9.Akinesia deformation sequence in a fetus suspected by prenatal ultrasound and confirmed after mid-term termination
Xinyao LUO ; Qiuyang GU ; Xinxiu LIU ; Jianhua LI ; Liyan HUANG ; Xiaohua HUANG ; Shengnan WU ; Jingping YANG ; Meihua TAN
Chinese Journal of Perinatal Medicine 2022;25(3):218-221
We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.
10.Discussion on the Inhibitory Mechanism of Lanthanum Chloride on Vascular Smooth Muscle Cell Calcification Induced by High Phosphorus Based on NF-κB Signaling Pathway
Chao GU ; Lulu ZHAO ; Gang LI ; Yuan GAO ; Shengnan WANG ; Xiaojia LI ; Xiaorong YUAN ; Qiwen WANG ; BAOLECHAOLU ; Ruilan HAN
China Pharmacy 2021;32(20):2458-2466
OBJECTIVE:To discuss the inhibitory effect of lanthanum chloride on the calcification of vascular smooth muscle cells(VSMCs)induced by high phosphorus and its mechanism. METHODS :On the basis of screening the action concentration and time of lanthanum chloride by MTT method ,human VSMCs were divided into control group (1 mmol/L phosphorus solution ), lanthanum chloride high concentration control group (1 mmol/L phosphorus solution+ 60 μmol/L lanthanum chloride),model group (3 mmol/L phosphorus solution ),sodium chloride group (3 mmol/L phosphorus solution+ 180 μmol/L sodium chloride),nuclear factor κB(NF-κB)signaling pathway agonist+lanthanum chloride group (3 mmol/L phosphorus solution+ 1 μg/mL lipopolysaccharide+ 60 μmol/L lanthanum chloride),positive control group (3 mmol/L phosphorus solution+ 100 μmol/L sodium pyrophosphate),and lanthanum chloride low ,medium,and high concentration groups (3 mmol/L phosphorus solution+ 15,30,60 μmol/L lanthanum chloride). Alizarin red S staining and Von Kossa staining were used to detect cell calcification in each group after treated with phosphorus solution for 6 d and relevant medicine for 2 d. Western blot assay was used to detect the protein expression of TNF-α receptor associated protein 6(TRAF6),nuclear factor κB inhibitor protein α(IκBα),NF-κB p65,bone morphogenetic protein 2 (BMP-2),smooth muscle 22 α(SM22α)and Runt related transcription factor 2(Runx2). Real-time fluorescence quantitative polymerase chain reaction was used to detect mRNA expression of TRAF 6,IκBα,BMP-2,SM22α and Runx2. RESULTS : Compared with control group ,no cell calcification was observed in the lanthanum chloride high concentration control group ,while obvious cell calcification and significant increase of OD value were observed in model group and sodium chloride group (P< 0.01);protein and mRNA expression of TRAF 6 and BMP- 2 in cytoplasm as well as mRNA expression of Runx 2,protein expression of NF-κB p65 and Runx 2 in nucleus were significantly increased (P<0.01);protein and mRNA expression of IκBα and SM22α as well as protein expression of NF-κB p65 in cytoplasm were significantly decreased (P<0.01). Compared with model group,cell calcification was significantly improved in lanthanum chloride groups and positive control group ,while OD values were significantly reduced ;the expression levels of the above-mentioned protein and mRNA were reversed to varying degrees (P<0.05 or P<0.01). Compared with lanthanum chloride high concentration group ,obvious cell calcification was observed in NF-κB signaling pathway agonist + lanthanum chloride group ,and OD value was significantly increased ;the above indexes were significantly reversed in cytoplasm and nucleus (P<0.05 or P<0.01). CONCLUSIONS :Lanthanum chloride can inhibit the calcification of VSMCs induced by high phosphorus ,and its mechanism may be related to the inhibition of NF-κB signaling pathway activation.

Result Analysis
Print
Save
E-mail