AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective: To explore the efficacy of a novel injectable hydrogel (GelMA/P11/IL4@LIP) loaded with P11 bacteriophages and interleukin-4 (IL-4) liposomes (LIP) in preventing relapse after maxillary expansion in mice, providing experimental evidence for its clinical application. Methods: This study was approved by the experimental animal ethics committee of our hospital. First, 15 7-week-old C57BL/6 mice were used to establish a maxillary expansion model and divided into 5 groups (3 mice in each group): a control group, post expansion day 3 group (PED3 group), post expansion day 7 group (PED7 group), retention for 14 days group (RET group), and relapse for 7 days group (REL group). The mice in each group were sacrificed at their designated time points (day 0, 3, 7, 21, 28), and their maxilla and anterior cranial regions were collected. Bone parameters and the inter-crestal distance (ICD) of maxillary incisor mesial alveolar ridge were measured using micro-computed tomography (micro-CT). Histological staining was performed to evaluate bone formation and resorption, while immunohistochemistry (IHC) was performed for macrophage markers (CD86 and CD206), mesenchymal stem cell markers (glioma-associated oncogene homolog 1 [Gli1]), and osteogenic markers (Runt-related transcription factor 2 [Runx2] and Osterix [OSX]). Next, GelMA/P11/IL4@LIP was synthesized and administered to mouse models of maxillary expansion. A total of 24 7-week-old C57BL/6 mice were divided into 4 groups (6 mice in each group): a blank control group, GelMA group, GelMA/P11 group, and GelMA/P11/IL4@LIP group. All mice underwent palatal expansion. On PED7, the expanders of all 24 mice were cemented with resin to initiate the 14-day retention period. On day 1 of the retention phase, the mice in each group received injections of saline, GelMA, GelMA/P11, or GelMA/P11/IL4@LIP at the midpalatal suture. After the 14-day retention period, three mice in each group were randomly selected and sacrificed, while the other three had their expanders removed and underwent a 7-day relapse before being sacrificed on day 28 (REL). Micro-CT, histological staining, and IHC were performed to evaluate the preventive effect of GelMA/P11/IL4@LIP on post-expansion relapse. Results: The mice maxillary expansion model exhibited a decreased ICD at REL compared to RET in micro-CT analysis (P = 0.008). IHC analysis demonstrated prolonged M1 macrophage infiltration, scarce Gli1+ mesenchymal stem cells, and insufficient expression of osteogenic markers (RUNX2 and OSX) (P < 0.001). Compared to the blank control and GelMA groups, GelMA/P11/IL4@LIP hydrogel injection in the midpalatal suture led to increased ICD at REL, promoted the timely M2 polarization of macrophages, recruited Gli1+ mesenchymal stem cells, and upregulated the expression of RUNX2 and OSX (P < 0.05). Conclusion The mechanism of relapse after maxillary expansion involves the persistent infiltration of M1 macrophages, as well as the inadequate recruitment and insufficient osteogenic differentiation of MSCs in the midpalatal suture. The GelMA/P11/IL4@LIP composite enhanced orofacial mesenchymal stem cell recruitment and promoted the M2 polarization of macrophages, thereby enhancing osteogenesis in the midpalatal suture and preventing post-expansion relapse.

