1.Two cases of familial pediatric atypical hemolytic uremic syndrome caused by combined genetic mutations in CFH and CD46
Haomiao LI ; Yuan HAN ; Chunhua ZHU ; Qiuxia CHEN ; Sanlong ZHAO ; Fei ZHAO ; Guixia DING
Chinese Journal of Applied Clinical Pediatrics 2025;40(1):63-67
The clinical data of 2 pediatric patients with atypical hemolytic uremic syndrome (aHUS) who were admitted to the Department of Nephrology at the Children′s Hospital of Nanjing Medical University on July 2018 to June 2023 were retrospectively analyzed.Both patients had combined CFH and CD46 gene mutations.One patient, a 2-year-old boy, presented jaundice and darkened urine following mumps.The other patient, a 7-month-old girl and the younger sister of the boy, developed fever, cough, vomiting, and thrombocytopenia without any apparent cause.Laboratory tests revealed hemolytic anemia, thrombocytopenia, and acute kidney injury in both patients.The genetic test results revealed mutations in both CFH (c.3572C>T, p.Ser1191Leu) and CD46 genes (c.293C>T, p.Thr98Ile) in both patients.The patients′ mother is a heterozygous carrier of the CFH gene mutation, while their father is a heterozygous carrier of the CD46 gene mutation.Both parents exhibit normal phenotypes and are currently receiving regular infusions of Eculizumab.The pediatric aHUS caused by combined CFH and CD46 gene mutations is reported in this study for the first time in China.The clinical features of these patients are summarized and analyzed.
2.Two cases of familial pediatric atypical hemolytic uremic syndrome caused by combined genetic mutations in CFH and CD46
Haomiao LI ; Yuan HAN ; Chunhua ZHU ; Qiuxia CHEN ; Sanlong ZHAO ; Fei ZHAO ; Guixia DING
Chinese Journal of Applied Clinical Pediatrics 2025;40(1):63-67
The clinical data of 2 pediatric patients with atypical hemolytic uremic syndrome (aHUS) who were admitted to the Department of Nephrology at the Children′s Hospital of Nanjing Medical University on July 2018 to June 2023 were retrospectively analyzed.Both patients had combined CFH and CD46 gene mutations.One patient, a 2-year-old boy, presented jaundice and darkened urine following mumps.The other patient, a 7-month-old girl and the younger sister of the boy, developed fever, cough, vomiting, and thrombocytopenia without any apparent cause.Laboratory tests revealed hemolytic anemia, thrombocytopenia, and acute kidney injury in both patients.The genetic test results revealed mutations in both CFH (c.3572C>T, p.Ser1191Leu) and CD46 genes (c.293C>T, p.Thr98Ile) in both patients.The patients′ mother is a heterozygous carrier of the CFH gene mutation, while their father is a heterozygous carrier of the CD46 gene mutation.Both parents exhibit normal phenotypes and are currently receiving regular infusions of Eculizumab.The pediatric aHUS caused by combined CFH and CD46 gene mutations is reported in this study for the first time in China.The clinical features of these patients are summarized and analyzed.
