ObjectiveThis study aims to elucidate the potential mechanism of Zuojinwan in improving liver fibrosis through hepatic tissue metabolomics analysis. MethodsTwenty-four mice were randomly allocated into normal group， model group ， positive drug group （silymarin， 100 mg·kg^-1）， and Zuojinwan group （Zuojinwan solution， 2.5 g·kg^-1）， with per group six mice. Liver fibrosis model was induced via intraperitoneal injection of olive oil solution with 10% carbon tetrachloride （CCl₄） （0.5 μL·g^-1， three times weekly for 8 weeks） in all groups except the normal group. During the final 4 weeks， the silymarin group received silymarin （100 mg·kg^-1） by gavage thrice weekly， while the Zuojinwan group was administered Zuojinwan solution （2.5 g·kg^-1） under the same regimen. After the last administration， the levels of liver fibrosis indicators and liver injury markers in serum were detected. The pathological morphological changes of the liver tissues were observed. The levels of liver fibrosis markers α-smooth muscle actin （α-SMA） and Collagen Ⅰ（ColⅠ） were detected. Metabolomics was analyzed on mice's liver tissues. The mice's serum was collected for metabolomics analysis. ResultsCompared with the model group， Zuojinwan significantly improved indicators related to liver fibrosis and liver injury. Compared with the normal group， the model group showed significantly elevated levels of fibrosis markers such as laminin （LN）， hyaluronic acid （HA）， procollagen typeⅢ （PC-Ⅲ）， and type Ⅳ Collagen （Ⅳ-C）， while liver injury indicators such as alanine aminotransferase （ALT）， aspartate aminotransferase （AST）， alkaline phosphatase （ALP）， lactate dehydrogenase （LDH）， and total bilirubin （TBIL）， exhibited a marked upward trend （P<0.05）. Compared with the model group， the silymarin group showed a significant decrease in the aforementioned indicators （P<0.05）. Notably， compared with the model group， the Zuojinwan group exhibited a significant reduction in all these indicators （P<0.05）， with efficacy comparable to that of the silymarin group. Zuojinwan reduced mRNA and protein levels of α-SMA and ColⅠ in the liver tissue. Metabolomics results revealed that compared with the model group， Zuojiinwan significantly reduced levels of glucose metabolism-related metabolites such as D-fructose 1，6-bisphosphate （FBP）， nicotinamide adenine dinucleotide phosphate （NADPH）， sodium beta-D-fructose 6-phosphate （F6P）， dihydroxyacetone phosphate （DHAP）， fumaric acid， and D-glucose 6-phosphate （G6P） （P<0.05）. Serum enzyme-linked immunosorbent assay （ELISA） was used to detect glucose metabolism indicators and further validate the regulatory effect of Zuojinwan on glucose metabolism. ConclusionThese results suggest that Zuojinwan may improve liver fibrosis by regulating the dysregulated levels of glucose metabolism during the progression of liver fibrosis.

