OBJECTIVE To establish a Chinese drug-related problem （DRP） classification system applicable to pharmacist-led pharmaceutical care in China， providing pharmacists with an effective and practical tool for pharmaceutical care. METHODS A multi-stage process was employed to construct the DRP classification system， including literature review and analysis， comparison of existing classification systems， refinement of classification items and framework development， two rounds of standard case validation， expert discussion， and system revision. The Fleiss′ kappa test was used to calculate the consistency coefficient κ， assessing the reliability of pharmacists participating in evaluating the classification system. An electronic questionnaire comprising six items was employed to evaluate the system’s applicability. RESULTS The constructed Chinese DRP classification system comprised six sections [problem（including potential problems）， DRP evaluation， cause （including possible causes of potential problems）， intervention， acceptance of intervention and DRP status]， with 24 primary codes and 96 secondary codes. In the first round of case validation， κ values exceeded 0.4 for all sections except “intervention” and “DRP status”. In the second round， κ values exceeded 0.4 for all sections. In the applicability evaluation of the classification system， positive ratings （“strongly agree” or “agree”） exceeded 85% for all items. Specifically， positive ratings for“the classification system can provide appropriate category selection”，“ the classification system is comprehensive”，“ the classification system is convenient to use” and “the classification system is highly satisfactory” exceeded 92%. CONCLUSIONS The Chinese DRP classification system developed demonstrates both high reliability and applicability， providing an effective and practical classification tool for pharmacists in China to conduct pharmaceutical care.

Objective: To characterize perioperative dynamic changes in immune-cell phenotypes and inflammatory cytokines in patients undergoing CPB (cardiopulmonary bypass) cardiac surgery, and to explore their associations with postoperative outcomes. Methods: In this prospective cohort study, 120 adult patients who underwent elective cardiac surgery under CPB at West China Hospital from May 2022 to March 2023 were enrolled. Perioperative immune-cell phenotypes and concentrations of 40 inflammation-related cytokines were measured. The primary outcomes were the sequential organ failure assessment (SOFA) score at 24 h after surgery and ΔSOFA (the peak SOFA score within 48 h after surgery minus the preoperative SOFA score). Secondary outcomes included major adverse cardiovascular events (MACE), acute kidney injury (AKI), respiratory failure, severe liver injury, and infection. Results: The mean age of enrolled patients was 57±10 years. Of these, 52% (62/120) were male and 90% (108/120) underwent valve surgery. During the rewarming to the end of CPB, neutrophil counts rapidly increased (7.39×10 /L vs preoperative 3.07×10 /L, P<0.001), with significant upregulation of CD11b (7.30×10 /L vs preoperative 3.05×10 /L, P<0.001) and CD54 (7.15×10 /L vs preoperative 2.99×10 /L, P<0.001). Lymphocyte counts increased at the end of CPB (1.75×10 /L vs preoperative 1.12×10 /L, P<0.001) but decreased significantly at 24 h after surgery (0.59×10 /L vs preoperative 1.12×10 /L, P<0.001). Plasma analysis showed that multiple pro-inflammatory cytokines increased during CPB and remained elevated up to 24 h after surgery; five chemokines and the anti-inflammatory cytokine IL-10 peaked at the end of CPB. The SOFA score increased from 1 (1, 2) preoperatively to 7 (5, 10) at 24 h after surgery, with a ΔSOFA of 6 (4, 8). Within 30 days after surgery, 48 patients (40.0%) developed AKI, 17 (14.2%) developed infection, 4 (3.3%) developed severe liver injury, 3 (2.5%) developed respiratory failure, and 3 (2.5%) experienced MACE. During the 2-year follow-up, 8 patients (6.7%) experienced MACE and 5 (4.2%) died. Conclusion: Multi-organ dysfunction is common after cardiac surgery under CPB (median ΔSOFA, 6), accompanied by perioperative activation of multiple immune-cell subsets and upregulation of pro-inflammatory, anti-inflammatory, and chemotactic mediators. This study provides data-driven evidence and research clues for further investigation of the associations between CPB-related immune perturbations and postoperative organ dysfunction and clinical outcomes.

