AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveThe exacerbating trend of global population aging poses profound socioeconomic and public health challenges, making the comprehensive elucidation of biological aging mechanisms and the discovery of effective anti-aging interventions an urgent priority in the life sciences. Based on our previous serum metabolomics findings that dimethylglycine, an intermediate metabolite of amino acid metabolism naturally present in the human body, was significantly enriched in the serum of longevity families, this study aimed to systematically investigate the anti-aging effects of dimethylglycine both in living organisms and in controlled laboratory environments, and to preliminarily elucidate its underlying molecular mechanisms. While existing literature indicates that dimethylglycine possesses antioxidant and immunomodulatory properties, its direct anti-aging efficacy and the specific molecular pathways through which it operates remain largely unexplored. MethodsTo comprehensively evaluate the anti-aging properties of dimethylglycine, we utilized replicative senescent human embryonic lung fibroblasts, specifically the WI-38 cell line, as an experimental model in a controlled laboratory environment. Cell viability and safety were thoroughly assessed using Cell Counting Kit-8 and lactate dehydrogenase release assays across various concentrations of dimethylglycine. The impact of dimethylglycine on cellular senescence phenotypes, oxidative stress, and proliferative capacity was evaluated via senescence-associated beta-galactosidase staining, reactive oxygen species fluorescence detection, and 5-ethynyl-2'-deoxyuridine incorporation assays. Furthermore, the molecular alterations of senescence-associated secretory phenotype factors and core senescence signaling pathways were quantified using quantitative reverse transcription polymerase chain reaction for the messenger RNA levels of interleukin-6, interleukin-8, p21, and matrix metalloproteinase-1, and enzyme-linked immunosorbent assay for the measurement of p16 and p21 protein expression levels. For the living organism model, the wild-type nematode Caenorhabditis elegans was used to evaluate systemic physiological effects. We conducted a comprehensive lifespan analysis at 20°C, heat stress resistance survival assays at 35℃, senescence-associated beta-galactosidase staining, lipofuscin accumulation tracking, intracellular reactive oxygen species measurement, and Oil Red O staining to ascertain systemic lipid accumulation. Additionally, network pharmacology bioinformatics tools, including PharmMapper and STRING databases, and Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis were utilized to predict target pathways, alongside highly detailed molecular docking simulations utilizing SwissDock and Protein-Ligand Interaction Profiler to examine interactions with the cytochrome P450 family 2 subfamily C member 9 protein. ResultsThe experimental outcomes robustly demonstrate the potent anti-aging capabilities of dimethylglycine. At the cellular level, toxicity analyses firmly confirmed that dimethylglycine is highly safe; continuous treatment with 50 mol/L and 70 mol/L of dimethylglycine for 5 d did not induce any cellular membrane damage or cytotoxicity, but rather actively promoted cellular proliferation. Utilizing the optimal standardized concentration of 50 mol/L, dimethylglycine treatment significantly ameliorated senescent phenotypic markers in human embryonic lung fibroblasts, which was evidenced by a drastic and highly significant reduction in the senescence-associated beta-galactosidase positive cell percentage (P<0.000 1) and intracellular reactive oxygen species levels (P<0.000 1), alongside a marked increase in the 5-ethynyl-2'-deoxyuridine-positive proliferation rate (P=0.003 5). On a molecular expression scale, dimethylglycine significantly downregulated the messenger RNA expression of multiple core senescence-associated secretory phenotype inflammatory factors, including interleukin-6, interleukin-8, p21, and matrix metalloproteinase-1. Concurrently, it effectively suppressed the protein expression of critical cell cycle arrest markers, diminishing p16 protein levels by 57.3% (P=0.000 4) and p21 protein levels by 27.2% (P=0.000 7). In the nematode Caenorhabditis elegans animal model, dimethylglycine significantly extended the mean lifespan from 20.402 d to an impressive 23.066 d (P<0.000 1) and notably enhanced overall survival rates under severe heat stress environmental conditions (P=0.017). Furthermore, systemic dimethylglycine intervention significantly mitigated age-related physiological decline by decreasing bodily lipofuscin accumulation (P<0.000 1), significantly reducing senescence-associated beta-galactosidase activity, lowering systemic reactive oxygen species fluorescence (P=0.008), and effectively alleviating overall fat accumulation (P<0.000 1). Mechanistically, extensive network pharmacology and Kyoto Encyclopedia of Genes and Genomes analyses strongly revealed that the potential targets of dimethylglycine are significantly enriched in fundamental drug metabolism and oxidative stress response pathways. Precision molecular docking simulations conclusively demonstrated that dimethylglycine forms highly stable structural interactions with the cytochrome P450 family 2 subfamily C member 9 protein, specifically highlighting the definitive formation of 5 stable hydrogen bonds involving serine 365, leucine 366, and serine 429 residues, as well as two critical salt bridge formations with arginine 97 and histidine 368 residues. It is additionally predicted to interact favorably with glutathione S-transferase family proteins. ConclusionDimethylglycine exhibits a profoundly significant and multifaceted anti-aging activity at both the cellular and entire living animal levels. By powerfully alleviating oxidative stress, heavily suppressing the core p16 and p21-dependent cellular senescence signaling pathways, and substantially mitigating the detrimental senescence-associated secretory phenotype, dimethylglycine effectively delays fundamental cellular senescence processes and drastically extends whole-organism lifespan. The biological mechanisms driving these robust protective effects are highly likely closely associated with its direct stable interactions with crucial metabolic and detoxifying enzyme systems, such as cytochrome P450 family 2 subfamily C member 9 and glutathione S-transferase family proteins, thereby systemically improving metabolic dysregulation and restoring critical redox homeostasis. This comprehensive study provides highly solid experimental evidence supporting dimethylglycine as a highly potent and safe potential anti-aging intervention agent, while simultaneously offering a clear molecular mechanistic explanation for the previously documented high abundance of dimethylglycine observed within exceptionally long-lived human populations.

