BACKGROUND:Some studies have confirmed the changes in the function of immune cell subsets such as monocytes,T cells,B cells,and natural killer cells(NK cells)in patients with osteoarthritis,but the specific regulatory mechanisms are unclear.OBJECTIVE:To explore the causal relationship between plasma metabolite-mediated immune cells and hip osteoarthritis.METHODS:The Genome-Wide Association Studies(GWAS)data of 731 immune cells were used as the exposure,the GWAS data of hip osteoarthritis were used as the outcome,and 1 400 plasma metabolites were selected as mediating factors.The GWAS database is an important database for genetic association studies,maintained by international organizations with no country-specific affiliation.The inverse variance weighting method in the two-sample Mendelian randomization method was the main method,and the Bayesian weighted Mendelian randomization method was used to analyze the prior distribution,sample data and weights,which were then used to calculate the posterior distribution.The accuracy and reliability of the inverse variance weighting results were evaluated according to the posterior distribution,supplemented by MR-Egger,weighted median,simple model,and weighted mode methods.The pliotropy test and heterogeneity test were used to ensure the robustness of the process.The results of the inverse variance weighting method were used for subsequent mediating effect analysis.RESULTS AND CONCLUSION:(1)The inverse variance weighting method identified 4 immune cells strongly correlated with hip osteoarthritis,and 20 metabolites strongly associated with hip osteoarthritis,all of which had no reverse causal relationship.At the same time,the validation results of Bayesian weighted Mendelian randomization method showed that the posterior mean value was similar to the estimated value of the inverse variance weighting,and the posterior variance was relatively lower.One monocyte subtype(PDL-1 on CD14-CD16+)was finally screened out to have a causal relationship with hip osteoarthritis,with a total effect of-0.047(odds ratio=0.954,95％confidence interval:0.926-0.983),and a mediating effect of-0.004(odds ratio=0.939,95％confidence interval:0.902-0.978)mediated by alliin levels,accounting for 8.5％of the total effect.It was concluded that alliin is a protective factor in the progression of hip osteoarthritis,in which this metabolite plays a mediating role.(2)The large amount of data from international databases and European population analysis is of great significance to Chinese biomedicine,which can provide clues for research on the genetic susceptibility to similar diseases in the Chinese population,aiding in discovering the unique associations.The pharmacogenomic approaches used can be adapted to screen for drug response genes in the Chinese population,enhancing the precision of personalized medicine.Additionally,the advanced high-throughput technologies and statistical methods employed can be learned and applied to disease prevention and treatment research.

BACKGROUND:Some studies have confirmed the changes in the function of immune cell subsets such as monocytes,T cells,B cells,and natural killer cells(NK cells)in patients with osteoarthritis,but the specific regulatory mechanisms are unclear.OBJECTIVE:To explore the causal relationship between plasma metabolite-mediated immune cells and hip osteoarthritis.METHODS:The Genome-Wide Association Studies(GWAS)data of 731 immune cells were used as the exposure,the GWAS data of hip osteoarthritis were used as the outcome,and 1 400 plasma metabolites were selected as mediating factors.The GWAS database is an important database for genetic association studies,maintained by international organizations with no country-specific affiliation.The inverse variance weighting method in the two-sample Mendelian randomization method was the main method,and the Bayesian weighted Mendelian randomization method was used to analyze the prior distribution,sample data and weights,which were then used to calculate the posterior distribution.The accuracy and reliability of the inverse variance weighting results were evaluated according to the posterior distribution,supplemented by MR-Egger,weighted median,simple model,and weighted mode methods.The pliotropy test and heterogeneity test were used to ensure the robustness of the process.The results of the inverse variance weighting method were used for subsequent mediating effect analysis.RESULTS AND CONCLUSION:(1)The inverse variance weighting method identified 4 immune cells strongly correlated with hip osteoarthritis,and 20 metabolites strongly associated with hip osteoarthritis,all of which had no reverse causal relationship.At the same time,the validation results of Bayesian weighted Mendelian randomization method showed that the posterior mean value was similar to the estimated value of the inverse variance weighting,and the posterior variance was relatively lower.One monocyte subtype(PDL-1 on CD14-CD16+)was finally screened out to have a causal relationship with hip osteoarthritis,with a total effect of-0.047(odds ratio=0.954,95％confidence interval:0.926-0.983),and a mediating effect of-0.004(odds ratio=0.939,95％confidence interval:0.902-0.978)mediated by alliin levels,accounting for 8.5％of the total effect.It was concluded that alliin is a protective factor in the progression of hip osteoarthritis,in which this metabolite plays a mediating role.(2)The large amount of data from international databases and European population analysis is of great significance to Chinese biomedicine,which can provide clues for research on the genetic susceptibility to similar diseases in the Chinese population,aiding in discovering the unique associations.The pharmacogenomic approaches used can be adapted to screen for drug response genes in the Chinese population,enhancing the precision of personalized medicine.Additionally,the advanced high-throughput technologies and statistical methods employed can be learned and applied to disease prevention and treatment research.

