1.Research advances in the diagnosis and treatment of Polycystic kidney disease.
Jiafa WU ; Yuru JING ; Xiaoyuan NING
Chinese Journal of Medical Genetics 2026;43(3):234-240
Polycystic kidney disease (PKD) is a group of inherited disorders characterized by cystic lesions in the kidneys and multiple organs, primarily including autosomal dominant polycystic kidney disease (ADPKD) and autosomal recessive polycystic kidney disease (ARPKD). ADPKD is mainly caused by variations in the PKD1 and PKD2 genes. Its clinical manifestations include progressive renal cyst growth, hypertension, and multi-system complications. ARPKD, on the other hand, is primarily caused by mutations in the PKHD1 gene. It commonly occurs in infants and young children, with hepatorenal cystic fibrosis being a key feature. Although there is currently no cure for PKD, the integration of multi-omics and precision medicine strategies holds promise for optimizing patient management and improving outcomes in the future. This review summarizes the genetic basis, pathogenic mechanisms, diagnostic techniques, and therapeutic advances in PKD, providing a reference for clinical practice and research.
Humans
;
Polycystic Kidney Diseases/genetics*
;
TRPP Cation Channels/genetics*
;
Mutation
;
Polycystic Kidney, Autosomal Dominant/therapy*
;
Receptors, Cell Surface
2.Inositol 1,4,5-triphosphate receptor 3 promotes renal cyst development in autosomal dominant polycystic kidney disease.
Zhi-Wei QIU ; Ming LIU ; Hong ZHOU ; Bao-Xue YANG
Acta Physiologica Sinica 2023;75(3):328-338
The purpose of the present study was to determine the role of inositol 1,4,5-trisphosphate receptor 3 (IP3R3) in renal cyst development in autosomal dominant polycystic kidney disease (ADPKD). 2-aminoethoxy-diphenyl borate (2-APB) and shRNA were used to suppress the expression of IP3R3. The effect of IP3R3 on cyst growth was investigated in Madin-Darby canine kidney (MDCK) cyst model, embryonic kidney cyst model and kidney specific Pkd1 knockout (PKD) mouse model. The underlying mechanism of IP3R3 in promoting renal cyst development was investigated by Western blot and immunofluorescence staining. The results showed that the expression level of IP3R3 was significantly increased in the kidneys of PKD mice. Inhibiting IP3R3 by 2-APB or shRNA significantly retarded cyst expansion in MDCK cyst model and embryonic kidney cyst model. Western blot and immunofluorescence staining results showed that hyperactivated cAMP-PKA signaling pathway in the growth process of ADPKD cyst promoted the expression of IP3R3, which was accompanied by a subcellular redistribution process in which IP3R3 was translocated from endoplasmic reticulum to intercellular junction. The abnormal expression and subcellular localization of IP3R3 further promoted cyst epithelial cell proliferation by activating MAPK and mTOR signaling pathways and accelerating cell cycle. These results suggest that the expression and subcellular distribution of IP3R3 are involved in promoting renal cyst development, which implies IP3R3 as a potential therapeutic target of ADPKD.
Animals
;
Dogs
;
Mice
;
Cysts/genetics*
;
Inositol 1,4,5-Trisphosphate Receptors/pharmacology*
;
Kidney/metabolism*
;
Polycystic Kidney Diseases/metabolism*
;
Polycystic Kidney, Autosomal Dominant/drug therapy*
;
Madin Darby Canine Kidney Cells
3.Analysis of PDK1 gene variants and prenatal diagnosis for eight pedigrees affected with autosomal dominant polycystic kidney disease.
Huijun LI ; Peixuan CAO ; Xiangyu ZHU ; Yujie ZHU ; Xing WU ; Jie LI
Chinese Journal of Medical Genetics 2022;39(9):932-937
OBJECTIVE:
To detect potential variants in eight Chinese pedigrees affected with autosomal dominant polycystic kidney disease (ADPKD) and provide prenatal diagnosis for two of them.
METHODS:
Whole exome sequencing and high-throughput sequencing were carried out to detect variants of PKD1 and PKD2 genes in the probands. Sanger sequencing was used to validate the variants, and their pathogenicity was predicted by searching the ADPKD and protein variation databases.
RESULTS:
Eight PKD1 variants were detected, which have included five nonsense mutations and three missense mutations. Among these, four nonsense variants (PKD1: c.7555C>T, c.7288C>T, c.4957C>T, c.11423G>A) were known to be pathogenic, whilst one missense variant (PKD1: c.2180T>G) was classified as likely pathogenic. Three novel variants were detected, which included c.6781G>T (p.Glu2261*), c.109T>G (p.Cys37Gly) and c.8495A>G (p.Asn2832Ser). Prenatal testing showed that the fetus of one family has carried the same mutation as the proband, while the fetus of another family did not.