BACKGROUND:Pearl powder is rich in many active ingredients,which can promote the proliferation and migration of fibroblasts,thus promoting wound healing and skin tissue regeneration.However,the effect of nano-pearl powder water-soluble matrix on proliferation,migration and apoptosis of mouse fibroblasts L929 has not been reported.OBJECTIVE:To investigate the effect of nano-pearl powder water-soluble matrix on the proliferation,migration and apoptosis of mouse fibroblasts L929.METHODS:Passage 6 L929 cells were divided into five groups.The negative control group did not add any material;the positive control group added PBS,and the low,medium and high mass concentration groups of water-soluble matrix were added with 10,25 and 40 μg/mL of nano-pearl powder water-soluble matrix,respectively.The proliferation of L929 cells was detected by MTT assay.The migration ability of L929 cells was detected by Transwell.The apoptosis rate of L929 cells was detected by flow cytometry.The expressions of apoptosis-related proteins Bax,Bcl-2,and Caspase-1 were detected by western blot assay.RESULTS AND CONCLUSION:(1)The results of MTT assay and Transwell chamber experiment showed that the water-soluble matrix of nano-pearl powder could promote the proliferation and migration of L929 cells,and it was concentration dependent.(2)Flow cytometry and western blot assay results showed that the water-soluble matrix of nano-pearl powder could reduce the apoptosis rate of L929 cells and the protein expression of Bax and Caspase-1,and increase the expression of Bcl-2 protein,and it was concentration dependent.(3)These findings exhibited that the water-soluble matrix of nano-pearl powder could inhibit cell apoptosis under high mass concentration treatment.The results show that the water-soluble matrix of nano-pearl powder can promote the proliferation and migration of fibroblasts and inhibit the apoptosis of fibroblasts.

BACKGROUND:Although previous studies have reported associations between lipids and the risk of osteoporotic pathological fractures,the specific causal relationships between lipid level and osteoporotic pathological fractures remain unclear.OBJECTIVE:To elucidate the causal relationship between lipids and osteoporotic pathological fractures using a two-sample bidirectional Mendelian randomization analysis.METHODS:The data for 178 lipid metabolites were obtained from the IEU-GWAS database(developed by the MRC Integrative Epidemiology Unit at the University of Bristol,UK,which provides extensive summary data from genome-wide association studies),while osteoporotic pathological fracture data(from 173 619 European participants)were acquired from the FinnGen database(constructed by the Finnish national gene research program,focusing on investigating relationships between genomics and health/disease in the Finnish population).Osteoporotic pathological fracture data were used as the outcome variable,with lipids serving as exposures,for the bidirectional Mendelian randomization study to evaluate the causal effects of different lipids on osteoporotic pathological fractures.The UK Biobank database was employed as a validation set by switching the outcome variable to verify the findings horizontally.RESULTS AND CONCLUSION:(1)The inverse variance weighted analysis indicated that each unit increase in sterol ester(27∶1/20∶2)levels was associated with a 25.55％increase in the risk of osteoporotic pathological fractures(odds ratio=1.256,95％confidence interval:1.001-1.575,P=0.049),suggesting a significant positive correlation between elevated sterol ester levels and increased fracture risk.Reverse Mendelian randomization analysis revealed a significant negative association between osteoporotic pathological fractures and three types of phosphatidylcholine.Horizontal validation yielded consistent results,confirming sterol ester as a risk factor for osteoporotic pathological fractures.(2)The results indicate that sterol ester is a risk factor for osteoporotic pathological fractures,while phosphatidylcholine serves as a protective factor.These findings strengthen the evidence supporting the effect of lipids on the risk of osteoporotic pathological fractures.Although the GWAS data used in this study were derived from European populations,given the broad commonality of human genetics,the results provide valuable reference significance for improving osteoporosis in Chinese populations through lipid regulation.