Symptom and syndrome efficacy evaluation scales are indispensable tools for clinical efficacy assessment in traditional Chinese medicine （TCM）， and hold significant value at all stages of new drug research development for spleen and stomach diseases. These scales can provide scientific basis for clinical positioning， efficacy evaluation， and expansion of indications of new drugs. By analyzing the current hotspots and difficulties in research， this study aims to explore the important significance of these scales in the development of new drugs for spleen and stomach diseases， summarize the domestic research progress， and conduct comparative analyses with international studies. Future development trends are also discussed in order to promote the application of symptom and syndrome efficacy evaluation scales in the development of new drugs for spleen and stomach diseases and to advance the moder-nization process of TCM.

Background/Aims: Chronic constipation is prevalent yet under-diagnosed across Asia, compromising quality of life and burdening healthcare systems. Cultural stigma, varied diets, and limited access to standardized diagnostic tools delay timely care. Methods: The Bali Chronic Constipation Roundtable in November 2024, brought together experts from 11 Asian countries. The group reviewed epidemiological data, analyzed multinational questionnaire on clinical practice pattern, and conducted structured discussions to identify key barriers and propose region-specific recommendations. Results: Chronic constipation prevalence varies across Asia, ranging from 1.8% in India to 16.6% in Japan, with women and the elderly disproportionately affected. Under-reporting persists owing to cultural taboos and widespread self treatment with laxatives and traditional medications. Although the Rome IV criteria remains the global standard, they may not fully reflect Asian symptom profiles, and diagnosis is limited by scarce motility laboratories. First line therapies such as dietary-fiber optimization and osmotic laxatives are widely available, but newer pharmacotherapies (prucalopride, linaclotide, lubiprostone, and elobixibat) remain costly and unevenly accessible. Biofeedback for dyssynergic defecation is underutilized due to limited availability. Experts recommend expanded regional research on to refine diagnostic criteria, coupled with enhanced physician education and public awareness. They advocate accessibility to second-line and novel therapies that incorporate culturally attuned regional guidelines, and improved access to gastrointestinal motility testing. Conclusions The Bali Chronic Constipation Roundtable highlighted Asia’s need for region specific diagnostics and management. Addressing diagnostic and treatment gaps will improve outcomes, while ongoing researcher clinician policy collaboration must standardize guidelines, advance research, and ensure equitable care across Asia.

Background: This study was performed to characterize the incidence, costs, and risk factors associated with renal and cardiovascular adverse outcomes following primary percutaneous coronary intervention (pPCI) in patients with ST-elevation myocardial infarction (STEMI). Methods: Patients with STEMI who underwent pPCI using iso-osmolar contrast were enrolled at 39 centers. The incidence of acute kidney injury (AKI) and major adverse renal and cardiovascular events (MARCE) was analyzed, as well as inpatient costs. Logistic regression analysis was performed to identify risk factors. Results: Among 2,293 patients, the incidence of AKI and MARCE within 72 hours post-pPCI was 4.14% (n = 95) and 4.40% (n = 101), respectively. AKI and/or MARCE were associated with systolic blood pressure (AKI: odds ratio [OR], 1.009; 95% confidence interval [CI], 1.000–1.018), hypertension (AKI: OR, 1.815; 95% CI, 1.133–2.906; MARCE: OR, 1.760;95% CI, 1.118–2.769), anterior wall infarction (AKI: OR, 1.895; 95% CI, 1.196–3.004; MARCE:OR, 1.939; 95% CI, 1.240–3.032), Killip class (AKI: OR, 1.465; 95% CI, 1.117–1.922; MARCE:OR, 1.467; 95% CI, 1.131–1.903), and serum creatinine (SCr; MARCE: OR, 1.006; 95% CI, 1.000–1.012). Hospitalization costs for patients with STEMI who developed AKI or MARCE were significantly higher than for those without AKI (9,595 ± 5,795 vs. 8,279 ± 3,872 USD, P = 0.003) or without MARCE (9,890 ± 5,616 vs. 8,255 ± 3,859 USD, P < 0.001). Conclusions In patients with STEMI undergoing pPCI with iso-osmolar contrast, the incidence of AKI and MARCE was associated with higher hospitalization costs. Systolic blood pressure, hypertension, anterior wall infarction, Killip class, and SCr were identified as risk factors for these outcomes.