3.Study on the 90-day Feeding Experimental Background Data of SD Rats for Drug Safety Evaluation
Chao QIN ; Shuangxing LI ; Tingting ZHAO ; Chenchen JIANG ; Jing ZHAO ; Yanwei YANG ; Zhi LIN ; Sanlong WANG ; Hairuo WEN
Laboratory Animal and Comparative Medicine 2025;45(4):439-448
ObjectiveTo establish background data for a 90-day feeding trial of SD rats to ensure the reliability of research data. MethodsBackground data from six independent 90-day feeding trials of SD rats conducted by the National Center for Safety Evaluation of Drugs from 2020 to 2023 were summarized. These studies involved a blank control group of 120 SPF-grade 4-week-old SD rats, with an equal number of males and females, which were only given standard full-nutrient pelleted rat feed. After the quarantine period, the animals were observed for an additional 90 days, followed by intraperitoneal injection of Zoletil (50 mg/mL) for anesthesia, blood sampling, euthanasia, and necropsy. By analyzing the data from the blank control group, a relevant background database for SD rats was established. ResultsBoth male and female rats exhibited steady weight gain, with a more pronounced increase in male rats. Within 90 days, the average body weight of male and female rats increased to over 500 g and 300 g, respectively. Three weeks later, the average daily food intake of male rats stabilized at approximately 25~28 g per rat, while that of female rats remained stable at approximately 16~19 g per rat. The food utilization rate of all animals gradually decreased from the first week of the experiment. In the white blood cell (WBC) differential count results, significant differences were observed in the counts of WBCs, neutrophils (Neut), lymphocytes (Lymph), and monocytes (Mono) between males and females (P<0.001). However, there were no significant differences in the percentages of neutrophil (%Neut), lymphocyte (%Lymph), and monocyte (%Mono) between the sexes (P>0.05). The average red blood cell count (RBC), hemoglobin concentration (HGB), hematocrit (HCT), platelet count (PLT), prothrombin time (PT), and activated partial thromboplastin time (APTT) were higher in male animals than in female animals (P<0.05). The average values of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), creatine phosphokinase (CK), lactate dehydrogenase (LDH), glucose (GLU), and triglyceride (TG) in male rats were higher than those in female rats (P<0.05). The urinary pH range for male animals was 5.0 to 8.5, while for female animals it was 6.5 to 9.0. The majority of male animals had a urinary specific gravity lower than 1.020, and the majority of female animals had a urinary specific gravity lower than 1.015. The weights of various organs (excluding the adrenal glands and reproductive organs) in male animals were heavier than those in female animals (P<0.001), while the organ/body weight ratios (excluding the kidneys and reproductive organs) of female animals were higher than those of male animals (P<0.001). ConclusionThis study summarizes the background reference ranges for body weight, food intake, hematology, and serum biochemistry indicators in SPF-grade SD rats in the untreated control group from six 90-day feeding trials conducted by the National Center for Safety Evaluation of Drugs. It provides important reference data for related research. By summarizing the background and spontaneous histopathological changes in rats, this study aids in the standardization and normalization of subsequent research, as well as in the evaluation and analysis of abnormal results.
4.Background data of SD rats in embryo-fetal development toxicity study
Manman ZHAO ; Zihe LIANG ; Xiaomeng LIU ; Ying YANG ; Chao WANG ; Tingting ZHAO ; Xingchao GENG ; Xiaobing ZHOU ; Sanlong WANG
Chinese Journal of Pharmacology and Toxicology 2024;38(7):526-532
OBJECTIVE To set up normal ranges for indexes in embryo-fetal development toxicity studies in Sprague-Dawley(SD)rats and to establish a background database to provide reference for the embryo-fetal development toxicity evaluation of drugs.METHODS The data on embryonic develop-ment and fetal growth from embryo-fetal development toxicity studies(11 items)conducted by our center between 2013 and 2022 was statistically analyzed,involving 205 pregnant rats and 3037 fetuses in total,with the mean and standard deviation,coefficient of variation and 95%confidence interval calculated.The indexes included body mass,body mass gain and food consumption during pregnancy,pregnancy outcomes(pregnancy rate,average corpora lutea,average Implant sites,average live conceptuses,live conceptuse rate,resorption rate and dead conceptuse rate),fetal growth and development(fetal mass,placental mass and sex ratio),appearance abnormality rate,visceral abnormality rate,and skeletal abnormality rate.RESULTS The mass of pregnant rats trended up during gestation,with significant increases in the late period.Food consumption increased along with gestation.Caesarean section was conducted on gestation day 20,and the pregnancy rate was 93.2%.The average corpora lutea,Implant sites and live conceptuses were 18.0±3.2,15.9±2.8 and 14.8±3.0,respectively.The live conceptuse rate was 93.4%while the total dead embryo rate was 6.6%.The average mass of fetuses and placenta were respectively 3.6±0.3 and(0.6±0.3)g,and the fetal sex ratio(male/female)was 0.94.The incidence of fetal appearance abnormalities was about 0.2%,and that of soft tissue abnormalities was approximately 0.8%.The rate of skeletal abnormalities was about 1.2%,with higher incidence of non-ossification and incomplete ossification mostly identified on sternum and hyoid bone.The numbers of ossifications of metacarpal bones,metatarsal bones and sacrococcygeal vertebrae were 7.0±0.7,8.0±0.1 and 7.4±0.5,respectively.The rate of ossification of sternumⅠtoⅣwas higher,with an average of about 98.6%-99.9%.The ossification rates of sternum Ⅴ and Ⅵ were(68.0±28.4)%and(82.8±23.9)%.CONCLUSION The background database of indexes in the embryo-fetal development toxicity study on SD rats is established for our GLP laboratory,which provides reference for reproductive toxicity studies.