Thyroid-associated ophthalmopathy(TAO)is a common autoimmune complication in thyroid diseases. Its pathogenesis is complex and involves the abnormal activation of multiple signaling pathways. With the rapid development of molecular biology and genomics technologies, the signal transduction mechanisms and regulatory networks related to TAO have been deeply analyzed. At present, studies have found that the interaction between the TSH receptor(TSHR)and the insulin-like growth factor-1 receptor(IGF-1R)signaling pathway, as well as immune inflammation-related pathways, oxidative stress, and calcium signaling pathways, play important roles in the pathogenesis of TAO. In addition, the research on the regulatory mechanism of non-coding RNA and fibrosis-related signaling molecules has gradually become the focus. Despite much advancement, there are still many unsolved mysteries regarding the exact pathogenesis of TAO. This article aims to systematically review the latest research progress of the main signaling pathways of TAO. By combining the latest achievements in gene expression profiles, single-cell sequencing and drug design, it analyzes potential therapeutic targets and the development directions of innovative drugs, providing a theoretical basis for the pathological mechanism of TAO and a scientific basis for the optimization of clinical treatment strategies at the same time.

Lung cancer is a leading cause of cancer-related morbidity and mortality worldwide. Coupled with the substantial workload, the clinical management of lung cancer is challenged by the critical need to efficiently and accurately process increasingly complex medical information. In recent years, large language models (LLMs) technology has undergone explosive development, demonstrating unique advantages in handling complex medical data by leveraging its powerful natural language processing capabilities, and its application value in the field of lung cancer diagnosis and treatment is continuously increasing. The paper systematically analyzes that the exceptional potential of LLMs in lung cancer auxiliary diagnosis, tumor feature extraction, automatic staging, progression/outcome analysis, treatment recommendations, medical documentation generation, and patient education. However, they face critical technical and ethical challenges including inconsistent performance in complex integrated decision-making (e.g., TNM staging, personalized treatment suggestions) and "black box" opacity issues, along with dilemmas such as training data biases, model hallucinations, data privacy concerns, and cross-lingual adaptation challenges ("data colonization"). Future directions should prioritize constructing high-quality multimodal corpora specific to lung cancer, developing interpretable and compliant specialized models, and achieving seamless integration with existing clinical workflows. Through dual drivers of technological innovation and ethical standardization, LLMs should be prudently advanced for holistic lung cancer management processes, ultimately promoting efficient, standardized, and personalized diagnosis and treatment practices.

Objective: To identify the latent class characteristics of health literacy and related factors among junior high school students, so as to provide evidence for developing precise and systematic health literacy promotion strategies. Methods: In November 2024, a two stage random cluster sampling method was used to conduct a questionnaire survey among 8 933 junior high school students in Zhongshan. Health literacy was assessed across six dimensions: health behavior and lifestyle, disease prevention and control, mental health, growth development and puberty health, safety emergency and risk avoidance, and medical knowledge and appropriate healthcare utilization. Latent profile analysis was used to identify distinct health literacy classes, and multinomial Logistic regression was applied to analyze the related factors. Results: Three latent classes of health literacy among junior high school students were identified: the well balanced type(71.7%，6 406), the medical knowledge deficit type(22.3%，1 992), and the overall low literacy type(6.0%，537). Logistic regression analysis showed that girls had lower risks of belonging to the medical knowledge deficit type( OR =0.53, 95% CI =0.48-0.59) and the overall low literacy type( OR =0.27,95% CI =0.22-0.33) compared with boys(both P <0.05). Students in rural schools had the highest risks of belonging to these two profiles above [ OR (95% CI ) =1.89 (1.61-2.21), 3.18 (2.50-4.06),both P <0.05]. Junior high school students having ≥2 siblings were positively associated with belonging to these two profiles, with risks 1.60 (95% CI = 1.35-1.89) and 2.25 times (95% CI =1.66-3.05) higher than those of only children (both P <0.05). Junior high school students with parental education of bachelor s degree or above were associated with lower risk of belonging to the medical knowledge deficit type (father: OR =0.63, 95% CI =0.47-0.84; mother: OR =0.68, 95% CI = 0.52 -0.90,both P <0.05). Junior high school students with receiving health education courses ≥3 times per month were associated with lower risks of belonging to both the medical knowledge deficit type and overall low literacy type ( OR =0.51, 95% CI =0.43- 0.60 ; OR =0.33, 95% CI =0.25-0.42, both P <0.05). Conclusions Three latent classes of health literacy exist among junior high school students in Zhongshan. Targeted interventions should be implemented based on profile characteristics, with an emphasis on strengthening medical knowledge education and providing comprehensive support for vulnerable groups.