Objective To investigate the microbial contamination and its influencing factors of indoor air in public places in Xi'an City, to assess the health risk of employees, and to provide a scientific basis for improving the indoor environment of public places. Methods Total bacterial count and total fungal count in indoor air were monitored in hotels/inns, shopping malls/supermarkets, gyms, and waiting rooms in Xi'an from 2023 to 2024. The health risk assessment of employees was evaluated according to the Chinese Population Exposure Parameters Manual (Adult Volume). Results Overall, the standard-exceeding rate of total bacterial count in Xi'an was 3.85%, and the median values of total bacterial count and total fungal count were 350 CFU/m3 and 300 CFU/m3, respectively. The results of the generalized linear model showed that high indoor temperature and PM10 levels were associated with increased indoor bacterial concentrations (β>0, P<0.05), while high daily passenger flow, and high indoor relative humidity and PM₁₀ levels were associated with increased indoor fungal concentrations (β>0, P<0.05). The multivariate logistic regression showed that high levels of indoor bacterial and fungal concentrations were risk factors for respiratory discomfort among employees. The hazard quotient (HQ) values for all types of public places were less than 1, indicating that the health risk of microbial aerosol exposures for employees was relatively low. Conclusion The indoor microbial pollution in public places in Xi'an is relatively mild, but countermeasures still need to be taken to reduce indoor air microbial contamination.

ObjectiveTo observe the effects of Yangjing Zhongyutang （YJZYT） on mitochondrial biogenesis and oxidative stress damage mediated by the silent information regulator 1 （SIRT1）/peroxisome proliferator-activated receptor gamma coactivator-1alpha （PGC-1α） signaling pathway in cyclophosphamide （CTX）-induced rats with diminished ovarian reserve （DOR）， and to explore its mechanism in improving ovarian reserve function and follicular development. MethodsForty-two 8-week-old female SD rats with normal estrous cycles were randomly divided into a blank control group （n=7） and a model group （n=35）. Rats in the model group received a single intraperitoneal injection of CTX （90 mg·kg^-1） to establish the DOR model. After modeling， estrous cycles were monitored for 7 consecutive days， and model success was confirmed based on criteria for estrous cycle disruption. After successful modeling， rats were divided into groups for intervention： estradiol valerate group （0.09 mg·kg^-1）， and YJZYT high-， medium-， and low-dose groups （19.98， 9.99， 5.00 g·kg^-1）. The blank control group and model group were given an equal volume of distilled water by gavage. All groups received daily gavage once for 4 consecutive weeks. The general state， body weight， and ovarian wet weight of rats were observed and recorded， and the ovarian organ index was calculated. Enzyme-linked immunosorbent assay （ELISA） was used to measure serum levels of follicle-stimulating hormone （FSH）， luteinizing hormone （LH）， estradiol （E₂）， anti-Müllerian hormone （AMH）， superoxide dismutase （SOD）， and glutathione peroxidase （GSH-Px）. Hematoxylin-eosin （HE） staining was performed to observe ovarian histomorphological changes and follicular development status. Immunofluorescence was used to detect reactive oxygen species （ROS） expression levels. Colorimetric assays were employed to measure adenosine triphosphate （ATP） and malondialdehyde （MDA） content in ovarian tissues. Quantitative Real-time polymerase chain reaction （Real-time PCR） was used to detect mitochondrial DNA （mtDNA） copy number and the mRNA expression levels of key genes including SIRT1， PGC-1α， nuclear respiratory factor 1 （NRF1）， and mitochondrial transcription factor A （TFAM）. Western blot was performed to detect the protein expression levels of SIRT1， PGC-1α， NRF1， and TFAM. ResultsCompared with the blank group， rats in the model group exhibited disrupted estrous cycles， obviously reduced body weight， and decreased ovarian index （P<0.05）. Ovarian histopathology revealed cortical thinning， loose structure， and a significant reduction in both primordial and growing follicles （P<0.01）. Serum FSH and LH levels were significantly elevated （P<0.01）， while E₂ and AMH levels were obviously reduced （P<0.05， P<0.01）. ATP content and mtDNA copy number decreased in ovarian tissue （P<0.01）， ROS expression increased， MDA levels rose， while SOD and GSH-Px activities obviously decreased （P<0.05， P<0.01）， mRNA and protein expression levels of SIRT1， PGC-1α， NRF1， and TFAM were obviously downregulated （P<0.05， P<0.01）. After treatment， compared with the model group， body weight and ovarian index obviously recovered in rats administered various doses of YJZYT （P<0.05）， serum E₂ and AMH levels increased， while FSH and LH levels obviously decreased （P<0.05， P<0.01）， ovarian tissue ATP content and mtDNA copy number were up-regulated， ROS and MDA levels decreased， and antioxidant enzymes SOD and GSH-Px activity obviously increased （P<0.05， P<0.01）， Gene and protein expression levels related to the SIRT1/PGC-1α /NRF1/TFAM signaling pathway were obviously up-regulated compared to the model group （P<0.05， P<0.01）， HE staining revealed that ovarian structure gradually recovered to integrity in all treatment groups， with a obviously increase in the number of primordial and growing follicles （P<0.05， P<0.01）. Granulosa cells were neatly arranged， indicating marked improvement in ovarian function. ConclusionYJZYT may improve ovarian function and follicular development in rats with diminished ovarian reserve by activating the SIRT1/PGC-1α signaling pathway， promoting mitochondrial biogenesis， enhancing mitochondrial function， and alleviating oxidative stress damage.

