AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo investigate the mechanism of topical treatment of allergic contact dermatitis （ACD） mice with Portulacae Herba based on the nuclear factor E₂-related factor 2 （Nrf2）/heme oxygenase-1 （HO-1）/nuclear factor-κB （NF-κB） signaling pathway. MethodsA total of 70 6-week-old specific pathogen free （SPF） female Kunming mice were adaptively fed for 1 week and randomly divided into blank group， model group， compound dexamethasone acetate cream group （2.075×10^-2 g·g^-1）， blank matrix cream group， low-dose Portulacae Herba cream group （0.1 g·g^-1）， high-dose Portulacae Herba cream group （0.2 g·g^-1）， and Portulacae Herba + inhibitor group （0.2 g·g^-1 + 30 mg·kg^-1 ML385）， with 10 mice in each group. One day before the experiment， the mice were shaved on the neck and back. Except for the blank group， the mice in the other groups were treated with 2，4-dinitrochlorobenzene （DNCB） to establish an ACD model. After respective administration， the skin lesion of the mice was scored， and the histopathological changes of the skin were stained with hematoxylin-eosin （HE）. Enzyme-linked immunosorbent assay （ELISA） was used to detect the levels of interleukin-6 （IL-6）， interleukin-1β （IL-1β）， reactive oxygen species （ROS）， superoxide dismutase （SOD） activity， and malondialdehyde （MDA） in serum of mice. The expression of Nrf2/HO-1/NF-κB signaling pathway-related proteins in mouse skin tissue was detected by immunohistochemistry （IHC）， Western blot， and real-time fluorescence quantitative polymerase chain reaction （Real-time PCR）. ResultsCompared with the blank group， the mice in the model group had an increased skin lesion score （P<0.01）， severe pathological damage to skin tissue， increased content of IL-1β， IL-6， ROS， and MDA in their serum （P<0.01）， and decreased content of SOD （P<0.01）. In addition， the mRNA and protein expression levels of Nrf2， HO-1， and nuclear factor-κB inhibitor α （IκBα） in skin tissue were up-regulated （P<0.01）， while the protein expression levels of phosphorylated （p）-IκBα and p-NF-κB p65 and the mRNA expression of NF-κB p65 were down-regulated （P<0.01）. Compared with the model group and the blank matrix cream group， the mice treated with Portulacae Herba had a decreased skin lesion score （P<0.01）， reduced pathological damage to skin tissue， decreased content of IL-1β， IL-6， ROS， and MDA in their serum （P<0.01）， and increased content of SOD （P<0.01）. Additionally， the mRNA and protein expression levels of Nrf2， HO-1， and IκBα in skin tissue were down-regulated （P<0.05，P<0.01）， and the protein expression levels of p-IκBα and p-NF-κB p65 and the mRNA expression of NF-κB p65 were up-regulated （P<0.05，P<0.01）. Compared with the Portulacae Herba + inhibitor group， the high-dose Portulacae Herba cream group had a decreased skin lesion score （P<0.01）， alleviated pathological damage to skin tissue， decreased content of IL-1β， IL-6， ROS， and MDA in the serum of mice （P<0.05，P<0.01）， and increased content of SOD （P<0.01）. The protein expression levels of Nrf2， HO-1， and IκBα and the mRNA expression of Nrf2 and HO-1 in skin tissue were up-regulated （P<0.05，P<0.01）， and the protein expression levels of p-IκBα and p-NF-κB p65 and the mRNA expression of NF-κB p65 were down-regulated （P<0.05）. ConclusionPortulacae Herba can improve DNCB-induced ACD skin damage in mice by regulating the Nrf2/HO-1/NF-κB signaling pathway.