Objective:To investigate the value of 24 h urinary aldosterone(24 h-UAC) measurement by liquid chromatography-tandem mass spectrometry(LC-MS/MS) in the subtype classification of primary aldosteronism(PA).Methods:A total of 86 patients with PA, including 51 with unilateral primary aldosteronism(UPA) and 35 with bilateral primary aldosteronism(BPA), were enrolled in the Department of Endocrinology and Metabolism at West China Hospital between January 2018 and December 2022. Plasma aldosterone concentration(PAC), plasma renin concentration(PRC) and 24 h-UAC were measured by LC-MS/MS. 24-hour urinary electrolytes and 24-hour urinary creatinine(24 h-UCR) were also measured. The diagnostic value of 24 h-UAC in PA subtype classification was evaluated using receiver operating characteristic(ROC) curve analysis. Multivariate logistic regression analysis was conducted with PA subtypes as the dependent variable(UPA=1, BPA=0) to establish a diagnostic model for differentiating unilateral from bilateral lesions, and its performance was compared with published Chinese classification models. Results:There were no statistical differences between the UPA and BPA groups in terms of age, gender, BMI, systolic and diastolic blood pressure, 24 h urinary potassium, sodium, chloride, 24 h-UCR and PRC( P<0.05). The lowest plasma potassium level was significantly lower in the UPA group than in the BPA group, while PAC, 24 h-UAC, aldosterone-renin ratio(ARR), and 24 h-UAC/UCR were significantly higher( P<0.05). The detection rate of typical adenomas on imaging also showed a significant difference between the two groups( P<0.05). The area under the ROC curve(AUC) of 24 h-UAC for differentiating UPA from BPA was 0.829(95% CI 0.733-0.902), with an optimal cut-off value of 15.4 μg/24 h, yielding a sensitivity of 68.63% and a specificity of 88.57%( P<0.001). At a cut-off value of 24.5 μg/24 h, specificity reached 100%, with a sensitivity of 27.45%. Multivariate analysis indicated that a combined model incorporating 24 h-UAC, the lowest plasma potassium level, and imaging findings of typical adenomas significantly improved diagnostic accuracy for PA subtyping, achieving a specificity of 91.43%. Compared with the existing Chinese modified Küpers scoring model and CONPASS prediction model, this model demonstrated higher diagnostic efficiency, a lower missed diagnosis rate, and a misdiagnosis rate intermediate between the two. Conclusion:The 24 h-UAC in UPA patients is significantly higher than in BPA patients, making it a valuable marker for PA subtype classification. A predictive model combining 24 h-UAC, the lowest plasma potassium level, and imaging evidence of typical adenomas demonstrated high diagnostic accuracy for PA subtype classification and may provide valuable guidance for clinical decision-making.

Objective:To investigate the role of Golgi protein 73(GP73)in the diagnosis of primary biliary cholangitis(PBC)and its association with disease progression and therapeutic efficacy monitoring.Methods:Serum samples were collected from 70 PBC pa-tients,36 patients with liver diseases other than autoimmune liver disease(non-AILD group),and 40 healthy controls(HC group),and ELISA was used to measure the serum level of GP73.For the inpatients with PBC,serum samples were collected before and after treat-ment to measure GP73.Results:There was a significant difference in the distribution of serum GP73 concentration between the PBC group,the non-AILD group,and the HC group(P<0.001),and the receiver operating characteristic(ROC)curve showed that GP73 had an area under the ROC curve of 0.839 in the diagnosis of PBC.Serum GP73 level was positively correlated with aspartate amino-transferase(AST)(r=0.337,P=0.009),alkaline phosphatase(ALP)(r=0.380,P=0.003),total bilirubin(r=0.330,P=0.010),and direct bilirubin(r=0.371,P=0.004),while it was negatively correlated with prothrombin activity(r=-0.329,P=0.036)and cholinesterase(r=-0.518,P<0.001).The PBC patients with liver cirrhosis had a significantly higher serum GP73 level than those without liver cirrhosis(P=0.002).There was no significant difference in GP73 content between the patients with positive anti-mitochondrial antibodies-M2,anti-BCOADC-E2PDC-E2 OGDC-E2 antibodies,and anti-SPl00 antibodies and those with negative antibodies.The PBC patients had significant reductions in the serum levels of AST,ALP,gamma-glutamyl transpeptidase,and GP73 after liver-protecting treatment and improvement in cholestasis(P<0.05).Conclusion:GP73 plays an important role in the diagnosis,disease progression,and efficacy monitoring of PBC and is expected to become a potential disease marker for PBC.

Tumor metastasis is the leading cause of high mortality in most cancers, and numerous studies have demonstrated that the malignant crosstalk of multiple components in the tumor microenvironment (TME) together promotes tumor metastasis. Cancer-associated fibroblasts (CAFs) are the major stromal cells and crosstalk centers in the TME of various kinds of tumors, such as breast cancer, pancreatic cancer, and prostate cancer. Recently, the CAF-induced pro-tumor metastatic TME has gained wide attention, being considered as one of the effective targets for tumor therapy. With in-depth research, CAFs have been found to promote tumor metastasis through multiple mechanisms, such as inducing epithelial-mesenchymal transition in tumor cells, remodeling the extracellular matrix, protecting circulating tumor cells, and facilitating the formation of a pre-metastatic niche. To enhance the anti-tumor metastasis effect, therapeutic strategies designed by combining nano-drug delivery systems with CAF modulation are undoubtedly a desirable choice, as evidenced by the research over the past decades. Herein, we introduce the physiological properties of CAFs, detail the possible mechanisms whereby CAFs promote tumor metastasis, categorize CAFs-based nano-drug delivery strategies according to their anti-metastasis functions and discuss the current challenges, possible solutions, as well as the future directions in order to provide a theoretical basis and reference for the utilization of CAFs-based nano-drug delivery strategies to promote tumor metastasis therapy.