5.Analysis of clinical characteristics of pediatric atypical hemolytic uremic syndrome in a single center
Haomiao LI ; Yuan HAN ; Chunhua ZHU ; Qiuxia CHEN ; Sanlong ZHAO ; Fei ZHAO ; Guixia DING
Chinese Journal of Nephrology 2024;40(5):367-378
Objective:To analyze the clinical characteristics of pediatric atypical hemolytic uremic syndrome (aHUS), and provide clinical experience for the diagnosis and treatment of aHUS in China.Methods:It was a single-center retrospective study. Fifteen aHUS children treated and having complete clinical data at Children's Hospital of Nanjing Medical University between December 31, 2017 and October 15, 2023 were enrolled to analyze the clinical features covering laboratory examinations, genetic testing results, and clinical manifestations. The children were classified based on genetic testing and complement factor H (CFH) antibody detection results to analyze the corresponding clinical characteristics.Results:Among the 15 aHUS patients. There were 8 males and 7 females. The onset age was 5.1 (0.7, 10.8) years old. All patients underwent genetic testing, with 9/15 of aHUS-related gene mutation, revealing 2 de novo mutations in complement factors-related genes. Among 11 patients screened for CFH antibody, 6 tested positive. C3 was detected in 14 patients , and C3 decreased in 9 patients. In laboratory examinations, there were notable decreases in red blood cell (RBC) count in 13 patients, platelet (PLT) count in 15 patients, hemoglobin (Hb) in 15 patients and estimated glomerular filtration rate (eGFR) in 14 patients. Blood urea nitrogen (BUN) and serum creatinine (Scr) were markedly elevated in 13 patients and 9 patients, respectively. Twelve patients exhibited elevated transaminase levels, and 14 patients exhibited elevated lactate dehydrogenase (LDH) levels. Clinically, 11 patients had triggers, and 4 patients had clear family histories. Common clinical features including anemia, thrombocytopenia, proteinuria and hematuria were in 15 patients. There were statistically significant differences in RBC count ( Z=-2.84, P=0.005), PLT count ( Z=-6.65, P<0.001), Hb ( t=-3.71, P=0.002), LDH ( Z=3.76, P=0.002), BUN ( Z=2.71, P=0.017), and eGFR ( Z=-3.65, P=0.003) before and after treatment except alanine transaminase, aspartate transaminase, Scr and complement C3 (all P>0.05). There were no significant differences in onset age, RBC count, PLT count, Hb, LDH, alanine transaminase, aspartate transaminase, Scr, BUN, eGFR, and C3 between aHUS-related gene mutation and non-mutation groups, and CFH antibody-positive and negative groups (all P>0.05). Conclusions:aHUS is marked by severity, and has diverse clinical manifestations. There are no significant differences in clinical presentation at admission between hereditary and acquired aHUS, highlighting the critical importance of genetic testing and complement-related factor detection in diagnosing aHUS etiology. The family history plays a supportive role in diagnosis of aHUS.