CONCLUSION
PKD1 variants, including three novel variants, have been identified in the eight pedigrees affected with ADPKD. Based on these results, prenatal diagnosis and genetic counseling have been provided.
DNA Mutational Analysis/methods*
;
Female
;
Humans
;
Mutation
;
Pedigree
;
Polycystic Kidney, Autosomal Dominant/genetics*
;
Pregnancy
;
Prenatal Diagnosis
;
TRPP Cation Channels/genetics*
4.Analysis of PKD2 gene variant and protein localization in a pedigree affected with polycystic kidney disease.
Jianping CHENG ; Ping LI ; Yujun LI ; Yong'an ZHOU ; Ruirui REN ; Yaxin HAN ; Xingxing LI ; Zhe LI ; Yuan BAI
Chinese Journal of Medical Genetics 2021;38(1):47-51
OBJECTIVE:
To detect the mutation site in a pedigree affected with autosomal dominant polycystic kidney disease (ADPKD) and verify its impact on the protein function.
METHODS:
Peripheral blood samples were collected from the proband and his pedigree members for the extraction of genomic DNA. Mutational analysis was performed on the proband through whole-exome sequencing. Suspected variant was verified by Sanger sequencing. A series of molecular methods including PCR amplification, restriction enzyme digestion, ligation and transformation were also used to construct wild-type and mutant eukaryotic expression vectors of the PKD2 gene, which were transfected into HEK293T and HeLa cells for the observation of protein expression and cell localization.
RESULTS:
The proband was found to harbor a c.2051dupA (p. Tyr684Ter) frame shift mutation of the PKD2 gene, which caused repeat of the 2051st nucleotide of its cDNA sequence and a truncated protein. Immunofluorescence experiment showed that the localization of the mutant protein within the cell was altered compared with the wild-type, which may be due to deletion of the C-terminus of the PKD2 gene.
CONCLUSION
The c.2051dupA (p. Tyr684Ter) mutation of the PKD2 gene probably underlay the pathogenesis of ADPKD in this pedigree.
DNA Mutational Analysis
;
Female
;
Frameshift Mutation
;
HEK293 Cells
;
HeLa Cells
;
Humans
;
Male
;
Pedigree
;
Polycystic Kidney, Autosomal Dominant/physiopathology*
;
Protein Kinases/genetics*
;
Protein Transport/genetics*
;
Whole Exome Sequencing
5.Ultrasonographic manifestation and genetic analysis of a fetus with nephronophthisis type 2.
Qinghua WU ; Saisai YANG ; Can WANG ; Huirong SHI ; Shumin REN ; Zhihui JIAO ; Xiangdong KONG
Chinese Journal of Medical Genetics 2020;37(5):559-562
OBJECTIVE:
To carry out genetic analysis for a family with a fetus manifesting bilateral polycystic renal dysplasia and oligohydramnios at 16 gestational week and a previous history for fetal renal anomaly.
METHODS:
Ultrasound scan was carried out to detect the morphological changes. Following genetic counselling, the parents had decided to terminate the pregnancy. Fetal kidneys were subjected to histological examination. Target capture and next generation sequencing (NGS) was applied to the abortus to detect potential variants. The results were verified by Sanger sequencing.
RESULTS:
Histological examination of fetal kidneys revealed cystic changes without cortex, medulla or normal renal structure. NGS has identified a heterozygous c.100+1G>A variant and deletion of exon 3 of the INVS gene, which were respectively inherited from the mother and father.
CONCLUSION
Through NGS and Sanger sequencing, the fetus was diagnosed with type II nephronophthisis (NPHP2). Above result can provide guidance for further pregnancy and enforce understanding of clinical features and genetic etiologies for NPHP.
Female
;
Fetus
;
Genetic Testing
;
Heterozygote
;
Humans
;
Mutation
;
Polycystic Kidney, Autosomal Dominant
;
diagnostic imaging
;
genetics
;
Pregnancy
;
Sequence Deletion
;
genetics
;
Transcription Factors
;
genetics
;
Ultrasonography
6.Application of immunosuppressants in patients with autosomal dominant polycystic kidney disease after kidney transplantation.
Qiong LI ; Jiangtao LI ; Fan YANG ; Yanna LIU ; Wenfeng DENG ; Ruming LIU ; Yangcheng HU ; Renfei XIA ; Jian XU ; Yun MIAO
Journal of Southern Medical University 2020;40(4):538-543
OBJECTIVE:
To investigate the optimal dose range of immunosuppressants in patients with autosomal dominant polycystic kidney disease (ADPKD) after renal transplantation.