With the widespread adoption of low-dose CT screening and the extensive application of high-resolution CT, the detection rate of sub-centimeter lung nodules has significantly increased. How to scientifically manage these nodules while avoiding overtreatment and diagnostic delays has become an important clinical issue. Among them, lung nodules with a consolidation tumor ratio less than 0.25, dominated by ground-glass shadows, are particularly worthy of attention. The therapeutic challenge for this group is how to achieve precise and complete resection of nodules during surgery while maximizing the preservation of the patient's lung function. The "watershed topography map" is a new technology based on big data and artificial intelligence algorithms. This method uses Dicom data from conventional dose CT scans, combined with microscopic (22-24 levels) capillary network anatomical watershed features, to generate high-precision simulated natural segmentation planes of lung sub-segments through specific textures and forms. This technology forms fluorescent watershed boundaries on the lung surface, which highly fit the actual lung anatomical structure. By analyzing the adjacent relationship between the nodule and the watershed boundary, real-time, visually accurate positioning of the nodule can be achieved. This innovative technology provides a new solution for the intraoperative positioning and resection of lung nodules. This consensus was led by four major domestic societies, jointly with expert teams in related fields, oriented to clinical practical needs, referring to domestic and foreign guidelines and consensus, and finally formed after multiple rounds of consultation, discussion, and voting. The main content covers the theoretical basis of the "watershed topography map" technology, indications, operation procedures, surgical planning details, and postoperative evaluation standards, aiming to provide scientific guidance and exploration directions for clinical peers who are currently or plan to carry out lung nodule resection using the fluorescent microscope watershed analysis method.

Objective To systematically evaluate the risk prediction models for anastomotic leakage (AL) in patients with esophageal cancer after surgery. Methods A computer-based search of PubMed, EMbase, Web of Science, Cochrane Library, Chinese Medical Journal Full-text Database, VIP, Wanfang, SinoMed and CNKI was conducted to collect studies on postoperative AL risk prediction model for esophageal cancer from their inception to October 1st, 2023. PROBAST tool was employed to evaluate the bias risk and applicability of the model, and Stata 15 software was utilized for meta-analysis. Results A total of 19 literatures were included covering 25 AL risk prediction models and 7373 patients. The area under the receiver operating characteristic curve (AUC) was 0.670-0.960. Among them, 23 prediction models had a good prediction performance (AUC>0.7); 13 models were tested for calibration of the model; 1 model was externally validated, and 10 models were internally validated. Meta-analysis showed that hypoproteinemia (OR=9.362), postoperative pulmonary complications (OR=7.427), poor incision healing (OR=5.330), anastomosis type (OR=2.965), preoperative history of thoracoabdominal surgery (OR=3.181), preoperative diabetes mellitus (OR=2.445), preoperative cardiovascular disease (OR=3.260), preoperative neoadjuvant therapy (OR=2.977), preoperative respiratory disease (OR=4.744), surgery method (OR=4.312), American Society of Anesthesiologists score (OR=2.424) were predictors for AL after esophageal cancer surgery. Conclusion At present, the prediction model of AL risk in patients with esophageal cancer after surgery is in the development stage, and the overall research quality needs to be improved.

This article combined the pathogenic characteristics of "latent wind" with the theory of collateral diseases to clarify the pathological features of tumor blood vessels， including their active proliferation， high permeabi-lity， and promotion of metastasis. The theory framework of "latent wind in collaterals" as the tumor mechanism was proposed， which suggests that at the site of tumor lesions， the collaterals inherit the nature of latent wind to grow excessively， adopt an open and discharge nature to leak essence， and tumor toxins， characterized by their rapid movement and frequent changes， spread and metastasize， driving the progression of malignant tumors. Focusing on the fundamental pathogenesis of "latent wind in collaterals"， specific clinical treatment principles and methods centered on treating wind are proposed， including regulating qi and dispelling wind， clearing heat and extinguishing wind， unblocking collaterals and expelling wind， and reinforcing healthy qi to calm wind， so as to provide references for enhancing the precision of traditional Chinese medicine in treating malignant tumors.

AIM: To compare the control effect of spherical and toric orthokeratology on low-to-moderate myopia with astigmatism(-1.00--1.50 DC)in adolescents.METHODS: The clinical data of 119 cases(119 eyes)of low-to-moderate myopia with astigmatism(-1.00--1.50 DC)adolescents who were treated and fitted with orthokeratology in the ophthalmology department of Sichuan Provincial People's Hospital from June 2021 to January 2022 were retrospectively analyzed. They were divided into spherical group, with 65 cases(65 eyes), and toric group, with 54 cases(54 eyes)according to the type of orthokeratology. The changes of uncorrected visual acuity(UCVA), axial length and corneal astigmatism before and after wearing lenses were recorded to evaluate the therapeutic effect.RESULTS: The UCVA of both the groups significantly improved at 1 and 2 a after wearing lenses(all P<0.01); corneal astigmatism decreased, but there was no significant difference(all P>0.05); the axial length was longer than that before wearing lenses(P<0.01). There were no statistical significant differences in the UCVA and corneal astigmatism between the spherical group and the toric group(Fintergroup=0.829,Pintergroup=0.364; Fintergroup=0.997,Pintergroup=0.320); and there were no statistical significant differences in the axial length growth between the spherical group and the toric group after wearing lenses for 1 a(0.18±0.11 mm vs 0.17±0.14 mm), and 2 a(0.17±0.10 mm vs 0.16±0.10 mm; all P>0.05).CONCLUSION: Both orthokeratology lenses can improve the UCVA, reduce corneal astigmatism, and delay axial length growth of adolescents with low-to-moderate myopia with astigmatism(-1.00--1.50 DC), and there are no significant differences in the control effect of spherical design orthokeratology and the toric design orthokeratology on myopia.