6.Effects of Morinda officinalis oligosaccharides exposure during lactation on the Sprague-Dawley maternal rats and their offspring's development
Manman ZHAO ; Runcheng HE ; Ying YANG ; Zeping ZUO ; Xinyao CAO ; Chao WANG ; Nie WEN ; Sanlong WANG ; Xingchao GENG ; Zhibin WANG ; Xiaobing ZHOU
Adverse Drug Reactions Journal 2024;26(9):543-550
Objective:To explore the effects of maternal exposure to Morinda officinalis oligosaccharides (MOO) during lactation on the Sprague-Dawley (SD) maternal rats and their offspring's growth and development. Methods:Seventy-two female rats with a surviving litter size of ≥ 6 were divided into the excipients control group, MOO low-dose group (50 mg/kg), MOO medium-dose group (160 mg/kg), and MOO high-dose group (500 mg/kg) using a snake-shaped grouping based on body weight, with 18 rats per group. The rats were gavage fed once daily until 20 days of delivery. The response of maternal rats after MOO exposure during lactation, as well as the appearance, response, gross anatomical abnormalities of their F1 and F2 offspring were observed. The body weight and food intake of maternal rats during lactation and those of their offspring before and after weaning were measured. The behavior (central nervous system function) of the F1 and F2 offspring was evaluated using functional observation battery (FOB). The learning and memory function of the F1 offspring was evaluated using Y-maze test. The male and female F1 offspring in the same dose group were mated when they were raised to 10-12 weeks in order to observe the reproductive function of F1 female rats.Results:Compared with the excipients control group, no abnormality was found in the clinical observation of maternal rats in the 3 MOO exposure groups during lactation, and there was no significant differences in their body weight and daily food intake during lactation (all P>0.05). No significant effects were found on the appearance, clinical symptoms, gross anatomy, body weight, and food intake of the F1 and F2 offspring after maternal rats receiving MOO exposure during lactation. In the FOB of the F1 and F2 offspring and the Y-maze test of F1 offspring, few differences in MOO exposure groups were observed and lack of significant dose-response relationship. After pregnancy, there were no statistically significant differences in the number of corpus luteum, implantation number, birth index, delivery index, survival index, and weaning index in F1 female offspring of maternal rats exposed to MOO at different doses during lactation compared with those of the excipients control group (all P>0.05). Conclusions:There were no obvious toxic reactions in maternal rats after exposure to different doses of MOO during lactation, nor in the growth and development, nervous system, learning and memory, and reproductive function of their offspring.
7.Effects of Morinda officinalis oligosaccharides exposure during lactation on the Sprague-Dawley maternal rats and their offspring's development
Manman ZHAO ; Runcheng HE ; Ying YANG ; Zeping ZUO ; Xinyao CAO ; Chao WANG ; Nie WEN ; Sanlong WANG ; Xingchao GENG ; Zhibin WANG ; Xiaobing ZHOU
Adverse Drug Reactions Journal 2024;26(9):543-550
Objective:To explore the effects of maternal exposure to Morinda officinalis oligosaccharides (MOO) during lactation on the Sprague-Dawley (SD) maternal rats and their offspring's growth and development. Methods:Seventy-two female rats with a surviving litter size of ≥ 6 were divided into the excipients control group, MOO low-dose group (50 mg/kg), MOO medium-dose group (160 mg/kg), and MOO high-dose group (500 mg/kg) using a snake-shaped grouping based on body weight, with 18 rats per group. The rats were gavage fed once daily until 20 days of delivery. The response of maternal rats after MOO exposure during lactation, as well as the appearance, response, gross anatomical abnormalities of their F1 and F2 offspring were observed. The body weight and food intake of maternal rats during lactation and those of their offspring before and after weaning were measured. The behavior (central nervous system function) of the F1 and F2 offspring was evaluated using functional observation battery (FOB). The learning and memory function of the F1 offspring was evaluated using Y-maze test. The male and female F1 offspring in the same dose group were mated when they were raised to 10-12 weeks in order to observe the reproductive function of F1 female rats.Results:Compared with the excipients control group, no abnormality was found in the clinical observation of maternal rats in the 3 MOO exposure groups during lactation, and there was no significant differences in their body weight and daily food intake during lactation (all P>0.05). No significant effects were found on the appearance, clinical symptoms, gross anatomy, body weight, and food intake of the F1 and F2 offspring after maternal rats receiving MOO exposure during lactation. In the FOB of the F1 and F2 offspring and the Y-maze test of F1 offspring, few differences in MOO exposure groups were observed and lack of significant dose-response relationship. After pregnancy, there were no statistically significant differences in the number of corpus luteum, implantation number, birth index, delivery index, survival index, and weaning index in F1 female offspring of maternal rats exposed to MOO at different doses during lactation compared with those of the excipients control group (all P>0.05). Conclusions:There were no obvious toxic reactions in maternal rats after exposure to different doses of MOO during lactation, nor in the growth and development, nervous system, learning and memory, and reproductive function of their offspring.