ObjectiveTo investigate the association of the traditional Chinese medicine （TCM） syndrome types of primary liver cancer （PLC） with clinical features and multimodal quantitative radiological features on computed tomography （CT） and magnetic resonance imaging （MRI）， and to provide a reference for the objectification of TCM syndrome differentiation and precise diagnosis and treatment. MethodsA retrospective analysis was performed for the clinical data of 312 patients who were diagnosed with PLC in The First Affiliated Hospital of Hunan University of Chinese Medicine from March 2020 to June 2025， and according to the TCM syndrome type， they were divided into stagnation of liver Qi group with 40 patients， stagnation of liver Qi and spleen deficiency group with 109 patients， Qi stagnation and blood stasis group with 62 patients， dampness-heat toxin amassment group with 81 patients， and liver-kidney Yin deficiency group with 20 patients. Clinical features and multimodal quantitative radiological features were compared between the patients with different TCM syndrome types. A one-way analysis of variance was used for comparison of normally distributed continuous data between multiple groups， and the least significant difference t-test was used for further comparison between two groups； the Kruskal-Wallis H test was used for comparison of non-normally distributed continuous data between multiple groups， and the Dunn’s multiple test was used for further comparison between two groups； the chi-square test was used for comparison of categorical data between groups， and the Bonferroni method was used for further comparison between two groups. ResultsThere were significant differences between the patients with different TCM syndrome types in China liver cancer staging （CNLC）， Child-Pugh class， alanine aminotransferase， aspartate aminotransferase， albumin， direct bilirubin， total bilirubin， prothrombin time， neutrophil， and albumin-bilirubin score （all P<0.05）. In the stagnation of liver Qi group， the patients with Child-Pugh class A accounted for 75.00%； among the patients with CNLC stage I PLC， the patients with stagnation of liver Qi accounted for 60.00%， and those with Qi stagnation and blood stasis syndrome accounted for 59.68%， while among the patients with CNLC stage IV PLC， the distribution proportion of dampness-heat toxin amassment （27.16%） and liver-kidney Yin deficiency （30.00%） was significantly higher than that of stagnation of liver Qi （2.50%） （all P<0.05）. Radiological examination showed that there were significant differences between the patients with different TCM syndrome types in the number of tumors， ascites， venous tumor thrombus， maximum tumor diameter， intrahepatic metastasis， and lymph node metastasis in the hepatic hilar and retroperitoneal regions （all P<0.05）. Compared with the patients with stagnation of liver Qi， the patients with liver depression and spleen deficiency or liver-kidney Yin deficiency were more likely to develop intrahepatic metastasis； the patients with liver depression and spleen deficiency， dampness-heat toxin amassment， or liver-kidney Yin deficiency were more likely to develop lymph node metastasis in the hepatic hilar and retroperitoneal regions； the patients with liver-kidney Yin deficiency were more likely to experience multiple tumors； the patients with liver depression and spleen deficiency or dampness-heat toxin amassment were more likely to develop ascites （all P<0.05）. Compared with the patients with Qi stagnation and blood stasis syndrome， the patients with liver depression and spleen deficiency had a significantly longer maximum tumor diameter and a significantly higher proportion of patients with venous tumor thrombus （both P<0.05）. Furthermore， among the 184 patients with MRI diffusion-weighted imaging sequences， the patients with dampness-heat toxin amassment or Qi stagnation and blood stasis syndrome had significantly higher ADC values and relative ADC values than those with stagnation of liver Qi （all P<0.05）. ConclusionThere are significant differences in CT/MRI radiological features and clinical features between PLC patients with different TCM syndrome types， among whom the patients with liver depression and spleen deficiency， dampness-heat toxin amassment， and liver-kidney Yin deficiency tend to exhibit progressive radiological features， and those with dampness-heat toxin amassment or Qi stagnation and blood stasis syndrome tend to have higher ADC values. These findings provide an objective basis for TCM syndrome differentiation in PLC.

Objective: Huntington’s disease (HD) is characterized by motor, cognitive, and neuropsychiatric symptoms. Oculomotor impairments and gait variability have been independently considered as potential markers in HD. However, an integrated analysis of eye movement and gait is lacking. We performed multiple examinations of eye movement and gait variability in HTT mutation carriers, analyzed the consistency between these parameters and clinical severity, and then examined the associations between oculomotor impairments and gait deficits. Methods: We included 7 patients with pre-HD, 30 patients with HD and 30 age-matched controls. We collected demographic data and assessed the Unified Huntington’s Disease Rating Scale (UHDRS) score. Examinations, including saccades, smooth pursuit tests, and optokinetic (OPK) tests, were performed to evaluate eye movement function. The parameters of gait include stride length, walking velocity, step deviation, step length, and gait phase. Results: HD patients have significant impairments in the latency and velocity of saccades, the gain of smooth pursuit, and the gain and slow phase velocities of OPK tests. Only the speed of saccades significantly differed between pre-HD patients and controls. There are significant impairments in stride length, walking velocity, step length, and gait phase in HD patients. The parameters of eye movement and gait variability in HD patients were consistent with the UHDRS scores. There were significant correlations between eye movement and gait parameters. Conclusion Our results show that eye movement and gait are impaired in HD patients and that the speed of saccades is impaired early in pre-HD. Eye movement and gait abnormalities in HD patients are significantly correlated with clinical disease severity.