OBJECTIVE: To establish a two-segment vertebrectomy model using the finite element method, and to measure and compare the biomechanical properties of the lower cervical anterior transpedicular root screw (ATPRS) plate system, lower cervical anterior pedicle screw (ATPS) plate system, and lower cervical anterior cervical locked-plate (ACLP) system on this model. METHODS: CT data of the cervical spine (C₀-T₁) from a 34-year-old healthy adult male volunteer were collected. A nonlinear complete model of the lower cervical spine (C₃-C₇) was established using Mimics 10.01 software, based on which the ATPRS fixation model, ATPS fixation model, and ACLP fixation model were constructed respectively. An axial pressure of 75 N and a pure couple moment of 1.5 N·m were applied to C3 to make the model perform flexion-extension, left-right lateral bending, and left-right rotation movements. The range of motion (ROM) and stress distribution of each model under different working conditions were compared. RESULTS: The ROM of the C₄-C₇ segments in the ACLP group, ATPS group, and ATPRS group was reduced to 0.65° (-95.2%), 0.58° (-95.7%), and 0.62° (-95.4%) respectively compared with the intact model during flexion-extension movement;during lateral bending movement, it was reduced to 0.58° (-95.2%), 0.51°(-95.8%), and 0.60° (-95.1%) respectively;during rotation movement, it was reduced to 1.17° (-89.6%), 1.26° (-88.8%), and 1.27°(-88.7%) respectively. In terms of the stress on the titanium mesh graft, the ATPS group and ATPRS group had the maximum load during extension and the minimum load during flexion. Compared with the ACLP group, the stress on the titanium mesh graft in ATPS and ATPRS decreased by (-33.7%) and (-15.8%) in flexion, (-29.4%) and (-13.2%) in extension, (-26.2%) and (-23.4%) in lateral bending, and (-18.8%) and (-5.4%) in rotation, respectively. In terms of bone-screw interface stress, the peak bone stress near the C₇ screw in the ACLP group, ATPS group, and ATPRS group increased by 49.2%, 45.0%, and 47.6% respectively compared with the peak bone stress near the C₄ screw during extension. However, during flexion and lateral bending, there was no significant difference in the peak bone stress near the C₄ and C₇ screws. During rotation, the difference between the peak bone stress near the C₄ screw and that near the C₇ screw showed that in the ACLP group, left rotation (37.6%) was similar to right rotation (36.7%), while in the ATPS group and ATPRS group, left rotation was lower than right rotation. CONCLUSION Compared with the ACLP group, the ATPS group and ATPRS group have greater fixation stiffness and more stable fixation. However, in rotational movement, due to the uneven distribution of fixation stiffness, the stress distribution during torsion is uneven, but it is still better than the ACLP group. This indicates that ATPRS, like ATPS, has good primary stability, providing favorable conditions for bone graft fusion.
Humans ; Finite Element Analysis ; Male ; Cervical Vertebrae/physiopathology* ; Adult ; Biomechanical Phenomena ; Bone Plates ; Bone Screws ; Range of Motion, Articular ; Fracture Fixation, Internal

Stress is a critical inducer in the onset and progression of many chronic diseases. Prolonged or intense stress can disrupt the overall balance between the nervous, immune, and endocrine systems. The resulting biological signals may act on corresponding receptors in the cervical spine region, leading to adverse pathological changes. The vertebral artery and the surrounding muscular and connective tissues are influenced by biomechanical abnormalities and inflammatory cascades associated with cervical spondylosis of vertebral artery type (CSA), which promotes the release of various hormones. These hormones, through the neuroendocrine-immune system, affect the central nervous system, inducing or exacerbating negative emotional feedback and thereby establishing a "central-local-central" vicious cycle. This article explores the mechanisms underlying the impact of stress on the key CSA symptoms through the neuroendocrine-immune network (NEI) theory, providing a more comprehensive framework for targeted therapeutic interventions in CSA.
Humans ; Neurosecretory Systems/immunology* ; Spondylosis/etiology* ; Vertebral Artery/immunology* ; Stress, Psychological/complications* ; Chronic Disease