METHODS:
A cohort of 68 patients with ADPKD who received their first renal transplantation between March, 2000 and January, 2018 in our institute were retrospectively analyzed, with 68 non-ADPKD renal transplant recipients matched for gender, age and date of transplant as the control group. We analyzed the differences in patient and renal survival rates, postoperative complications and concentrations of immunosuppressive agents between the two groups at different time points within 1 year after kidney transplantation. The concentrations of the immunosuppressants were also compared between the ADPKD patients with urinary tract infections (UTI) and those without UTI after the transplantation.
RESULTS:
The recipients with ADPKD and the control recipients showed no significantly difference in the overall 1-, 5-, and 10- year patient survival rates (96.6% 96.0%, 94.1% 93.9%, and 90.6% 93.9%, respectively; > 0.05), 1-, 5-, and 10-year graft survival rates (95.2% 96.0%, 90.8% 87.2%, and 79.0% 82.3%, respectively; > 0.05), or the incidences of other post- transplant complications including acute rejection, gastrointestinal symptoms, cardiovascular events, pneumonia, and neoplasms ( > 0.05). The plasma concentrations of both tacrolimus and mycophenolate mofetil (MPA) in ADPKD group were significantly lower than those in the control group at 9 months after operation ( < 0.05). The incidence of UTI was significantly higher in ADPKD patients than in the control group ( < 0.05). In patients with ADPKD, those with UTI after transplantation had a significantly higher MPA plasma concentration ( < 0.05).
CONCLUSIONS
In patients with ADPKD after renal transplant, a higher dose of MPA is associated with a increased risk of UTI, and their plasma concentrations of immunosuppressants for long-term maintenance of immunosuppression regimen can be lower than those in other kidney transplantation recipients.
Graft Survival
;
Humans
;
Immunosuppressive Agents
;
Kidney Transplantation
;
Polycystic Kidney, Autosomal Dominant
;
Retrospective Studies
7.Genetic diagnosis and prenatal diagnosis of autosomal dominant polycystic kidney disease.
Chinese Journal of Medical Genetics 2019;36(5):419-423
OBJECTIVE:
To explore the genetic etiology for 17 pedigrees affected with autosomal dominant polycystic kidney disease (ADPKD).
METHODS:
Peripheral blood samples were derived from the probands and their parents with informed consent. Following DNA extraction, targeted capture and next generation sequencing were carried out in search for potential disease-causing variants. Sanger sequencing was used to validate candidate pathogenic variants co-segregating with the disease in each pedigree. Prenatal diagnosis was provided for one family.
RESULTS:
Among the 17 probands, 14 PKD1 mutations and 3 PKD2 mutations were detected, which included 6 missense mutations, 4 nonsense mutations and 7 frameshift mutations. Of these, 8 have been associated with ADPKD previously and 9 were novel, which included c.7625G>T (p.Gly2542Val), c.3673C>T (p.Gln1225*), c.11048dupT (p.Thr3684Aspfs*38), c.9083_9084delAG (p.Glu3028Glyfs*40), c.10560delG (p.Pro3521Hisfs*6), c.7952_7974del TGTCCCTGAGGGTCCACACTGTG (p.Val2651Glyfs*2) of PKD1, and c.662T>G (p.Leu221*), c.1202_1203 insCT (p.Glu401Aspfs*2), and c.919 delA (p.Ser307Valfs*10) of PKD2. Prenatal testing showed that the fetus did not carry the same mutation as the proband.
CONCLUSION
Identification of causative mutations in the 17 pedigrees affected with ADPKD has provided a basis for genetic counseling and reproductive guidance. The novel findings have enriched the mutational spectrum of the PKD1 and PKD2 genes.
DNA Mutational Analysis
;
Female
;
Humans
;
Mutation
;
Pedigree
;
Polycystic Kidney, Autosomal Dominant
;
Pregnancy
;
Prenatal Diagnosis
;
TRPP Cation Channels
8.Research progress in autosomal dominant polycystic kidney disease.
Sheng HU ; Dongjie LI ; Xinji TAN ; Jie GU ; Mingquan CHEN ; Xiaobo ZHANG
Journal of Central South University(Medical Sciences) 2019;44(10):1179-1187
Autosomal dominant polycystic kidney disease (ADPKD) is a common hereditary disease, mainly caused by polycystic kidney disease 1/2 (PKD1/2) gene mutation. The main manifestation is the formation of multiple progressive enlarged cysts in both kidneys, which can be accompanied by decreased glomerular filtration rate, hypertension, liver cyst and cerebral aneurysm. About 45% of patients will progress to end-stage renal failure before the age of 60. ADPKD gene sequencing can be chosen for suspicious patients with atypical clinical features, no positive family history, and inconspicuous imaging findings. In the ADPKD positive families, imaging examination is the main means of diagnosing ADPKD. Height-adjusted total kidney volume (htTKV) and kidney growth rate are commonly used to monitor ADPKD disease progression and prognosis. There is no effective treatment for ADPKD to stop its progress. Drugs such as tolvaptan and bosutinib can delay the renal disfunction and they have been applied to clinical therapy in Europe and America.
