AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo investigate the mechanism of topical treatment of allergic contact dermatitis （ACD） mice with Portulacae Herba based on the nuclear factor E₂-related factor 2 （Nrf2）/heme oxygenase-1 （HO-1）/nuclear factor-κB （NF-κB） signaling pathway. MethodsA total of 70 6-week-old specific pathogen free （SPF） female Kunming mice were adaptively fed for 1 week and randomly divided into blank group， model group， compound dexamethasone acetate cream group （2.075×10^-2 g·g^-1）， blank matrix cream group， low-dose Portulacae Herba cream group （0.1 g·g^-1）， high-dose Portulacae Herba cream group （0.2 g·g^-1）， and Portulacae Herba + inhibitor group （0.2 g·g^-1 + 30 mg·kg^-1 ML385）， with 10 mice in each group. One day before the experiment， the mice were shaved on the neck and back. Except for the blank group， the mice in the other groups were treated with 2，4-dinitrochlorobenzene （DNCB） to establish an ACD model. After respective administration， the skin lesion of the mice was scored， and the histopathological changes of the skin were stained with hematoxylin-eosin （HE）. Enzyme-linked immunosorbent assay （ELISA） was used to detect the levels of interleukin-6 （IL-6）， interleukin-1β （IL-1β）， reactive oxygen species （ROS）， superoxide dismutase （SOD） activity， and malondialdehyde （MDA） in serum of mice. The expression of Nrf2/HO-1/NF-κB signaling pathway-related proteins in mouse skin tissue was detected by immunohistochemistry （IHC）， Western blot， and real-time fluorescence quantitative polymerase chain reaction （Real-time PCR）. ResultsCompared with the blank group， the mice in the model group had an increased skin lesion score （P<0.01）， severe pathological damage to skin tissue， increased content of IL-1β， IL-6， ROS， and MDA in their serum （P<0.01）， and decreased content of SOD （P<0.01）. In addition， the mRNA and protein expression levels of Nrf2， HO-1， and nuclear factor-κB inhibitor α （IκBα） in skin tissue were up-regulated （P<0.01）， while the protein expression levels of phosphorylated （p）-IκBα and p-NF-κB p65 and the mRNA expression of NF-κB p65 were down-regulated （P<0.01）. Compared with the model group and the blank matrix cream group， the mice treated with Portulacae Herba had a decreased skin lesion score （P<0.01）， reduced pathological damage to skin tissue， decreased content of IL-1β， IL-6， ROS， and MDA in their serum （P<0.01）， and increased content of SOD （P<0.01）. Additionally， the mRNA and protein expression levels of Nrf2， HO-1， and IκBα in skin tissue were down-regulated （P<0.05，P<0.01）， and the protein expression levels of p-IκBα and p-NF-κB p65 and the mRNA expression of NF-κB p65 were up-regulated （P<0.05，P<0.01）. Compared with the Portulacae Herba + inhibitor group， the high-dose Portulacae Herba cream group had a decreased skin lesion score （P<0.01）， alleviated pathological damage to skin tissue， decreased content of IL-1β， IL-6， ROS， and MDA in the serum of mice （P<0.05，P<0.01）， and increased content of SOD （P<0.01）. The protein expression levels of Nrf2， HO-1， and IκBα and the mRNA expression of Nrf2 and HO-1 in skin tissue were up-regulated （P<0.05，P<0.01）， and the protein expression levels of p-IκBα and p-NF-κB p65 and the mRNA expression of NF-κB p65 were down-regulated （P<0.05）. ConclusionPortulacae Herba can improve DNCB-induced ACD skin damage in mice by regulating the Nrf2/HO-1/NF-κB signaling pathway.