Objective·To determine hyaluronan(HA)expression in the endocrine-resistant microenvironment of estrogen receptor-positive(ER+)breast cancer and elucidate its impact on the acquired resistance.Methods·Chemiluminescent immunoassay was used to quantify HA levels in the culture supernatants of fulvestrant-resistant breast cancer cells.An immunofluorescence(IF)assay was performed to visualize the colocalization of CD44 and HA in MCF7/FulR cells.Using an established adaptive endocrine-resistant breast cancer mouse model,HA expression in resistant breast cancer tissues was assessed by immunohistochemistry(IHC)assay.Single-cell RNA sequencing(scRNA-seq)and RNA sequencing(RNA-seq)were conducted to examine transcriptomic profiles and alterations in HA-related genes in resistant breast cancer cells.Flow cytometry(FCM)was utilized to measure the proportion of CD44+CD24-cells in MCF7/FulR.The correlation between HA synthesis genes and cell stemness was investigated in clinical ER+breast cancers from GEO data sets.Hyaluronidase(HAase)treatment was applied to remove the"HA coat",and RT-qPCR and Western blotting analysis were carried out to monitor changes in stemness-related molecules.CCK-8 assays,flow cytometry(FCM),and Hoechst 33258 staining were performed to determine changes in apoptosis and fulvestrant efficiency after HAase treatment.Results·IF results revealed that compared with MCF7 cells,the"HA coat"on the surface of MCF7/FulR cells was significantly thickened.IHC demonstrated markedly increased HA retention in fulvestrant-resistant mouse breast cancer tissues.ScRNA-seq and RNA-seq analyses indicated elevated expression of stemness-related genes and HA synthesis-associated genes in fulvestrant-resistant breast cancer cells.Correlation analysis revealed a positive association between HA synthesis and cancer stemness in ER+breast cancer.IF and RT-qPCR results demonstrated that removing the HA coating from the surface of MCF7/FulR cells led to a significant reduction in the expression of stemness-related molecules;concurrently,CCK-8 assays,FCM analysis,and Hoechst 33258 staining revealed that"HA coat"clearance reduced MCF7/FulR'tolerance to fulvestrant and increased apoptosis.Conclusion·Endocrine-resistant breast cancer cells develop an enriched"HA coat",which promotes stemness in fulvestrant-resistant tumors.Disruption of this HA coat through HAase treatment effectively reduces cell stemness,induces apoptosis,and re-sensitizes breast cancer cells to fulvestrant.

Objective:To analyze the effect of joint management of type 2 diabetes mellitus (T2DM) between specialty and community under the model of National Diabetes Prevention and Control Center (DPCC).Methods:A total of 2 527 T2DM patients managed by DPCC Pingshan Center of Shenzhen from January 1, 2022 to December 31, 2024 were retrospectively included. After management, the rate of downturn, reexamination rate, blood pressure compliance rate, metabolic indicators (waist circumference, body mass index, fasting blood glucose, glycosylated hemoglobin, blood lipids) and screening rate of chronic complications of diabetes (atherosclerotic cardiovascular disease, microvascular disease, diabetic peripheral neuropathy) were analyzed. Those included 2022 ( n=564), 2023 ( n=1 477), and 2024 ( n=2 527). Results:The downturn rate in 2022, 2023 and 2024 increased year by year (22.8% vs 67.2% vs 89.9%, P<0.01), and the review rate (41.1% vs 62.2% vs 52.7%, P<0.01), complication screening rate (51.6% vs 85.3% vs 62.2%, P<0.01), blood pressure compliance rate (53.1% vs 78.0% vs 67.2%, P<0.01), body mass index compliance rate (13.2% vs 17.3% vs 28.6%, P<0.01), fasting blood glucose meeting rate (46.4% vs 60.2% vs 68.5%, P<0.01), glycated hemoglobin meeting rate (58.4% vs 63.2% vs 45.6%, P<0.01) were relatively improved. Waist circumference compliance rate (30.6% vs 27.7% vs 21.6%) and blood lipid compliance rate (33.6% vs 35.5% vs 31.9%) were not significantly improved, and the review rate, blood pressure compliance rate and complication screening rate in 2024 were lower than those in 2023 and higher than those in 2022. Conclusions:The combined management of type 2 diabetes under the DPCC model has significant effects on improving the down-conversion rate, rediagnosis rate, blood pressure compliance rate, metabolic index compliance rate and the screening rate of diabetes-related chronic complications in patients with diabetes. At the same time, it was also found that with the progress of hierarchical diagnosis and treatment, the review rate, complication screening rate, blood pressure, waist circumference, blood lipid and glycosylated hemoglobin reached the standard of patients decreased compared with the previous situation, which needs to be further analyzed and improved.

OBJECTIVE To establish the HPLC fingerprint of Xintong granules and the quantitative analysis of multi-components by single-marker method(QAMS)to determine the contents of 7 components,so as to provide a scientific basis for their quality control.METHODS HPLC method was used to establish the fingerprints for 10 batches of Xintong granules(No.S1-S10),and similarity evaluation,cluster analysis(CA)and partial least squares-discriminant analysis(PLS-DA)were performed.At the same time,the contents of seven components,including puerarin,daidzin,calycosin-7-O-β-D-glucoside,stilbene glycoside,naringin,icariin and tanshinone ⅡA,were determined by QAMS method,and were compared with the results of external standard method.RESULTS A total of 18 common peaks were marked and 7 peaks were identified in the HPLC fingerprints for 10 batches of Xintong granules,namely puerarin(peak 4),daidzin(peak 7),calycosin-7-O-β-D-glucoside(peak 9),stilbene glycoside(peak 10),naringin(peak 12),icariin(peak 17),and tanshinone ⅡA(peak 18);the similarities among them were more than 0.990,and CA and PLS-DA results showed that S4-S5,S8-S10,S1-S3 and S6-S7 were clustered into three categories,respectively.Using naringin as the internal standard,the contents of puerarin,daidzin,calycosin-7-O-β-D-glucoside,stilbene glycoside,icariin and tanshinone ⅡA were determined to be 7.868 1-10.181 2,1.709 2-2.374 1,0.285 2-0.326 3,1.024 1-1.523 9,0.140 2-0.290 4,and 0.077 1-0.219 4 mg/g,respectively,by the QAMS.These results showed no significant differences compared to those obtained by the external standard method.CONCLUSIONS Established HPLC fingerprint and QAMS method are convenient,stable and accurate,which can provide a basis for the quality evaluation of Xintong granules.