Surgical treatment is one of the key approaches for non-small cell lung cancer (NSCLC). Regular postoperative follow-up is crucial for early detection and timely management of tumor recurrence, metastasis, or second primary tumors. A scientifically sound and reasonable follow-up strategy not only extends patient survival but also significantly improves quality of life, thereby enhancing overall prognosis. This consensus aims to build upon the previous version by incorporating the latest clinical research advancements and refining postoperative follow-up protocols for early-stage NSCLC patients based on different treatment modalities. It provides a scientific and practical reference for clinicians involved in the postoperative follow-up management of NSCLC. By optimizing follow-up strategies, this consensus seeks to promote the standardization and normalization of lung cancer diagnosis and treatment in China, helping more patients receive high-quality care and long-term management. Additionally, the release of this consensus is expected to provide insights for related research and clinical practice both domestically and internationally, driving continuous development and innovation in the field of postoperative management for NSCLC.

BACKGROUND:Carboxylesterase 1 and inflammatory factors play a crucial role in regulating lipid metabolism and glucose homeostasis.However,the effects of different exercise intensity interventions on carboxylesterase 1 and inflammatory factors in skeletal muscle of type 2 diabetic rats remain to be revealed. OBJECTIVE:To investigate the effects of different exercise intensity interventions on carboxylesterase 1 and inflammatory factors in skeletal muscle of type 2 diabetic rats. METHODS:Thirty-two 8-week-old male Sprague-Dawley rats were randomly divided into normal control group(n=12)and modeling group(n=20)after 1 week of adaptive feeding.Rat models of type 2 diabetes mellitus were prepared by high-fat diet and single injection of streptozotocin.After successful modeling,the rats were randomly divided into diabetic control group(n=6),moderate-intensity exercise group(n=6)and high-intensity intermittent exercise group(n=6).The latter two groups were subjected to treadmill training at corresponding intensities,once a day,50 minutes each,and 5 days per week.Exercise intervention in each group was carried out for 6 weeks.After the intervention,ELISA was used to detect blood glucose and blood lipids of rats.The morphological changes of skeletal muscle were observed by hematoxylin-eosin staining.The mRNA expression levels of carboxylesterase 1 and inflammatory cytokines were detected by real-time quantitative PCR.The protein expression levels of carboxylesterase 1 and inflammatory cytokines were detected by western blot and immunofluorescence. RESULTS AND CONCLUSION:Compared with the normal control group,fasting blood glucose,triglyceride,low-density lipoprotein cholesterol,insulin resistance index in the diabetic control group were significantly increased(P<0.01),insulin activity was decreased(P<0.05),and the mRNA and protein levels of carboxylesterase 1,never in mitosis gene A related kinase 7(NEK7)and interleukin 18 in skeletal muscle tissue were upregulated(P<0.05).Compared with the diabetic control group,fasting blood glucose,triglyceride,low-density lipoprotein cholesterol,and insulin resistance index in the moderate-intensity exercise group and high-intensity intermittent exercise group were down-regulated(P<0.05),and insulin activity was increased(P<0.05).Moreover,compared with the diabetic control group,the mRNA level of NEK7 and the protein levels of carboxylesterase 1,NEK7 and interleukin 18 in skeletal muscle were decreased in the moderate-intensity exercise group(P<0.05),while the mRNA levels of carboxylesterase 1,NEK7,NOD-like receptor heat protein domain associated protein 3 and interleukin 18 and the protein levels of carboxylesterase 1 and interleukin 18 in skeletal muscle were downregulated in the high-intensity intermittent exercise group(P<0.05).Hematoxylin-eosin staining showed that compared with the diabetic control group,the cavities of myofibers in the moderate-intensity exercise group became smaller,the number of internal cavities was reduced,and the cellular structure tended to be more intact;the myocytes of rats in the high-intensity intermittent exercise group were loosely arranged,with irregular tissue shape and increased cavities in myofibers.To conclude,both moderate-intensity exercise and high-intensity intermittent exercise can reduce blood glucose,lipid,insulin resistance and carboxylesterase 1 levels in type 2 diabetic rats.Moderate-intensity exercise can significantly reduce the expression level of NEK7 protein in skeletal muscle,while high-intensity intermittent exercise can significantly reduce the expression level of interleukin 18 protein in skeletal muscle.In addition,the level of carboxylesterase 1 is closely related to the levels of NEK7 and interleukin 18.