PURPOSE: Lateral patellar compression syndrome (LPCS) is characterized by a persistent abnormally high stress exerted on the lateral articular surface of the patella due to lateral patellar tilt without dislocation and lateral retinaculum contracture, leading to anterior knee pain. The purpose of this study is to evaluate the efficacy and prognosis of lateral retinaculum release (LRR) combined with chondroplasty in the treatment of LPCS. METHODS: This retrospective study evaluated 40 patients who underwent LRR combined with chondroplasty for LPCS between 2020 and 2021. The assessment included improvement in postoperative tenderness and knee joint function. Patients were evaluated using the Lysholm, Tegner, and International Knee Documentation Committee 2000 scoring systems, as well as the visual analog scale, both preoperatively and postoperatively, with the paired comparisons analyzed using a t-test. Additionally, intraoperative observations were made regarding knee joint lesions, including cartilage damage and osteophyte formation, with analysis by the Chi-square test. RESULTS: The visual analog scale score for tenderness showed a significant decrease after surgery (p < 0.001). Evaluation of knee joint function also indicated significant improvements, as demonstrated by increased Lysholm, Tegner, and International Knee Documentation Committee 2000 scores postoperatively (p < 0.001, p = 0.011, p < 0.001, respectively). Furthermore, all LPCS patients included in the study presented with cartilage injuries and osteophyte formation. Significant differences were noted in the incidence of cartilage damage and osteophyte formation at different locations within the knee among patients with LPCS. CONCLUSION LRR combined with chondroplasty is an effective surgical approach for treating patients with LPCS, with satisfactory recovery observed at the 1-year follow-up. Additionally, the incidence of cartilage damage and osteophyte formation in LPCS patients varies significantly depending on the specific location within the knee joint.
Humans ; Male ; Female ; Retrospective Studies ; Adult ; Middle Aged ; Patella/surgery* ; Knee Joint/physiopathology* ; Recovery of Function ; Young Adult ; Treatment Outcome ; Cartilage, Articular/surgery* ; Adolescent

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To evaluate the dynamic changes of glucocorticoid (GC) dose and the feasibility of GC discontinuation in rheumatoid arthritis (RA) patients under the background of Chinese medicine (CM). METHODS: This multicenter retrospective cohort study included 1,196 RA patients enrolled in the China Rheumatoid Arthritis Registry of Patients with Chinese Medicine (CERTAIN) from September 1, 2019 to December 4, 2023, who initiated GC therapy. Participants were divided into the Western medicine (WM) and integrative medicine (IM, combination of CM and WM) groups based on medication regimen. Follow-up was performed at least every 3 months to assess dynamic changes in GC dose. Changes in GC dose were analyzed by generalized estimator equation, the probability of GC discontinuation was assessed using Kaplan-Meier curve, and predictors of GC discontinuation were analyzed by Cox regression. Patients with <12 months of follow-up were excluded for the sensitivity analysis. RESULTS: Among 1,196 patients (85.4% female; median age 56.4 years), 880 (73.6%) received IM. Over a median 12-month follow-up, 34.3% (410 cases) discontinued GC, with significantly higher rates in the IM group (40.8% vs. 16.1% in WM; P<0.05). GC dose declined progressively, with IM patients demonstrating faster reductions (median 3.75 mg vs. 5.00 mg in WM at 12 months; P<0.05). Multivariate Cox analysis identified age <60 years [P<0.001, hazard ratios (HR)=2.142, 95% confidence interval (CI): 1.523-3.012], IM therapy (P=0.001, HR=2.175, 95% CI: 1.369-3.456), baseline GC dose ⩽7.5 mg (P=0.003, HR=1.637, 95% CI: 1.177-2.275), and absence of non-steroidal anti-inflammatory drugs use (P=0.001, HR=2.546, 95% CI: 1.432-4.527) as significant predictors of GC discontinuation. Sensitivity analysis (545 cases) confirmed these findings. CONCLUSIONS RA patients receiving CM face difficulties in following guideline-recommended GC discontinuation protocols. IM can promote GC discontinuation and is a promising strategy to reduce GC dependency in RA management. (Trial registration: ClinicalTrials.gov, No. NCT05219214).
Adult ; Aged ; Female ; Humans ; Male ; Middle Aged ; Arthritis, Rheumatoid/drug therapy* ; Glucocorticoids/therapeutic use* ; Medicine, Chinese Traditional ; Retrospective Studies