Objective·To determine hyaluronan(HA)expression in the endocrine-resistant microenvironment of estrogen receptor-positive(ER+)breast cancer and elucidate its impact on the acquired resistance.Methods·Chemiluminescent immunoassay was used to quantify HA levels in the culture supernatants of fulvestrant-resistant breast cancer cells.An immunofluorescence(IF)assay was performed to visualize the colocalization of CD44 and HA in MCF7/FulR cells.Using an established adaptive endocrine-resistant breast cancer mouse model,HA expression in resistant breast cancer tissues was assessed by immunohistochemistry(IHC)assay.Single-cell RNA sequencing(scRNA-seq)and RNA sequencing(RNA-seq)were conducted to examine transcriptomic profiles and alterations in HA-related genes in resistant breast cancer cells.Flow cytometry(FCM)was utilized to measure the proportion of CD44+CD24-cells in MCF7/FulR.The correlation between HA synthesis genes and cell stemness was investigated in clinical ER+breast cancers from GEO data sets.Hyaluronidase(HAase)treatment was applied to remove the"HA coat",and RT-qPCR and Western blotting analysis were carried out to monitor changes in stemness-related molecules.CCK-8 assays,flow cytometry(FCM),and Hoechst 33258 staining were performed to determine changes in apoptosis and fulvestrant efficiency after HAase treatment.Results·IF results revealed that compared with MCF7 cells,the"HA coat"on the surface of MCF7/FulR cells was significantly thickened.IHC demonstrated markedly increased HA retention in fulvestrant-resistant mouse breast cancer tissues.ScRNA-seq and RNA-seq analyses indicated elevated expression of stemness-related genes and HA synthesis-associated genes in fulvestrant-resistant breast cancer cells.Correlation analysis revealed a positive association between HA synthesis and cancer stemness in ER+breast cancer.IF and RT-qPCR results demonstrated that removing the HA coating from the surface of MCF7/FulR cells led to a significant reduction in the expression of stemness-related molecules;concurrently,CCK-8 assays,FCM analysis,and Hoechst 33258 staining revealed that"HA coat"clearance reduced MCF7/FulR'tolerance to fulvestrant and increased apoptosis.Conclusion·Endocrine-resistant breast cancer cells develop an enriched"HA coat",which promotes stemness in fulvestrant-resistant tumors.Disruption of this HA coat through HAase treatment effectively reduces cell stemness,induces apoptosis,and re-sensitizes breast cancer cells to fulvestrant.

Stereotactic radiotherapy is widely favored because of its high treatment precision and less fractionations.ZND-A is a new domestic gamma-ray cone-beam focused stereotactic radiotherapy system.Herein the technical characteristics of ZND-A system are described in detail from the aspects of the treatment frame,gamma-ray module,collimator module,six-dimensional treatment couch module and image-guided system module,and the main parameters are compared with the mainstream gamma knife equipments at home and abroad.With reference to Response Evaluation Criteria in Solid Tumors(RECIST 1.1),the initial efficacy of the patients treated by the ZND-A system is analyzed to evaluate the advantages and disadvantages of the ZND-A system for providing a reference for the hospital clinical use of this type of gamma knife.

Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.

Stereotactic radiotherapy is widely favored because of its high treatment precision and less fractionations.ZND-A is a new domestic gamma-ray cone-beam focused stereotactic radiotherapy system.Herein the technical characteristics of ZND-A system are described in detail from the aspects of the treatment frame,gamma-ray module,collimator module,six-dimensional treatment couch module and image-guided system module,and the main parameters are compared with the mainstream gamma knife equipments at home and abroad.With reference to Response Evaluation Criteria in Solid Tumors(RECIST 1.1),the initial efficacy of the patients treated by the ZND-A system is analyzed to evaluate the advantages and disadvantages of the ZND-A system for providing a reference for the hospital clinical use of this type of gamma knife.