Objective To systematically evaluate the risk prediction models for anastomotic leakage (AL) in patients with esophageal cancer after surgery. Methods A computer-based search of PubMed, EMbase, Web of Science, Cochrane Library, Chinese Medical Journal Full-text Database, VIP, Wanfang, SinoMed and CNKI was conducted to collect studies on postoperative AL risk prediction model for esophageal cancer from their inception to October 1st, 2023. PROBAST tool was employed to evaluate the bias risk and applicability of the model, and Stata 15 software was utilized for meta-analysis. Results A total of 19 literatures were included covering 25 AL risk prediction models and 7373 patients. The area under the receiver operating characteristic curve (AUC) was 0.670-0.960. Among them, 23 prediction models had a good prediction performance (AUC>0.7); 13 models were tested for calibration of the model; 1 model was externally validated, and 10 models were internally validated. Meta-analysis showed that hypoproteinemia (OR=9.362), postoperative pulmonary complications (OR=7.427), poor incision healing (OR=5.330), anastomosis type (OR=2.965), preoperative history of thoracoabdominal surgery (OR=3.181), preoperative diabetes mellitus (OR=2.445), preoperative cardiovascular disease (OR=3.260), preoperative neoadjuvant therapy (OR=2.977), preoperative respiratory disease (OR=4.744), surgery method (OR=4.312), American Society of Anesthesiologists score (OR=2.424) were predictors for AL after esophageal cancer surgery. Conclusion At present, the prediction model of AL risk in patients with esophageal cancer after surgery is in the development stage, and the overall research quality needs to be improved.

This article combined the pathogenic characteristics of "latent wind" with the theory of collateral diseases to clarify the pathological features of tumor blood vessels， including their active proliferation， high permeabi-lity， and promotion of metastasis. The theory framework of "latent wind in collaterals" as the tumor mechanism was proposed， which suggests that at the site of tumor lesions， the collaterals inherit the nature of latent wind to grow excessively， adopt an open and discharge nature to leak essence， and tumor toxins， characterized by their rapid movement and frequent changes， spread and metastasize， driving the progression of malignant tumors. Focusing on the fundamental pathogenesis of "latent wind in collaterals"， specific clinical treatment principles and methods centered on treating wind are proposed， including regulating qi and dispelling wind， clearing heat and extinguishing wind， unblocking collaterals and expelling wind， and reinforcing healthy qi to calm wind， so as to provide references for enhancing the precision of traditional Chinese medicine in treating malignant tumors.

AIM: To compare the control effect of spherical and toric orthokeratology on low-to-moderate myopia with astigmatism(-1.00--1.50 DC)in adolescents.METHODS: The clinical data of 119 cases(119 eyes)of low-to-moderate myopia with astigmatism(-1.00--1.50 DC)adolescents who were treated and fitted with orthokeratology in the ophthalmology department of Sichuan Provincial People's Hospital from June 2021 to January 2022 were retrospectively analyzed. They were divided into spherical group, with 65 cases(65 eyes), and toric group, with 54 cases(54 eyes)according to the type of orthokeratology. The changes of uncorrected visual acuity(UCVA), axial length and corneal astigmatism before and after wearing lenses were recorded to evaluate the therapeutic effect.RESULTS: The UCVA of both the groups significantly improved at 1 and 2 a after wearing lenses(all P<0.01); corneal astigmatism decreased, but there was no significant difference(all P>0.05); the axial length was longer than that before wearing lenses(P<0.01). There were no statistical significant differences in the UCVA and corneal astigmatism between the spherical group and the toric group(Fintergroup=0.829,Pintergroup=0.364; Fintergroup=0.997,Pintergroup=0.320); and there were no statistical significant differences in the axial length growth between the spherical group and the toric group after wearing lenses for 1 a(0.18±0.11 mm vs 0.17±0.14 mm), and 2 a(0.17±0.10 mm vs 0.16±0.10 mm; all P>0.05).CONCLUSION: Both orthokeratology lenses can improve the UCVA, reduce corneal astigmatism, and delay axial length growth of adolescents with low-to-moderate myopia with astigmatism(-1.00--1.50 DC), and there are no significant differences in the control effect of spherical design orthokeratology and the toric design orthokeratology on myopia.

Reasonable and standardised placebo setting for acupoint application pastes is a key factor for clinical trials to verify the safety and effectiveness of acupoint application. By sorting out the current design status of placebo in the allocation concealment and blind design， paste components， paste location， paste duration in the current clinical trials of acupoint application pastes， it is proposed that there are problems such as low application rate of blinding and non-standardised reporting， insufficient standardisation of placebo settings and lack of systematic research， and lack of uniform standards of the placebo evaluation method. Based on the action mechanism of acupoint application， the idea of setting placebo for acupoint application paste is proposed in terms of replacing the application material， controlling the physicochemical effect produced by transdermal absorption of drugs， and setting the permeability of placebo， in order to enrich the methodological content of the placebo setting for acupoint application， and providing more scientific and reliable clinical evidence of acupoint application.