ObjectiveTo analyze the development status and research frontiers of repetitive peripheral magnetic stimulation (rPMS) in rehabilitation therapy. MethodsRelevant literatures on rPMS in rehabilitation therapy were retrieved from CNKI, Wanfang data, VIP and Web of Science Core Collection from January, 2005 to December, 2024. CiteSpace 6.4.R1 and VOSviewer 1.6.20 were used for visualization analysis. ResultsA total of 202 publications were included, 81 in Chinese and 121 in English, with an overall increasing trend in annual publications. Japan had the highest number of English publications, while Germany demonstrated the highest centrality. The most productive institution in Chinese publications was Huashan Hospital Affiliated to Fudan University, with the most prolific authors being Xu Liang, Cai Qian and Ma Ming. For English publications, Technical University of Munich was the most productive institution, Schneider Cyril was the most productive author, and Clinical Neurophysiology was the most influential journal. Hotspot keywords in both Chinese and English publications included stroke, spasticity, repetitive transcranial magnetic stimulation, dysphagia, motor function, pain and plasticity, etc. The most bursting words in Chinese and English publications were spasticity and pain, respectively. ConclusionResearches on rPMS in rehabilitation therapy show steady growth, primarily focusing on functional rehabilitation for neurological diseases such as stroke and cerebral palsy, as well as the treatment of painful diseases including low back pain.

ObjectiveTo analyze the development status and research frontiers of repetitive peripheral magnetic stimulation (rPMS) in rehabilitation therapy. MethodsRelevant literatures on rPMS in rehabilitation therapy were retrieved from CNKI, Wanfang data, VIP and Web of Science Core Collection from January, 2005 to December, 2024. CiteSpace 6.4.R1 and VOSviewer 1.6.20 were used for visualization analysis. ResultsA total of 202 publications were included, 81 in Chinese and 121 in English, with an overall increasing trend in annual publications. Japan had the highest number of English publications, while Germany demonstrated the highest centrality. The most productive institution in Chinese publications was Huashan Hospital Affiliated to Fudan University, with the most prolific authors being Xu Liang, Cai Qian and Ma Ming. For English publications, Technical University of Munich was the most productive institution, Schneider Cyril was the most productive author, and Clinical Neurophysiology was the most influential journal. Hotspot keywords in both Chinese and English publications included stroke, spasticity, repetitive transcranial magnetic stimulation, dysphagia, motor function, pain and plasticity, etc. The most bursting words in Chinese and English publications were spasticity and pain, respectively. ConclusionResearches on rPMS in rehabilitation therapy show steady growth, primarily focusing on functional rehabilitation for neurological diseases such as stroke and cerebral palsy, as well as the treatment of painful diseases including low back pain.

ObjectiveTo evaluate the public health governance capacity in Jiangsu Province and provide an optimized pathway for the construction of a “strong, rich, beautiful, and high-quality” new Jiangsu. MethodsA total of 806 policy documents, 658 public information reports, and 148 research literatures related to public health governance capacity in Jiangsu Province from January 1995 to December 2023 were collected. The status of current public health goverance was assessed based on the evaluation criteria suitable for public health systems, and the strengths and the weaknesses of the system were identified. ResultsThe public health governance capability of Jiangsu Province was scored at 738.3 points, ranking 3rd nationally. Maternal health care and emergency response capacities achieved leading positions nationwide, both ranking 2nd. Jiangsu had exhibited a standardized guidance in the strategic level, a well-established management mechanism, an extensive coverage in information collection, and a scientifically established health targets setting. However, bottlenecks remained, including an unclear division of responsibilities across organizational departments, an insufficient public-health workforce, the absence of a stable growth mechanism for government funding investment, and difficulties in promptly identifying public needs. ConclusionJiangsu’s public-health system demonstrates leading nationally, yet several components remain underdeveloped. Future efforts should consolidate advantages while addressing weaknesses, further diversify content and forms, establish a stable funding increase mechanism, and clarify departmental functions, thereby providing solid health support for realizing the developmental goals of a “strong, rich, beautiful and high-quality” new Jiangsu.