1.Clinical practice of minimally invasive daytime hepatectomy based on enhanced recovery after surgery whole-process management scheme
Jinghao LIN ; Yewei ZHANG ; Qijiang MAO ; Qifang LIU ; Zhaoyang GE ; Hongxia XU ; Renan JIN ; Xiao LIANG
Chinese Journal of Surgery 2025;63(4):331-337
Objective:To explore the clinical effect of the whole-process management scheme of daytime minimally invasive liver resection surgery based on the enhanced recovery after surgery (ERAS) concept.Methods:This is a retrospective case series study. The data of 55 patients who underwent minimally invasive daytime liver resection surgery under the ERAS concept at the Department of General Surgery,Sir Run Run Shaw Hospital, Zhejiang University School of Medicine from January 2023 to August 2024. There were 22 males and 33 females;aged (48.2±15.1) years (range: 16 to 77 years). All patients were classified as Grade 2 according to the American Society of Anesthesiologists physical status classification. Among them, 7 cases were complicated with liver cirrhosis and 10 cases had fatty liver. A multidisciplinary team was formed, consisting of surgeons, anesthesiologists, rehabilitation physicians, psychologists, pharmacists, acute pain management team, operating room nurses, day surgery ward nurses, and ERAS specialized nurses. After strict evaluation by surgeons and anesthesiologists, patients suitable for daytime liver resection surgery were implemented with the ERAS whole-process management plan for liver resection on the basis of routine nursing care.Results:Among the 55 patients, 50 were discharged smoothly within 48 hours, while 5 were transferred to specialized departments for further treatment due to not meeting the discharge criteria, with a smooth daytime discharge rate of 90.9%. Among the 50 patients, 30 underwent laparoscopic surgery and 20 underwent robotic-assisted surgery. The surgery time was (91.6±28.2)minutes(range:45 to 165 minutes), with the intraoperative blood loss of only (30.5±25.5)ml(range:5 to 100 ml). Pathological examination results showed that among the 50 patients, 13 cases had hepatocellular carcinoma, 21 cases had hepatic hemangioma, 4 cases had hepatic cyst, 8 cases had focal nodular hyperplasia, 1 case had low-grade dysplastic nodule, 1 case had hepatolithiasis, 1 case had lymphoma, and 1 case had vascular, fibrous and lymphoid tissue proliferation. There were 44.0% patients who were able to get out of bed on the day of surgery. The hospital stay was (1.8±0.4)days(range:1 to 2 days), and the hospitalization cost was (34 499±20 330)yuan(range:11 724 to 73 488 yuan). No complications requiring special treatment outside the conventional pathway were observed during the hospital stay and follow-up period. At the 2-week outpatient follow-up, no significant abnormalities were found in all patients, and the wound healing was good.Conclusions:The daytime liver resection surgery based on the ERAS whole-process management plan has shown good feasibility in clinical practice. It helps to simplify medical process, shorten hospital stay, and reduce medical costs.