ObjectiveTo evaluate the effects of phases on the pharmacokinetic behavior of seven components from Banxia Xiexintang（BXT） in normal rats by investigating and comparing their pharmacokinetic profiles in different phase samples. MethodsThe phase separation of BXT was carried out by centrifugation-dialysis method， and three phase samples were obtained， including the precipitated phase（PP）， colloidal phase（CP） and true solution phase（TP）. A total of 24 male SD rats were randomly divided into BXT， PP， CP and TP groups（n=6）. The BXT group was gavaged at a dose of 24.1 g·kg^-1（calculated by the dosage of raw materials）. After proper treatments， PP， CP and TP groups were administrated at the same dose as that of BXT group， respectively. Blood was collected from each group at set time points after gavage of BXT and the phase samples. The contents of 7 components（baicalin， wogonoside， wogonin， berberine， palmatine， ammonium glycyrrhizinate and isoliquiritin） in rat plasma were determined by ultra-high performance liquid chromatography-triple quadrupole tandem mass spectrometry（UPLC-QqQ-MS/MS）， and the pharmacokinetic parameters of each component were analyzed by DAS 2.0. ResultsThe peak concentration of baicalin was the highest among the blood-entered components in each group， followed by wogonoside. The results of the concentration-time curves and pharmacokinetic parameters of the 7 components showed that the area under the concentration-time curve（AUC） of isoliquiritin in the BXT group was the highest， followed by that in the CP group. AUC values of baicalin， wogonoside， wogonin and ammonium glycyrrhizinate in the BXT group were similar to those of the CP group， and AUC of palmatine in the BXT group was similar to that of the PP group. The elimination half-life（t_1/2） values of baicalin and wogonoside in the BXT group was the longest， the t_1/2 values of ammonium glycyrrhizinate and berberine were similar to those of the CP group， and the t_1/2 of palmatine was similar to that of the PP group. The t_1/2 of wogonin was the longest in the PP group， and the t_1/2 of isoliquiritin was the longest in the TP group was the longest， which was similar to that in the PP group. Except for isoliquiritin， the other 6 components showed double peaks in the concentration-time curve of the PP group， indicating that the above components might be reabsorbed through the enterohepatic circulation in vivo， which resulted in the maintenance of high plasma concentrations for a long time， and consequently exhibited sustained-release properties. ConclusionThe pharmacokinetic characteristics of the components in different phases were different， and the CP phase may be the effective phase from the perspective of the pharmacological action of BXT. Compared with the BXT group， the in vivo action times of some components in the CP and PP groups were prolonged. The study explores the phase differences of traditional Chinese medicine（TCM） compound decoction in the aspect of pharmacokinetics， and verifies that the phase states from TCM compound decoction will affect the pharmacokinetic behaviors of the active components， which may consequently lead to the difference in in vivo effects.

