1.Analysis of PDK1 gene variants and prenatal diagnosis for eight pedigrees affected with autosomal dominant polycystic kidney disease.
Huijun LI ; Peixuan CAO ; Xiangyu ZHU ; Yujie ZHU ; Xing WU ; Jie LI
Chinese Journal of Medical Genetics 2022;39(9):932-937
OBJECTIVE:
To detect potential variants in eight Chinese pedigrees affected with autosomal dominant polycystic kidney disease (ADPKD) and provide prenatal diagnosis for two of them.
METHODS:
Whole exome sequencing and high-throughput sequencing were carried out to detect variants of PKD1 and PKD2 genes in the probands. Sanger sequencing was used to validate the variants, and their pathogenicity was predicted by searching the ADPKD and protein variation databases.
RESULTS:
Eight PKD1 variants were detected, which have included five nonsense mutations and three missense mutations. Among these, four nonsense variants (PKD1: c.7555C>T, c.7288C>T, c.4957C>T, c.11423G>A) were known to be pathogenic, whilst one missense variant (PKD1: c.2180T>G) was classified as likely pathogenic. Three novel variants were detected, which included c.6781G>T (p.Glu2261*), c.109T>G (p.Cys37Gly) and c.8495A>G (p.Asn2832Ser). Prenatal testing showed that the fetus of one family has carried the same mutation as the proband, while the fetus of another family did not.
CONCLUSION
PKD1 variants, including three novel variants, have been identified in the eight pedigrees affected with ADPKD. Based on these results, prenatal diagnosis and genetic counseling have been provided.
DNA Mutational Analysis/methods*
;
Female
;
Humans
;
Mutation
;
Pedigree
;
Polycystic Kidney, Autosomal Dominant/genetics*
;
Pregnancy
;
Prenatal Diagnosis
;
TRPP Cation Channels/genetics*
2.Genetic diagnosis and prenatal diagnosis of autosomal dominant polycystic kidney disease.
Chinese Journal of Medical Genetics 2019;36(5):419-423
OBJECTIVE:
To explore the genetic etiology for 17 pedigrees affected with autosomal dominant polycystic kidney disease (ADPKD).
METHODS:
Peripheral blood samples were derived from the probands and their parents with informed consent. Following DNA extraction, targeted capture and next generation sequencing were carried out in search for potential disease-causing variants. Sanger sequencing was used to validate candidate pathogenic variants co-segregating with the disease in each pedigree. Prenatal diagnosis was provided for one family.
RESULTS:
Among the 17 probands, 14 PKD1 mutations and 3 PKD2 mutations were detected, which included 6 missense mutations, 4 nonsense mutations and 7 frameshift mutations. Of these, 8 have been associated with ADPKD previously and 9 were novel, which included c.7625G>T (p.Gly2542Val), c.3673C>T (p.Gln1225*), c.11048dupT (p.Thr3684Aspfs*38), c.9083_9084delAG (p.Glu3028Glyfs*40), c.10560delG (p.Pro3521Hisfs*6), c.7952_7974del TGTCCCTGAGGGTCCACACTGTG (p.Val2651Glyfs*2) of PKD1, and c.662T>G (p.Leu221*), c.1202_1203 insCT (p.Glu401Aspfs*2), and c.919 delA (p.Ser307Valfs*10) of PKD2. Prenatal testing showed that the fetus did not carry the same mutation as the proband.
CONCLUSION
Identification of causative mutations in the 17 pedigrees affected with ADPKD has provided a basis for genetic counseling and reproductive guidance. The novel findings have enriched the mutational spectrum of the PKD1 and PKD2 genes.
DNA Mutational Analysis
;
Female
;
Humans
;
Mutation
;
Pedigree
;
Polycystic Kidney, Autosomal Dominant
;
Pregnancy
;
Prenatal Diagnosis
;
TRPP Cation Channels
3.Preimplantation genetic diagnosis for infertile males with autosomal dominant polycystic kidney disease.
Xiao-Yu YANG ; Tao LI ; Xiao-Jun LIU ; Jian-Dong SHEN ; Yu-Gui CUI ; Gui-Rong ZHANG ; Jia-Yin LIU
National Journal of Andrology 2018;24(5):409-413
ObjectiveAutosomal dominant polycystic kidney disease (ADPKD) is one of the most common genetic renal diseases, which may cause oligoasthenospermia and azoospermia and result in male infertility. This study aimed to analyze the outcomes of preimplantation genetic diagnosis (PGD) in male patients with ADPKD-induced infertility.
METHODSWe retrospectively analyzed the clinical data on 7 male patients with ADPKD-induced infertility undergoing PGD from April 2015 to February 2017, including 6 cases of oligoasthenospermia and 1 case of obstructive azoospermia, all with the PKD1 gene heterozygous mutations. Following intracytoplasmic sperm injection (ICSI), we performed blastomere biopsy after 5 or 6 days of embryo culture and subjected the blastomeres to Sureplex whole-genome amplification, followed by haplotype linkage analysis, Sanger sequencing, array-based comparative genomic hybridization to assess the chromosomal ploidy of the unaffected embryos, and identification of the unaffected euploid embryos for transfer.