2.Clinical practice of minimally invasive daytime hepatectomy based on enhanced recovery after surgery whole-process management scheme
Jinghao LIN ; Yewei ZHANG ; Qijiang MAO ; Qifang LIU ; Zhaoyang GE ; Hongxia XU ; Renan JIN ; Xiao LIANG
Chinese Journal of Surgery 2025;63(4):331-337
Objective:To explore the clinical effect of the whole-process management scheme of daytime minimally invasive liver resection surgery based on the enhanced recovery after surgery (ERAS) concept.Methods:This is a retrospective case series study. The data of 55 patients who underwent minimally invasive daytime liver resection surgery under the ERAS concept at the Department of General Surgery,Sir Run Run Shaw Hospital, Zhejiang University School of Medicine from January 2023 to August 2024. There were 22 males and 33 females;aged (48.2±15.1) years (range: 16 to 77 years). All patients were classified as Grade 2 according to the American Society of Anesthesiologists physical status classification. Among them, 7 cases were complicated with liver cirrhosis and 10 cases had fatty liver. A multidisciplinary team was formed, consisting of surgeons, anesthesiologists, rehabilitation physicians, psychologists, pharmacists, acute pain management team, operating room nurses, day surgery ward nurses, and ERAS specialized nurses. After strict evaluation by surgeons and anesthesiologists, patients suitable for daytime liver resection surgery were implemented with the ERAS whole-process management plan for liver resection on the basis of routine nursing care.Results:Among the 55 patients, 50 were discharged smoothly within 48 hours, while 5 were transferred to specialized departments for further treatment due to not meeting the discharge criteria, with a smooth daytime discharge rate of 90.9%. Among the 50 patients, 30 underwent laparoscopic surgery and 20 underwent robotic-assisted surgery. The surgery time was (91.6±28.2)minutes(range:45 to 165 minutes), with the intraoperative blood loss of only (30.5±25.5)ml(range:5 to 100 ml). Pathological examination results showed that among the 50 patients, 13 cases had hepatocellular carcinoma, 21 cases had hepatic hemangioma, 4 cases had hepatic cyst, 8 cases had focal nodular hyperplasia, 1 case had low-grade dysplastic nodule, 1 case had hepatolithiasis, 1 case had lymphoma, and 1 case had vascular, fibrous and lymphoid tissue proliferation. There were 44.0% patients who were able to get out of bed on the day of surgery. The hospital stay was (1.8±0.4)days(range:1 to 2 days), and the hospitalization cost was (34 499±20 330)yuan(range:11 724 to 73 488 yuan). No complications requiring special treatment outside the conventional pathway were observed during the hospital stay and follow-up period. At the 2-week outpatient follow-up, no significant abnormalities were found in all patients, and the wound healing was good.Conclusions:The daytime liver resection surgery based on the ERAS whole-process management plan has shown good feasibility in clinical practice. It helps to simplify medical process, shorten hospital stay, and reduce medical costs.
3.Detection of duplication mutation and carriers of Duchenne/Becker muscular dystrophy by multiplex ligation-dependent probe amplification quantitative
Qifang LIN ; Wanjin CHEN ; Ning WANG ; Zhiying WU ; Minting LIN ; Shenxing MURONG
Chinese Journal of Neurology 2011;44(8):568-573
Objective To analyze the dystrophin gene in patients with Duchenne/Becker muscular dystrophy (DMD/BMD) and their family members by multiplex ligation-dependent probe amplification (MLPA) method and to evaluate the application of this method in the mutations detection. Methods The whole dystrophin gene (79 exons) was analyzed by MLPA in 355 patients with DMD/BMD, the mothers of 46 patients with deletion mutation and the mothers of 8 patients with duplication mutation. The results were verified by PCR and sequencing when single exon deletion was found. Results One hundred and ninety cases were found to have deletion of one or more dystrophin exons, and 34 patients were identified to have duplication mutations. In 46 mothers of patients with deletion mutations, 28 were identified the mutations;and of 8 mothers of patients with duplication mutations, 6 were identified the mutations. There was no statistical significance between the carrier incidences in the 2 groups. A 23 bp deletion of AGGGAACAGATCCTGGTAAAGCA fragment in exon 17 was found in a patient. Conclusions Comparing with the traditional quantitative methods, MLPA can detect the deletion and duplication mutation in all the 79 exons of dystrophin gene in DMD/BMD patients, and can identify the carrier status in their family members. Furthermore, MLPA is not apt to be interfered by the concentration and purity of DNA template.