8.Clinical and pathological characteristics of adolescent-onset primary nephrotic syndrome in 110 children in a single center
Sanlong ZHAO ; Hongmei WU ; Fei ZHAO ; Yuan HAN ; Chunhua ZHU ; Xueqin CHENG ; Qiuxia CHEN ; Songming HUANG
Chinese Journal of Nephrology 2023;39(10):738-744
Objective:To analyze the clinical and pathological features of adolescent- onset primary nephrotic syndrome (PNS) in children (10 years≤age≤18 years), so as to explore the renal biopsy indications in adolescent-onset PNS.Methods:It was a single-center retrospective observational study. The clinical and pathological data of adolescent-onset PNS (age≥10 years) who underwent renal biopsy in Children's Hospital Affiliated to Nanjing Medical University from December 2004 to June 2022 were analyzed retrospectively.Results:A total of 110 children were included in the study, including 76 males (69.1%) and 34 females (30.9%), with the onset age ranging from 10 years to 14 years and 9 months. Forty-nine cases (44.5%) were accompanied by hematuria, including 14 cases (12.7%) of gross hematuria and 35 cases (31.8%) of microscopic hematuria. Twenty-five cases (22.7%) had hypertension, 19 cases (17.3%) had renal insufficiency, and 4 cases (3.6%) had low complement C3 at the onset. Fifty-two cases (47.3%) were steroid sensitive nephrotic syndrome and 58 cases (52.7%) were steroid resistant nephrotic syndrome. Biopsy results showed that minimal change disease(MCD) was the most common histopathological subtype (47.3%, 52 case), followed by focal segmental glomerulosclerosis (FSGS) in 22 cases (20.0%), IgA nephropathy (IgAN) in 17 cases (15.5%), membranous nephropathy (MN) in 7 cases (6.4%), mesangial proliferative glomerulonephritis in 5 cases (4.5%), IgM nephropathy in 4 cases (3.6%), membranous proliferative glomerulonephritis in 2 cases (1.8%), and C1q nephropathy in 1 case (0.9%). Among 44 children with simple type nephrotic syndrome, the pathological type was mainly MCD (77.3%), and 66 children with nephritic type nephrotic syndrome were mostly non-MCD (72.7%), such as IgAN, FSGS, MN, etc. If there are two or more clinical manifestations of persistent hematuria, hypertension, renal insufficiency or low C3 levels, the proportion of non-MCD would further increase to 92.0%(23/25). The pathological type of patient with gross hematuria or low C3-emia was non-MCD. The frequency of hematuria (69.0% vs. 17.3%, χ2=29.619, P<0.001), hypertension (31.0% vs. 13.5%, χ2=4.821, P=0.028) and renal insufficiency (24.1% vs. 9.6%, χ2=4.047, P=0.044) in non-MCD group was significantly higher than those in MCD group. Conclusions:If the clinical manifestation of PNS in adolescent over 10 years old is simple type nephrotic syndrome, the histopathological lesion is mostly MCD, and most of them are steroid sensitive. It is recommended to give hormone treatment first, and then perform renal biopsy if steroid resistance occurs; If the clinical manifestation is nephritic type nephrotic syndrome, the histopathological lesion is mostly non-MCD, especially those with gross hematuria or low C3-emia, or those have two or more clinical manifestations of persistent hematuria, hypertension, renal insufficiency and hypocomplement C3-emia, a kidney biopsy should be performed at onset.