Disease Progression
;
Glomerular Filtration Rate
;
Humans
;
Kidney
;
Polycystic Kidney, Autosomal Dominant
;
Tolvaptan
9.Preimplantation genetic diagnosis for infertile males with autosomal dominant polycystic kidney disease.
Xiao-Yu YANG ; Tao LI ; Xiao-Jun LIU ; Jian-Dong SHEN ; Yu-Gui CUI ; Gui-Rong ZHANG ; Jia-Yin LIU
National Journal of Andrology 2018;24(5):409-413
ObjectiveAutosomal dominant polycystic kidney disease (ADPKD) is one of the most common genetic renal diseases, which may cause oligoasthenospermia and azoospermia and result in male infertility. This study aimed to analyze the outcomes of preimplantation genetic diagnosis (PGD) in male patients with ADPKD-induced infertility.
METHODSWe retrospectively analyzed the clinical data on 7 male patients with ADPKD-induced infertility undergoing PGD from April 2015 to February 2017, including 6 cases of oligoasthenospermia and 1 case of obstructive azoospermia, all with the PKD1 gene heterozygous mutations. Following intracytoplasmic sperm injection (ICSI), we performed blastomere biopsy after 5 or 6 days of embryo culture and subjected the blastomeres to Sureplex whole-genome amplification, followed by haplotype linkage analysis, Sanger sequencing, array-based comparative genomic hybridization to assess the chromosomal ploidy of the unaffected embryos, and identification of the unaffected euploid embryos for transfer.
RESULTSOne PGD cycle was completed for each of the 7 patients. Totally, 26 blastocysts were developed, of which 12 were unaffected and diploid. Clinical pregnancies were achieved in 6 cases following 7 cycles of frozen embryo transplantation, which included 5 live births and 1 spontaneous abortion.
CONCLUSIONSFor males with ADPKD-induced infertility, PGD may contribute to high rates of clinical pregnancy and live birth and prevent ADPKD in the offspring as well. This finding is also meaningful for the ADPKD patients with normal fertility.
Abortion, Spontaneous ; genetics ; Biopsy ; Blastocyst ; Comparative Genomic Hybridization ; Embryo Transfer ; Female ; Humans ; Infertility, Male ; etiology ; genetics ; Male ; Mutation ; Polycystic Kidney, Autosomal Dominant ; complications ; diagnosis ; genetics ; prevention & control ; Pregnancy ; Pregnancy Outcome ; Preimplantation Diagnosis ; Retrospective Studies ; Sperm Injections, Intracytoplasmic
10.Esophageal Artery Pseudoaneurysm and Takayasu Arteritis in a Patient with Autosomal Dominant Polycystic Kidney Disease.
Hyunsuk KIM ; Yeonsil YU ; Kwang Eon SHIM ; Jin Eop KIM ; Junga KOH ; Jong Woo YOON ; Curie AHN ; Yun Kyu OH
Electrolytes & Blood Pressure 2018;16(1):11-14
A 47-year-old female previously diagnosed with ADPKD visited the hospital due to sudden pain in her upper abdomen and back. Esophagogastroduodenoscopy, contrast-enhanced abdominal computed tomography (CT), and CT angiography identified an esophageal artery pseudoaneurysm and hematoma in the esophagus. Urgent angiography and embolization were performed. After the procedure, CT angiography and positron emission tomography were performed due to differences in blood pressure between the arms. The patient was also found to have Takayasu arteritis and subsequently received outpatient follow-up care. The possible mechanisms that cause vascular abnormalities in ADPKD patients include damaged vascular integrity due to abnormal polycystin expression caused by PKD mutations and connective tissue abnormalities. Further research is needed to confirm these mechanisms, and ADPKD patients should be assessed for vascular abnormalities.
Abdomen
;
Aneurysm
;
Aneurysm, False*
;
Angiography
;
Arm
;
Arteries*
;
Blood Pressure
;
Connective Tissue
;
Endoscopy, Digestive System
;
Esophagus
;
Female
;
Follow-Up Studies
;
Hematoma
;
Humans
;
Middle Aged
;
Outpatients
;
Polycystic Kidney, Autosomal Dominant*
;
Positron-Emission Tomography
;
Takayasu Arteritis*

Result Analysis
Print
Save
E-mail