4.Characteristics of Dynamic Contractions on Surface Electromyography Single of Stroke Patients Induced from Low Limb Muscle When Exercising Passively, Exercising Initiatively with Assitant and Against Resistance
Yanquan TAN ; Huihan DAI ; Yi LIN ; Qifang CAI ; Jian WANG
Chinese Journal of Rehabilitation Theory and Practice 2009;15(4):348-351
Objective To investigate the characteristics of the dynamic contractions on the surface electromyography (sEMG) single of stroke patients induced from the low limb muscle when exercising passively, exercising initiatively with assistant and against resistance.Methods 24 stroke patients with hemiplegia and 17 normal subjects were tested with sEMG under a dynamic contractions in coxa and knee flexion and extension passively, initiatively with assistant and against resistance. The myoelectric signals were collected and processed by linear time and frequency domain method.Results The values of median frequency (MF) and mean power frequency (MPF) of stroke group were significantly lower, but the value of average EMG (AEMG) was higher ( P<0.001). The values of MF and MPF in activity side were lower than that in non-activity side ( P<0.001). The values of MF and MPF when exercising passively were higher than that when exercising with resistance ( P<0.05). The value of AEMG when exercising with resistance was highest. The values of MF and MPF in the synergist muscle were higher. The values of AEMG in the antagonistic muscle and synergist muscle were higher than that agonist and synergist muscle ( P<0.01). The values of MF and MPF in non-paretic exercising side were higher significantly, but in paretic exercising side and non-paretic silent side were lower. The values of MF and MPF in exercising side from vastus lateralis (VL) were the highest. The values of AEMG in exercising side and non-exercising side from biceps femoris (BF) were the highest. The values of MF and MPF in low limb of stroke group reduced, that in rectus femoris (RF) from paretic side was the lowest; that in BF from non-paretic side was the lowest ( P<0.01). The value of AEMG in low limb of stroke group was high significantly, especially in BF from the low limb of the non-paretic side in stroke patients. The values of AEMG in four group muscles gradually were higher following the higher exercising load, and that in the BF was the highest, and that in vastus medialis (VM) rose significantly.Conclusion The values of MF and MPF of stroke patients with hemiplegia reduce significantly, but the value of AEMG is higher. The values of MF and MPF in exercising side are lower than that in non-exercising side and non-paretic exercising side rising significantly, but that in paretic exercising side and non-paretic silent side reduce significantly. The values of MF and MPF in assistant exercise are higher than that in passive exercise and resistance exercise, but the value of AEMG in resistance exercise is higher than that in assistant exercise and in passive exercise. The values of MF and MPF in synergist muscle rise, but the values of AEMG in antagonist and synergist muscle are higher than that agonist and synergist muscle.
5.Effect of Dynamic Contractions on sEMG Co-contraction Ratio Taken from Antagonist Muscles of Knee Joint in Stroke Patients at Convalescence Stage
Yanquan TAN ; Qifang CAI ; Yi LIN ; Huihan DAI
Chinese Journal of Rehabilitation Theory and Practice 2008;14(3):220-221
Objective To observe the influence of dynamic contractions on the sEMG co-contraction ratio taken from the antagonist muscles of the knee joint of stroke patients.Methods 11 stroke patients and 14 healthy subjects were measured the dynamic contractions in both knee flexion and extension with the surface electromyography(sEMG).Results There was no significant differences of the median frequency(MF),mean power frequency(MPF),average EMG(AEMG)and the sEMG co-contraction ratio within the stroke patients and the healthy(P>0.05).There was no significant difference of the MF between the patients compared with the healthy(P>0.05),but the sEMG co-contraction ratio of the MPF increased significantly and that of AEMG decreased significantly(P<0.01).Conclusion The MPF,AEMG and the sEMG co-contraction ratio taken from the stoke patients may reflect the characters of the low limb muscle and the MF may not.
6.The sEMG Characteristics of the Lower Limbs Muscles in Stroke Patients
Yanquan TAN ; Huihan DAI ; Qifang CAI ; Yi LIN
Chinese Journal of Sports Medicine 2003;0(05):-
Objective To observe the surface electromyogram(sEMG)characteristics of the lower limbs muscles in stroke patients and healthy subjects during the passive and active-assisted anti-resistance movements.Methods Twenty four stroke patients and 17 healthy individuals(control group) participated in this study.sEMG of rectus femoris(RF),vastus lateralis(VL),ventralis medialis(VM)and biceps femoris(BF)was recorded during passive and active-assisted anti-resistance of knee joint in both groups.Average EMG(AEMG),mean power frequency(MPF)and median frequency(MF) were analyzed.Results Multiple factor ANOVA showed that very significant differences in the values of MF,MPF and AEMG between non-paretic and the paretic limbs appeared(P


Result Analysis
Print
Save
E-mail