Objective To investigate the value of fractional-order calculus(FROC)and continuous-time random-walk(CTRW)diffusion models based on readout segmentation of long variable echo-trains(RESOLVE)in identifying benign and malignant lesions in the head and neck.Methods A retrospective analysis was conducted on 61 patients pathologically confirmed head and neck lesions,including 19 benign lesions(BL)and 42 malignant lesions(ML).The ML were further divided into a lymphoma subgroup(LS)with 9 cases(14 lesions)and a non-lymphoma malignant lesion subgroup(MLS)with 33 cases.The parameters of DFROC,βFROC,μFROC,DCTRW,αCTRW and βCTRW were obtained from the two diffusion models;Independent sample t-tests or U tests were used to compare the differences in each parameter between benign and malignant groups and among various subgroups,and the receiver operating characteristic(ROC)curve was used to analyze the diagnostic efficacy of each parameter.Area under the curve(AUC)was compared by DeLong test.Results DFROC,μFROC,DCTRW and αCTRW showed significant differences between benign and malignant,BL and LS,BL and MLS and LS and MLS,with αCTRW showed the highest diagnostic efficacy;βFROC showed differences between BL and LS,BL and MLS,whileβCTRW did not show differences between benign and malignant groups,and among subgroups.Conclusion FROC and CTRW diffusion models based on RESOLVE can distinguish between benign and malignant head and neck lesions with multiple parameters,and provide metrics reflecting tissue heterogeneity.

Objective To investigate the value of fractional-order calculus(FROC)and continuous-time random-walk(CTRW)diffusion models based on readout segmentation of long variable echo-trains(RESOLVE)in identifying benign and malignant lesions in the head and neck.Methods A retrospective analysis was conducted on 61 patients pathologically confirmed head and neck lesions,including 19 benign lesions(BL)and 42 malignant lesions(ML).The ML were further divided into a lymphoma subgroup(LS)with 9 cases(14 lesions)and a non-lymphoma malignant lesion subgroup(MLS)with 33 cases.The parameters of DFROC,βFROC,μFROC,DCTRW,αCTRW and βCTRW were obtained from the two diffusion models;Independent sample t-tests or U tests were used to compare the differences in each parameter between benign and malignant groups and among various subgroups,and the receiver operating characteristic(ROC)curve was used to analyze the diagnostic efficacy of each parameter.Area under the curve(AUC)was compared by DeLong test.Results DFROC,μFROC,DCTRW and αCTRW showed significant differences between benign and malignant,BL and LS,BL and MLS and LS and MLS,with αCTRW showed the highest diagnostic efficacy;βFROC showed differences between BL and LS,BL and MLS,whileβCTRW did not show differences between benign and malignant groups,and among subgroups.Conclusion FROC and CTRW diffusion models based on RESOLVE can distinguish between benign and malignant head and neck lesions with multiple parameters,and provide metrics reflecting tissue heterogeneity.

Purpose To evaluate the differential diagnostic value of conventional ultrasound in the ureteral polyps and ureteral carcinoma via continuous observation.Materials and Methods The conventional ultrasound of patients with ureteral polyps and ureteral carcinoma treated in Shaanxi Provincial People's Hospital were retrospectively analyzed from June 2015 to June 2022.According to the pathological results,all participants were divided into the ureteral polyp group(98 cases)and the ureteral carcinoma group(151 cases).All clinical and ultrasound data were recorded,and the differences of echo,blood flow and peristalsis were compared between the two groups.Results There were significant differences in ureteral peristalsis,color Doppler flow distribution,periureteral tissue thickening,increased echo,and hydronephrosis(χ2=197.50,138.89,26.97,36.13,all P<0.05)between the two groups.Low echo was predominant in both groups[67(68.37)vs.114(75.50)],with no significant difference(χ2=1.52,P>0.05).In the ureteral polyp group,67 cases were found in the upper ureter,89 cases were observed continuously with common peristalsis,and 73 cases with color blood flow were mostly central blood flow,while in the ureteral cancer group,85 cases were found in the middle and lower ureter,148 cases showed almost no peristalsis,and 122 cases with color blood flow were mostly peripheral blood flow.Conclusion There are some differences in clinical features such as the location as well as whether hydronephrosis between ureteral polyps and carcinoma.Peristalsis can provide the differential diagnosis for ureteral polyps and ureteral carcinoma via continuous observation.

Ultrasound contrast agent is widely used in the diagnosis and treatment of kidney diseases.Connecting specific ligands on the surface of ultrasound contrast agent to construct targeted ultrasound contrast agent is a development trend.Targeted ultrasound contrast agent can specifically gather in kidney lesions,significantly enhance the ultrasound imaging of kidney lesions and the therapeutic effect of drug or gene,and achieve the early diagnosis and targeted therapy of kidney diseases at the gene,molecular and cell levels.The research progress of targeted ultrasound contrast agent in molecular imaging and targeted therapy of kidney diseases are reviewed in this paper.