Single-cell analysis of phenotypic plasticity could improve the development of more effective therapeutics. Still, the development of tools to measure single-cell heterogeneity has lagged due to difficulties in manipulating and culturing single cells. Here, we describe a single-cell culture and phenotyping platform that employs a starburst microfluidic network and automatic liquid handling system to capture single cells for long-term culture and multi-dimensional analysis and quantify their clonal properties via their surface biomarker and secreted cytokine/growth factor profiles. Studies performed on this platform found that cells derived from single-cell cultures maintained phenotypic equilibria similar to their parental populations. Single-cell cultures exposed to chemotherapeutic drugs stochastically disrupted this balance to favor stem-like cells. They had enhanced expression of mRNAs and secreted factors associated with cell signaling, survival, and differentiation. This single-cell analysis approach can be extended to analyze more complex phenotypes and screen responses to therapeutic targets.

Objective:To investigate the value of 24 h urinary aldosterone(24 h-UAC) measurement by liquid chromatography-tandem mass spectrometry(LC-MS/MS) in the subtype classification of primary aldosteronism(PA).Methods:A total of 86 patients with PA, including 51 with unilateral primary aldosteronism(UPA) and 35 with bilateral primary aldosteronism(BPA), were enrolled in the Department of Endocrinology and Metabolism at West China Hospital between January 2018 and December 2022. Plasma aldosterone concentration(PAC), plasma renin concentration(PRC) and 24 h-UAC were measured by LC-MS/MS. 24-hour urinary electrolytes and 24-hour urinary creatinine(24 h-UCR) were also measured. The diagnostic value of 24 h-UAC in PA subtype classification was evaluated using receiver operating characteristic(ROC) curve analysis. Multivariate logistic regression analysis was conducted with PA subtypes as the dependent variable(UPA=1, BPA=0) to establish a diagnostic model for differentiating unilateral from bilateral lesions, and its performance was compared with published Chinese classification models. Results:There were no statistical differences between the UPA and BPA groups in terms of age, gender, BMI, systolic and diastolic blood pressure, 24 h urinary potassium, sodium, chloride, 24 h-UCR and PRC( P<0.05). The lowest plasma potassium level was significantly lower in the UPA group than in the BPA group, while PAC, 24 h-UAC, aldosterone-renin ratio(ARR), and 24 h-UAC/UCR were significantly higher( P<0.05). The detection rate of typical adenomas on imaging also showed a significant difference between the two groups( P<0.05). The area under the ROC curve(AUC) of 24 h-UAC for differentiating UPA from BPA was 0.829(95% CI 0.733-0.902), with an optimal cut-off value of 15.4 μg/24 h, yielding a sensitivity of 68.63% and a specificity of 88.57%( P<0.001). At a cut-off value of 24.5 μg/24 h, specificity reached 100%, with a sensitivity of 27.45%. Multivariate analysis indicated that a combined model incorporating 24 h-UAC, the lowest plasma potassium level, and imaging findings of typical adenomas significantly improved diagnostic accuracy for PA subtyping, achieving a specificity of 91.43%. Compared with the existing Chinese modified Küpers scoring model and CONPASS prediction model, this model demonstrated higher diagnostic efficiency, a lower missed diagnosis rate, and a misdiagnosis rate intermediate between the two. Conclusion:The 24 h-UAC in UPA patients is significantly higher than in BPA patients, making it a valuable marker for PA subtype classification. A predictive model combining 24 h-UAC, the lowest plasma potassium level, and imaging evidence of typical adenomas demonstrated high diagnostic accuracy for PA subtype classification and may provide valuable guidance for clinical decision-making.