9.Clinical analysis of antineutrophil cytoplasmic antibody-associated vasculitis in 13 children
Sanlong ZHAO ; Hongmei WU ; Fei ZHAO ; Guixia DING ; Chunhua ZHU ; Xueqin CHENG ; Qiuxia CHEN ; Songming HUANG
Chinese Journal of Nephrology 2022;38(8):664-671
Objective:To investigate the clinical manifestations, pathological characteristics, treatment and prognosis of anti-neutrophil cytoplasmic antibody-associated vasculitis (AAV) in 13 children.Methods:The clinical and pathological data of 13 cases of AAV in children′s Hospital of Nanjing Medical University from June 2000 to December 2021 were retrospectively analyzed.Results:Among the 13 cases, 12 cases were diagnosed with microscopic polyangiitis (MPA) and 1 case was granulomatosis with polyangiitis (GPA), including 10 females and 3 males. The onset age ranged from 3 years and 11 months to 13 years and 10 months. The most frequently involved organ was the kidney (12 cases, 92.3%), followed by respiratory system (7 cases, 53.8%), skin (5 cases, 38.5%), digestive system (4 cases, 30.8%), nervous system (4 cases, 30.8%) and cardiovascular system (3 cases, 23.1%). There were 10 cases with orthotic anemia, 7 cases with positive antinuclear antibody, and 3 cases with mildly decreased complement C3. Among the 12 children with renal impairment, 9 cases were accompanied by abnormal renal function at the beginning of the disease. Renal biopsy was classified according to the Berden as follows: sclerotic in 5 cases, crescentic 3 cases, focal in 2 cases and mixed in 2 cases. All children were treated with glucocorticoid combined with immunosuppressant. During the follow-up time from 8 months to 128 months, 4 cases acquired complete remission, 8 cases achieved partial remission and 1 case recurred after complete remission, and 7 cases progressed to chronic kidney disease stage 5. Three children with complete remission underwent repeated renal biopsy, including 2 cases of mixed type and 1 case of crescent type initially, and all changed to focal type.Conclusions:AAV in children occurs mainly in school-age female, and most of AAV in children is MPA. The clinical manifestations are various. Most of them have renal damage and anemia, and lung damage is also common. Patients with skin purpura onset may be misdiagnosed as Henoch-Schonlein purpura, and AAV with ANA positive or complement reduction should exclude systemic lupus erythematosus. Once the renal function is abnormal in AAV, especially estimated glomerular filtration rate<60 ml·min -1·(1.73 m 2) -1 and the pathological classification is sclerotic type or crescent type, it is difficult to reverse even after active treatment. Early diagnosis and treatment are very important for AAV.
10.CLinicaL features and MYH9 gene variant in two Chinese sibLings with Fechtner syndrome
SanLong ZHAO ; Fei ZHAO ; Aihua ZHANG ; Songming HUANG
Chinese Journal of Pediatrics 2019;57(4):286-290
Objective To summarize the cLinicaL data and moLecuLar characteristics of two sibLings with Fechtner syndrome. Methods A retrospective anaLysis was made on the cLinicaL data, Laboratory tests and genetic test resuLts of two sibLings with Fechtner syndrome in a famiLy who were foLLowed up in the Department of NephroLogy, ChiLdren′s HospitaL AffiLiated to Nanjing MedicaL University from ApriL 2018 to August 2018. ResuLts Both sibLings showed proteinuria, microscopic hematuria and thrombocytopenia. Giant pLateLets and Leucocyte incLusions were easiLy seen in peripheraL bLood smears and bone marrow ceLLs, but the resuLts of renaL function, hearing and ophthaLmoLogic examinations were normaL. The father of the sibLings presented with proteinuria, thrombocytopenia, and hearing Loss. At the age of 26 years, he deveLoped uremia and now requires hemodiaLysis. The renaL biopsy of the eLder sister suggested focaL segmentaL gLomeruLoscLerosis. Gene anaLysis showed that the sibLings and their father MYH9 gene 25 exon c. 3195_c. 3215 deLCGAGCTCCAGCCCAGATCGC (p. A1065_A1072 deL) deLetion mutation. The eLder sister was treated with benazepriL hydrochLoride for 4 months and the proteinuria was improved. Her younger brother was given tacroLimus for 3 months, but the proteinuria did not improve significantLy, then benazepriL hydrochLoride was given for 1 month and proteinuria improved. ConcLusions Fechtner syndrome is characterized by nephritis, thrombocytopenia, giant pLateLets and Leucocyte incLusions. The variant of MYH9 gene is the cause of Fechtner syndrome. The deLetion mutation of p.A1065_A1072deL is the second internationaL report. Angiotensin?converting enzyme inhibitors may be effective in reducing proteinuria in patients with Fechtner syndrome.

Result Analysis
Print
Save
E-mail