BACKGROUND:Multiple observational studies have suggested a potential association between telomere length and musculoskeletal diseases.However,the underlying mechanisms remain unclear. OBJECTIVE:To investigate the genetic causal relationship between telomere length and musculoskeletal diseases using two-sample Mendelian randomization analysis. METHODS:Genome-wide association study summary data of telomere length were obtained from the UK Biobank.Genome-wide association study summary data of 10 common musculoskeletal diseases(osteonecrosis,osteomyelitis,osteoporosis,rheumatoid arthritis,low back pain,spinal stenosis,gout,scapulohumeral periarthritis,ankylosing spondylitis and deep venous thrombosis of lower limbs)were obtained from the FinnGen consortium.Inverse variance weighting,Mendelian randomization-Egger and weighted median methods were used to evaluate the causal relationship between telomere length and 10 musculoskeletal diseases.Inverse variance weighting was the primary Mendelian randomization analysis method,and sensitivity analysis was performed to explore the robustness of the results. RESULTS AND CONCLUSION:(1)Inverse variance-weighted results indicated a negative causal relationship between genetically predicted telomere length and rheumatoid arthritis(odds ratio=0.78,95%confidence interval:0.64-0.95,P=0.015)and osteonecrosis(odds ratio=0.56,95%confidence interval:0.36-0.90,P=0.016).No causal relationship was found between telomere length and the other eight musculoskeletal diseases(all P>0.05).(2)Sensitivity analysis affirmed the robustness of these causal relationships,and Mendelian randomization-Egger intercept analysis found no evidence of potential horizontal pleiotropy(all P>0.05).(3)This Mendelian randomized study supports that telomere length has protective effects against rheumatoid arthritis and osteonecrosis.However,more basic and clinical research will be needed to support our findings in the future.

BACKGROUND:Pyroptosis participate in the degradation of the extracellular matrix of chondrocytes,synovial inflammation and pain,and plays an important role in the prevention and treatment of osteoarthritis.In addition,exercise can inhibit the occurrence of pyroptosis to regulate the progression of osteoarthritis,which has become a research hot spot in the prevention and treatment of osteoarthritis. OBJECTIVE:To summarize the regulatory role of pyroptosis in osteoarthritis and the mechanism of exercise-mediated pyroptosis in osteoarthritis. METHODS:PubMed and CNKI databases were searched during 1992 to 2024 with the keywords"pyroptosis,osteoarthritis,chondrocyte pyroptosis,synovial cell pyroptosis,exercise"in English and Chinese,respectively.Finally,71 relevant articles were selected according to the inclusion and exclusion criteria. RESULTS AND CONCLUSION:(1)Osteoarthritis is a chronic degenerative joint disease characterized by the breakdown of cartilage extracellular matrix,synovial inflammation,and subchondral bone remodeling.This condition often leads to organic lesions,bone pain,and functional impairment.(2)Pyroptosis,a distinct programmed cell death mechanism,involves cell lysis and the release of inflammatory cytokines,triggering a robust inflammatory response,and is closely related to the development of osteoarthritis.Pyroptosis can result in the release of numerous inflammatory factors,thereby activate the nuclear factor kappa-B transcription and increase pyroptosis protein production,and in turn exacerbate the occurrence and development of osteoarthritis.Therefore,pyroptosis can be a new direction for the prevention and treatment of osteoarthritis.(3)Exercise has been shown to down-regulate the pyroptosis protein signaling pathway and inhibit the expression of related inflammatory factors,thereby playing a pivotal role in osteoarthritis prevention and treatment.Aerobic and anaerobic exercises can delay the pathological process of osteoarthritis by inhibiting the occurrence of pyroptosis.Moderate-intensity aerobic exercise is most effective in improving osteoarthritis by inhibiting pyroptosis signaling pathways,while anaerobic exercise can have beneficial effects on osteoarthritis by improving muscle mass.