ObjectiveThe U6 promoter is an essential element for driving sgRNA expression in the clustered regularly interspaced short palindromic repeat sequences/CRISPR-associated protein 9（CRISPR/Cas9）gene editing system in dicotyledonous plants. Endogenous U6 promoters typically exhibit higher transcriptional activity， which can significantly improve gene editing efficiency. This study aims to identify endogenous U6 promoters in Artemisia annua to optimize its CRISPR/Cas9 gene editing system， which holds significant importance for its molecular breeding. MethodsOn the basis of the highly conserved U6 snRNA sequences in Arabidopsis thaliana， endogenous U6 promoters were screened in the A. annua genome. Expression vectors were constructed with candidate AaU6 promoter driving the firefly luciferase （LUC） reporter gene， and then transiently transformed into Nicotiana benthamiana. Transcriptional activities of the promoters were measured and compared by in vivo imaging and the Dual Luciferase Reporter assay. ResultsEight endogenous U6 promoters were successfully cloned from A. annua. Sequences alignment revealed that all these promoters contained the two conserved cis-acting elements， upstream sequence element （USE） and TATA-box， which affected their transcriptional activity. Dual-luciferase activity assays indicated that the transcriptional activities of AaU6-3， AaU6-1， and AaU6-5 were significantly higher than that of the Arabidopsis AtU6-26 promoter， with AaU6-3 exhibiting the highest activity. ConclusionThis study identified three endogenous AaU6 promoters with high transcriptional activity in A. annua， providing key functional elements for establishing an efficient gene editing system in A. annua. These findings will contribute to advancing precision molecular breeding and high-quality germplasm innovation in A. annua.

Background: We investigated osteoporosis management strategies and clinical outcomes following the occurrence of medicationrelated osteonecrosis of the jaw (MRONJ). Methods: We retrospectively studied individuals diagnosed with MRONJ during osteoporosis treatment who were managed in the Osteoporosis Center or the Oral Maxillofacial Surgery & Dental Unit at Queen Mary Hospital in Hong Kong between 2010 and 2022. We examined subsequent osteoporosis management plans, fracture events, and bone mineral density (BMD). Results: Thirty-six individuals were included (mean age, 78.5 years; 94.4% women). The estimated prevalence of MRONJ was 0.26%. All patients had been exposed to bisphosphonates, and seven had also received denosumab before MRONJ. Following MRONJ, only 14 individuals continued anti-osteoporosis treatment, a decision influenced by a higher fracture probability at MRONJ onset. The most common regimen was a teriparatide-raloxifene sequence (n=8): three patients achieved stable BMD, four achieved improving BMD, and one exhibited a mixed response. The patient with a mixed BMD response had also been treated with denosumab. Six patients sustained incident fractures after MRONJ, and these patients had lower BMD T-scores than their counterparts. Two patients experienced MRONJ recurrence, which was associated with the resumption of bisphosphonate or denosumab therapy after MRONJ. These patients had higher BMD T-scores than those who did not experience MRONJ recurrence. Conclusion MRONJ is challenging because high fracture risk necessitates discontinuation of antiresorptive agents. Teriparatide followed by raloxifene may be a reasonable regimen. Individualised decisions in osteoporosis management after MRONJ are required to balance fracture risk reduction with minimising MRONJ recurrence.

Objective:To investigate the clinical characteristics and offer diagnostic and therapeutic approaches for adult-onset idiopathic hypogonadotropic hypogonadism(AIHH).Methods:Clinical, laboratory, and imaging data, as well as follow-up information, of three male patients diagnosed with AIHH at the Department of Endocrinology and Metabolism of Nanfang Hospital, Southern Medical University, were systematically reviewed and analyzed.Results:All three patients were male, with a median age of 39 years(range, 22 to 40). Two patients reported symptoms of enlarged breasts and reduced sexual function, while one case solely reported a decline in sexual function. Physical examination showed that the median length of the penis was 6 cm(range, 5 to 6 cm), and the bilateral testicular volume was 7.96 mL(4.70-8.82 mL). Basal hormone levels at the time of initial visit to our hospital as follows: the median testosterone level was 0.32 ng/mL(0.24-2.96 ng/mL), median follicle stimulating hormone(FSH) level was 0.56 mIU/mL(0.1-0.75 mIU/mL), and the median luteinizing hormone(LH) level was 0.69 mIU/mL(0.1-1.03 mIU/mL). The levels of other hormones secreted by the anterior pituitary gland were normal. Hypothalamic-pituitary magnetic resonance imaging(MRI) showed that 1 patient had a pituitary microadenoma. Three patients were treated with pulsatile GnRH or gonadotropins, one of which had hypothalamic-pituitary-gonadal(HPG) axis function reversal after GnRH pulse pump therapy and lasted for 1 year, but then still had irreversible reduction.Conclusion:AIHH is marked by adult-onset disease and idiopathic hypogonadism. Enhancing fertility remains a critical requirement for these patients. Pulsatile GnRH treatment or gonadotropin therapy, as viable treatments, exhibit therapeutic effects, albeit with occasional fluctuations. Therefore, the emphasis lies in the timely consideration of fertility preservation.