ObjectiveTo investigate the ameliorative effect of paeonol on acute alcohol-induced hepatic inflammation in mice via the regulation of the short-chain fatty acids （SCFAs）-specific receptor GPR43/mitogen-activated protein kinase （MAPK） signaling pathway. MethodsC57BL/6 mice were randomly divided into five groups： blank control group， model group， low-dose paeonol group （120 mg·kg^-1）， high-dose paeonol group （480 mg·kg^-1）， and silybin group （36.8 mg·kg^-1）. A mouse model of alcohol-induced liver disease （ALD） was established by ad libitum administration of a Lieber-DeCarli alcohol liquid diet. Serum lipid levels， liver function， inflammatory cytokines， and oxidative stress markers were measured. Liver hematoxylin-eosin （HE） staining and Oil Red O staining were performed to validate successful modeling. Western blot analysis was used to assess the expression levels of zonula occludens-1 （ZO-1）， Claudin-1， and proteins related to the GPR43/MAPK signaling pathway in the colonic tissue. Immunohistochemistry was employed to detect the protein expression of GPR43， ZO-1， and Claudin-1 in the colon. Then 16S rDNA sequencing was performed to analyze differences in intestinal flora between the model group and the high-dose paeonol group. Additionally， fecal microbiota transplantation （FMT） experiments were conducted to validate the regulatory effect of paeonol on ALD via modulation of intestinal flora. ResultsCompared with the blank control group， the model group showed significantly elevated serum lipid levels， oxidative stress， and inflammatory cytokine expression （P<0.01）. Liver histology revealed increased inflammatory infiltration and lipid droplet accumulation. Colonic mucosal injury and impaired intestinal barrier function were observed. Levels of MAPK pathway-related proteins in the colonic tissue were upregulated （P<0.01）， while GPR43， ZO-1， and Claudin-1 protein expression levels were significantly decreased （P<0.01）. The composition and abundance of the intestinal flora were markedly altered， with a reduced Bacteroidetes-to-Firmicutes ratio and decreased relative abundances of Eubacterium， Parabacteroides， Erysipelothrix， and Adlercreutzia， alongside increased abundances of Clostridium butyricum， Enterococcus， and Helicobacter pylori in the model group. Compared with the model group， paeonol significantly reduced serum lipid levels， oxidative stress responses， and the expression of inflammatory cytokines in ALD mice （P<0.05， P<0.01）. It also attenuated hepatic lipid accumulation， restored intestinal barrier function， and repaired the structural integrity of liver and colonic tissues. The protein expression levels of ZO-1， Claudin-1， and GPR43 in the colonic tissue were significantly increased （P<0.05， P<0.01）， while those of MAPK pathway-related proteins were significantly decreased （P<0.05， P<0.01）. The intestinal flora dysbiosis was effectively alleviated， rendering its composition closer to that of normal mice. The efficacy of paeonol in modulating ALD was further confirmed by FMT experiments， supporting its mechanistic involvement in the SCFAs-GPR43/MAPK signaling pathway. ConclusionPaeonol exerts a protective effect against ALD in mice， which may be mediated through regulation of the SCFAs-GPR43/MAPK signaling pathway， thereby achieving anti-inflammatory effects and improving intestinal barrier function.

With the widespread adoption of low-dose CT screening and the extensive application of high-resolution CT, the detection rate of sub-centimeter lung nodules has significantly increased. How to scientifically manage these nodules while avoiding overtreatment and diagnostic delays has become an important clinical issue. Among them, lung nodules with a consolidation tumor ratio less than 0.25, dominated by ground-glass shadows, are particularly worthy of attention. The therapeutic challenge for this group is how to achieve precise and complete resection of nodules during surgery while maximizing the preservation of the patient's lung function. The "watershed topography map" is a new technology based on big data and artificial intelligence algorithms. This method uses Dicom data from conventional dose CT scans, combined with microscopic (22-24 levels) capillary network anatomical watershed features, to generate high-precision simulated natural segmentation planes of lung sub-segments through specific textures and forms. This technology forms fluorescent watershed boundaries on the lung surface, which highly fit the actual lung anatomical structure. By analyzing the adjacent relationship between the nodule and the watershed boundary, real-time, visually accurate positioning of the nodule can be achieved. This innovative technology provides a new solution for the intraoperative positioning and resection of lung nodules. This consensus was led by four major domestic societies, jointly with expert teams in related fields, oriented to clinical practical needs, referring to domestic and foreign guidelines and consensus, and finally formed after multiple rounds of consultation, discussion, and voting. The main content covers the theoretical basis of the "watershed topography map" technology, indications, operation procedures, surgical planning details, and postoperative evaluation standards, aiming to provide scientific guidance and exploration directions for clinical peers who are currently or plan to carry out lung nodule resection using the fluorescent microscope watershed analysis method.

Surgical treatment is one of the key approaches for non-small cell lung cancer (NSCLC). Regular postoperative follow-up is crucial for early detection and timely management of tumor recurrence, metastasis, or second primary tumors. A scientifically sound and reasonable follow-up strategy not only extends patient survival but also significantly improves quality of life, thereby enhancing overall prognosis. This consensus aims to build upon the previous version by incorporating the latest clinical research advancements and refining postoperative follow-up protocols for early-stage NSCLC patients based on different treatment modalities. It provides a scientific and practical reference for clinicians involved in the postoperative follow-up management of NSCLC. By optimizing follow-up strategies, this consensus seeks to promote the standardization and normalization of lung cancer diagnosis and treatment in China, helping more patients receive high-quality care and long-term management. Additionally, the release of this consensus is expected to provide insights for related research and clinical practice both domestically and internationally, driving continuous development and innovation in the field of postoperative management for NSCLC.