0bjective:To observe The effects of 12-week Tai Chi Cardiac Rehabilitation Programme(TCCRP)and conven-tional exercise rehabilitation program(CERP)on inflammatory factors and adhesion molecules in patients with coronary heart disease(CHD).Method:Forty-six patients with CHD were jointly recruited from Anzhen Community Service Center at Bei-jing Chaoyang District and Wanjie Rehabilitation Hospital at Shandong Zibo from Oct.2020 to Nov.2021,and were randomly divided into the TCCRP group(n=23)and the CERP group as the control group(n=23)ac-cording to a 1∶1 ratio.Thirty-four patients completed the whole program,14 patients in the TCCRP group and 20 patients in the CERP group.All program were 60 min per time,3 times a week for a total of 12 weeks,including 4 weeks of in-hospital rehabilitation and 8 weeks of remote on-line home-based rehabilita-tion.Inflammatory factors and adhesion molecules were detected before and after the intervention.Result:After 12 weeks of intervention,C-reactive protein(CRP),interleukin 6(IL-6),vascular cell adhe-sion molecule(VCAM-1),and intercell adhesion molecule(ICAM-1)all decreased significantly(P＜0.01).The anti-inflammatory factor interleukin 10(IL-10)increased significantly in the TCCRP group(P＜0.0l).There was no significant difference between the two groups before the intervention(P＞0.05),and the VCAM-1 in the TCCRP group was significantly lower than the CERP group after the intervention(P＜0.05).Conclusion:In patients with coronary heart disease,the 12-week TCCRP and CERP intervention can effectively reduce the levels of pro-inflammatory factors CRP,IL-6 and adhesion molecules ICAM-1 and VCAM-1.The TC-CRP can effectively improve the level of anti-inflammatory factor IL-10 and reduce the expression of adhesion molecule VCAM-1 compared with CERP,which indicate a more positive effect on regulating the balance between pro-inflammatory and anti-inflammatory factors and improving the anti-inflammatory and anti-adhesion ability.

Purpose To investigate the features of conventional and contrast-enhanced ultrasound (CEUS) imaging in renal epithelioid angiomyolipoma (EAML). Materials and Methods We retrospectively analyzed the conventional ultrasound and CEUS images of the 30 patients with renal EAML who were confirmed by pathology in the General Hospital of the PLA from November 2010 to October 2022. The location,size,classfication,echo,boundary,shape,growth pattern and whether color Doppler ultrasound detects blood flow signals were observed by conventional ultrasound. CEUS was used to analyze the wash-in pattern,enhancement direction,peak enhancement intensity,the uniformity after enhancement,wash-out pattern and pseudocapsule sign,respectively. Results A total of 30 patients (n=30 lesions) were enrolled. The maximal diameter of the lesions varied from 1.4 to 12.6 cm. 17 cases occurred in the right kidney and 13 cases in the left kidney. On grayscale ultrasound,28 cases showed solid type,2 were cystic solid;18 cases demonstrated hypoechoic,10 were hyperechoic;the solid component in the cystic solid lesion was isoechoic in 1 case and hyperechoic in 1 case;24 cases displayed well-defined and 19 cases appeared regular shape;22 cases were presented exophytic growth. Color Doppler ultrasound detected blood flow in 24 cases. Of all 30 patients with EAML,CEUS was performed in 13 cases,6 lesions with simultaneous wash-in;10 cases with centripetal enhancement;9 cases with hyper-enhancement;10 cases with homogeneous enhancement;5 lesions with simultaneous wash-out;9 cases with pseudocapsule sign. Conclusion The ultrasonographic appearance of EAML has a tendency to be hypoechoic with exophytic growth and clear boundary on conventional ultrasound images,and centripetal enhancement,homogeneous hyperenhancement and presence of pseudocapsule on CEUS images. All these findings are contributed to the diagnosis of EAML.

0bjective:To observe The effects of 12-week Tai Chi Cardiac Rehabilitation Programme(TCCRP)and conven-tional exercise rehabilitation program(CERP)on inflammatory factors and adhesion molecules in patients with coronary heart disease(CHD).Method:Forty-six patients with CHD were jointly recruited from Anzhen Community Service Center at Bei-jing Chaoyang District and Wanjie Rehabilitation Hospital at Shandong Zibo from Oct.2020 to Nov.2021,and were randomly divided into the TCCRP group(n=23)and the CERP group as the control group(n=23)ac-cording to a 1∶1 ratio.Thirty-four patients completed the whole program,14 patients in the TCCRP group and 20 patients in the CERP group.All program were 60 min per time,3 times a week for a total of 12 weeks,including 4 weeks of in-hospital rehabilitation and 8 weeks of remote on-line home-based rehabilita-tion.Inflammatory factors and adhesion molecules were detected before and after the intervention.Result:After 12 weeks of intervention,C-reactive protein(CRP),interleukin 6(IL-6),vascular cell adhe-sion molecule(VCAM-1),and intercell adhesion molecule(ICAM-1)all decreased significantly(P＜0.01).The anti-inflammatory factor interleukin 10(IL-10)increased significantly in the TCCRP group(P＜0.0l).There was no significant difference between the two groups before the intervention(P＞0.05),and the VCAM-1 in the TCCRP group was significantly lower than the CERP group after the intervention(P＜0.05).Conclusion:In patients with coronary heart disease,the 12-week TCCRP and CERP intervention can effectively reduce the levels of pro-inflammatory factors CRP,IL-6 and adhesion molecules ICAM-1 and VCAM-1.The TC-CRP can effectively improve the level of anti-inflammatory factor IL-10 and reduce the expression of adhesion molecule VCAM-1 compared with CERP,which indicate a more positive effect on regulating the balance between pro-inflammatory and anti-inflammatory factors and improving the anti-inflammatory and anti-adhesion ability.