RESULTSOne PGD cycle was completed for each of the 7 patients. Totally, 26 blastocysts were developed, of which 12 were unaffected and diploid. Clinical pregnancies were achieved in 6 cases following 7 cycles of frozen embryo transplantation, which included 5 live births and 1 spontaneous abortion.
CONCLUSIONSFor males with ADPKD-induced infertility, PGD may contribute to high rates of clinical pregnancy and live birth and prevent ADPKD in the offspring as well. This finding is also meaningful for the ADPKD patients with normal fertility.
Abortion, Spontaneous ; genetics ; Biopsy ; Blastocyst ; Comparative Genomic Hybridization ; Embryo Transfer ; Female ; Humans ; Infertility, Male ; etiology ; genetics ; Male ; Mutation ; Polycystic Kidney, Autosomal Dominant ; complications ; diagnosis ; genetics ; prevention & control ; Pregnancy ; Pregnancy Outcome ; Preimplantation Diagnosis ; Retrospective Studies ; Sperm Injections, Intracytoplasmic
4.Femoral Neuropathy Secondary to Autosomal Dominant Polycystic Kidney Disease: A Case Report.
Jeehyun YOO ; Kil Byung LIM ; Hong Jae LEE ; Jiyong KIM ; Eun Cheol YOU ; Joongmo KANG
Annals of Rehabilitation Medicine 2018;42(3):488-493
Compressive femoral neuropathy is a disabling condition accompanied by difficulty in hip flexion and knee extension. It may result from retroperitoneal hematoma or bleeding, or from complications associated with pelvic, hip surgery, and renal transplants. A 55-year-old female with autosomal dominant polycystic kidney disease presented with proximal muscle weakness in lower extremities. The patient experienced recurrent renal cyst infection, with aggravated weakness during each event. Electromyography and nerve conduction study revealed bilateral femoral neuropathy. Computed tomography and magnetic resonance images were added to further identify the cause. As a result, a diagnosis of femoral neuropathy caused by enlarged polycystic kidney was made. Cyst infection was managed with antibiotics. Renal function was maintained by frequent regular hemodialysis. While avoiding activities that may increase abdominal pressure, rehabilitation exercises were provided. Motor strength in hip flexion and knee extension improved, and was confirmed via electrodiagnostic studies.
Anti-Bacterial Agents
;
Diagnosis
;
Electromyography
;
Exercise
;
Female
;
Femoral Neuropathy*
;
Hematoma
;
Hemorrhage
;
Hip
;
Humans
;
Knee
;
Lower Extremity
;
Middle Aged
;
Muscle Weakness
;
Neural Conduction
;
Polycystic Kidney Diseases
;
Polycystic Kidney, Autosomal Dominant*
;
Rehabilitation
;
Renal Dialysis
5.Hypokalemic Hypertension Leading to a Diagnosis of Autosomal Dominant Polycystic Kidney Disease.
Wasawat VUTTHIKRAIVIT ; Montira ASSANATHAM ; Chutintorn SRIPHRAPRADANG
Electrolytes & Blood Pressure 2016;14(1):11-15
Autosomal dominant polycystic kidney disease (ADPKD) is the most common inherited renal disease. Hypertension is common and occurs before decline in renal function. However, the coexistence of hypertension and hypokalemia is rare in ADPKD patients. We report on a 32-year-old woman with secondary aldosteronism. Magnetic resonance imaging of the renal arteries revealed multiple cysts of varying sizes in both the kidneys and the liver, compatible with ADPKD. Increased reninangiotensin-aldosterone system activity was secondary to cyst expansion. After initiation of angiotensin II receptor blocker, her blood pressure was controlled without additional requirement of potassium.
Adult
;
Angiotensin Receptor Antagonists
;
Blood Pressure
;
Diagnosis*
;
Female
;
Humans
;
Hyperaldosteronism
;
Hypertension*
;
Hypokalemia
;
Kidney
;
Liver
;
Magnetic Resonance Imaging
;
Polycystic Kidney, Autosomal Dominant*
;
Potassium
;
Receptors, Angiotensin
;
Renal Artery
6.PKD2 mutation in an Iranian autosomal dominant polycystic kidney disease family with misleading linkage analysis data.