Purpose To investigate the features of conventional and contrast-enhanced ultrasound (CEUS) imaging in renal epithelioid angiomyolipoma (EAML). Materials and Methods We retrospectively analyzed the conventional ultrasound and CEUS images of the 30 patients with renal EAML who were confirmed by pathology in the General Hospital of the PLA from November 2010 to October 2022. The location,size,classfication,echo,boundary,shape,growth pattern and whether color Doppler ultrasound detects blood flow signals were observed by conventional ultrasound. CEUS was used to analyze the wash-in pattern,enhancement direction,peak enhancement intensity,the uniformity after enhancement,wash-out pattern and pseudocapsule sign,respectively. Results A total of 30 patients (n=30 lesions) were enrolled. The maximal diameter of the lesions varied from 1.4 to 12.6 cm. 17 cases occurred in the right kidney and 13 cases in the left kidney. On grayscale ultrasound,28 cases showed solid type,2 were cystic solid;18 cases demonstrated hypoechoic,10 were hyperechoic;the solid component in the cystic solid lesion was isoechoic in 1 case and hyperechoic in 1 case;24 cases displayed well-defined and 19 cases appeared regular shape;22 cases were presented exophytic growth. Color Doppler ultrasound detected blood flow in 24 cases. Of all 30 patients with EAML,CEUS was performed in 13 cases,6 lesions with simultaneous wash-in;10 cases with centripetal enhancement;9 cases with hyper-enhancement;10 cases with homogeneous enhancement;5 lesions with simultaneous wash-out;9 cases with pseudocapsule sign. Conclusion The ultrasonographic appearance of EAML has a tendency to be hypoechoic with exophytic growth and clear boundary on conventional ultrasound images,and centripetal enhancement,homogeneous hyperenhancement and presence of pseudocapsule on CEUS images. All these findings are contributed to the diagnosis of EAML.

Objective:To retrospectively analyze clinical efficacy and safety of omalizumab in the treatment of chronic urticaria (CU) in southern Zhejiang, China.Methods:A retrospective observational study was conducted on CU patients who received omalizumab treatment at the First Affiliated Hospital of Wenzhou Medical University from January 1st, 2018 to August 1st, 2021. Through the outpatient follow-up visits, the disease activity, condition control, and quality of life were evaluated using the 7-day urticaria activity score (UAS7) , urticaria control test (UCT) , and dermatology life quality index (DLQI) . In addition, changes in disease condition, recurrence after withdrawal, and adverse events were assessed. Independent-sample t test was used for intergroup comparisons of normally distributed measurement data, Wilcoxon signed-rank sum test or Kruskal-Wallis H test was used for comparisons of non-normally distributed measurement data, and chi-square test or Fisher′s exact test was used for comparisons of enumeration data. Results:A total of 252 CU patients with poor response to antihistamines were included, with a baseline UCT score of 5.0 ± 2.4 points, a UAS7 score of 25.6 ± 6.2 points, and a DLQI score of 17.5 ± 4.7 points; among them, 204 (81.0%) were treated with omalizumab at an initial dose of 300 mg, and 48 (19.0%) with omalizumab at an initial dose of 150 mg. At the end points (12.0 ± 1.4 months after the start of treatment) , an overall control rate of 90.3% (224/248) was achieved after the omalizumab treatment; concretely, 137 (55.2%) patients achieved complete control (UCT = 16 points) , 87 (35.1%) achieved partial control (12 points ≤ UCT < 16 points) , and 24 (9.7%) showed no response (UCT < 12 points) , while 10 with partial response shifted to complete control after dose increase. During the treatment period, recurrence occurred in 50 patients (36.5%) , of whom 32 patients opted for retreatment with omalizumab, and then 30 (93.8%) achieved partial or complete control. Adverse events were reported in 8 patients (3.2%) , and all were mild or moderate.Conclusion:Omalizumab was effective in the real-world treatment of CU, and could improve patients′ quality of life, with a favorable safety profile.

We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.