Mona ENTEZAM ; Mohammad Reza KHATAMI ; Fereshteh SADDADI ; Mohsen AYATI ; Jamshid ROOZBEH ; Mohammad KERAMATIPOUR
Kidney Research and Clinical Practice 2016;35(2):96-101
BACKGROUND: Autosomal dominant polycystic kidney disease (ADPKD) is the most common genetic renal disorder caused by mutation in 2 genes PKD1 and PKD2. Thus far, no mutation is identified in approximately 10% of ADPKD families, which can suggest further locus heterogeneity. Owing to the complexity of direct mutation detection, linkage analysis can initially identify the responsible gene in appropriate affected families. Here, we evaluated an Iranian ADPKD family apparently unlinked to both PKD1 and PKD2 genes. This is one of the pioneer studies in genetic analysis of ADPKD in Iranian population. METHODS: Linkage reanalysis was performed by regenotyping of flanking microsatellite markers in 8 individuals of the ADPKD family. Direct mutation analysis was performed by Sanger sequencing. RESULTS: Mutation analysis revealed a pathogenic mutation (c.1094+1G>A) in the PKD2 gene in the proband. Analyzing 2 healthy and 4 clinically affected members confirmed the correct segregation of the mutation within the family and also ruled out the disease in 1 suspected individual. Misinterpretation of the linkage data was due to the occurrence of 1 crossing over between the PKD2 intragenic and the nearest downstream marker (D4S2929). Homozygosity of upstream markers caused the recombination indistinguishable. CONCLUSION: Although analysis of additive informative polymorphic markers can overcome the misleading haplotype data, it is limited because of the lack of other highly polymorphic microsatellite markers closer to the gene. Direct mutation screening can identify the causative mutation in the apparently unlinked pedigree; moreover, it is the only approach to achieve the confirmed diagnosis in individuals with equivocal imaging results.
Crossing Over, Genetic
;
Diagnosis
;
Haplotypes
;
Humans
;
Mass Screening
;
Microsatellite Repeats
;
Pedigree
;
Polycystic Kidney, Autosomal Dominant*
;
Population Characteristics
;
Recombination, Genetic
8.Successful Pregnancy in a Patient with Autosomal Dominant Polycystic Kidney Disease on Long-Term Hemodialysis.
Ji Hye JUNG ; Min Jeong KIM ; Hye Jin LIM ; Su Ah SUNG ; So Young LEE ; Dae Woon KIM ; Kyu Beck LEE ; Young Hwan HWANG
Journal of Korean Medical Science 2014;29(2):301-304
Recent advances in dialysis and a multidisciplinary approach to pregnant patients with advanced chronic kidney disease provide a better outcome. A 38-yr-old female with autosomal dominant polycystic kidney disease (ADPKD) became pregnant. She was undergoing hemodialysis (HD) and her kidneys were massively enlarged, posing a risk of intrauterine fetal growth restriction. By means of intensive HD and optimal management of anemia, pregnancy was successfully maintained until vaginal delivery at 34.5 weeks of gestation. We discuss the special considerations involved in managing our patient with regard to the underlying ADPKD and its influence on pregnancy.
Adult
;
Female
;
Fetal Growth Retardation/etiology
;
Humans
;
Kidney Failure, Chronic/therapy
;
Polycystic Kidney, Autosomal Dominant/*diagnosis
;
Pregnancy
;
Renal Dialysis
;
Risk Factors
;
Tomography, X-Ray Computed
9.Gene diagnosis and clinical characteristics of autosomal recessive polycystic kidney disease.
Chinese Journal of Pediatrics 2013;51(4):311-313
Adolescent
;
Child
;
Child, Preschool
;
DNA Mutational Analysis
;
Diagnosis, Differential
;
Humans
;
Infant
;
Infant, Newborn
;
Liver Diseases
;
diagnosis
;
genetics
;
pathology
;
Lung Diseases
;
diagnosis
;
genetics
;
pathology
;
Magnetic Resonance Imaging
;
Mutation
;
Polycystic Kidney, Autosomal Dominant
;
diagnosis
;
genetics
;
pathology
;
Polycystic Kidney, Autosomal Recessive
;
diagnosis
;
genetics
;
pathology
;
Prenatal Diagnosis
;
Receptors, Cell Surface
;
genetics
;
Tomography, X-Ray Computed
10.Successfully Treated Escherichia coli-Induced Emphysematous Cyst Infection with Combination of Intravenous Antibiotics and Intracystic Antibiotics Irrigation in a Patient with Autosomal Dominant Polycystic Kidney Disease.
Hyunsuk KIM ; Hayne CHO PARK ; Sunhwa LEE ; Jungsil LEE ; Chungyun CHO ; Dong Ki KIM ; Young Hwan HWANG ; Kook Hwan OH ; Curie AHN
Journal of Korean Medical Science 2013;28(6):955-958
A 62-yr-old woman with an autosomal dominant polycystic kidney disease (ADPKD) was admitted to our hospital for further evaluation of intermittent fever, nausea and left flank discomfort. The computed tomography (CT) scan revealed a gas-forming, infectious cyst of approximately 8.1 cm in size in left kidney lower pole. Escherichia coli was identified from the cyst fluid culture examination. Her symptoms improved only after the concomitant use of intravenous ciprofloxacin and an intracystic irrigation of ciprofloxacin through a percutaneous cystostomy drainage. Our case presents the successfully treated emphysematous cyst infection with combination of intravenous antibiotics and intracystic antibiotic therapy instead of surgical management.
Anti-Bacterial Agents/*therapeutic use
;
Ciprofloxacin/*therapeutic use
;
Cystostomy
;
Cysts/microbiology
;
Escherichia coli Infections/complications/*drug therapy
;
Female
;
Humans
;
Injections, Intravenous
;
Middle Aged
;
Polycystic Kidney, Autosomal Dominant/complications/*diagnosis
;
Therapeutic Irrigation
;
Tomography, X-Ray Computed

Result Analysis
Print
Save
E-mail