Triple-negative breast cancer (TNBC) represents a distinctive subtype, characterized by the absence of estrogen receptors, progesterone receptors, and human epidermal growth factor receptor 2 (HER2). Due to its high inter-tumor and intra-tumor heterogeneity, TNBC poses significant chanllenges for personalized diagnosis and treatment. The advant of clustered regular interspaced short palindromic repeats (CRISPR) technology has profoundly enhanced our understanding of the structure and function of the TNBC genome, providing a powerful tool for investigating the occurrence and development of diseases. This review focuses on the application of CRISPR/Cas technology in the personalized diagnosis and treatment of TNBC. We begin by discussing the unique attributes of TNBC and the limitations of current diagnostic and treatment approaches: conventional diagnostic methods provide limited insights into TNBC, while traditional chemotherapy drugs are often associated with low efficacy and severe side effects. The CRISPR/Cas system, which activates Cas enzymes through complementary guide RNAs (gRNAs) to selectively degrade specific nucleic acids, has emerged as a robust tool for TNBC research. This technology enables precise gene editing, allowing for a deeper understanding of TNBC heterogeneity by marking and tracking diverse cell clones. Additionally, CRISPR facilitates high-throughput screening to promptly identify genes involved in TNBC growth, metastasis, and drug resistance, thus revealing new therapeutic targets and strategies. In TNBC diagnostics, CRISPR/Cas was applied to develop molecular diagnostic systems based on Cas9, Cas12, and Cas13, each employing distinct detection principles. These systems can sensitively and specifically detect a variety of TNBC biomarkers, including cell-specific DNA/RNA and circulating tumor DNA (ctDNA). In the realm of precision therapy, CRISPR/Cas has been utilized to identify key genes implicated in TNBC progression and treatment resistance. CRISPR-based screening has uncovered potential therapeutic targets, while its gene-editing capabilities have facilitated the development of combination therapies with traditional chemotherapy drugs, enhancing their efficacy. Despite its promise, the clinical translation of CRISPR/Cas technology remains in its early stages. Several clinical trials are underway to assess its safety and efficacy in the treatment of various genetic diseases and cancers. Challenges such as off-target effects, editing efficiency, and delivery methods remain to be addressed. The integration of CRISPR/Cas with other technologies, such as 3D cell culture systems, human induced pluripotent stem cells (hiPSCs), and artificial intelligence (AI), is expected to further advance precision medicine for TNBC. These technological convergences can offer deeper insights into disease mechanisms and facilitate the development of personalized treatment strategies. In conclusion, the CRISPR/Cas system holds immense potential in the precise diagnosis and treatment of TNBC. As the technology progresses and becomes more costs-effective, its clinical relevance will grow, and the translation of CRISPR/Cas system data into clinical applications will pave the way for optimal diagnosis and treatment strategies for TNBC patients. However, technical hurdles and ethical considerations require ongoing research and regulation to ensure safety and efficacy.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To explore the predictive factors for hemodynamically significant patent ductus arteriosus (hsPDA) in preterm infants and to construct a nomogram prediction model for hsPDA occurrence in this population. METHODS: A retrospective analysis was conducted on the clinical data of preterm infants with gestational age <32 weeks diagnosed with patent ductus arteriosus (PDA) who were delivered at Nanjing Women and Children's Healthcare Hospital from January 2020 to December 2022. The subjects were divided into an hsPDA group (52 cases) and a non-hsPDA group (176 cases) based on the presence of hsPDA. Univariate analysis and multivariate logistic regression analysis were performed to screen predictive variables regarding the general information of the infants at birth, maternal pregnancy and delivery conditions, and relevant indicators during hospitalization. A nomogram prediction model for hsPDA occurrence was constructed using R software in preterm infants. Internal validation was performed using the Bootstrap method. Finally, the predictive model was evaluated for calibration, discrimination ability, and clinical utility. RESULTS: Multivariate regression analysis showed that the ratio of the left atrium to aorta diameter (LA/AO), mode of delivery (vaginal), and duration of mechanical ventilation were independent predictive factors for hsPDA in preterm infants (P<0.05). Based on the results of univariate analysis and multivariate logistic regression analysis, variables used to construct the nomogram prediction model for hsPDA risk included: LA/AO ratio, mode of delivery (vaginal), duration of mechanical ventilation, 5-minute Apgar score, and the presence of neonatal respiratory distress syndrome requiring surfactant therapy. The area under the receiver operating characteristic curve for this model was 0.876 (95%CI: 0.824-0.927), and the calibrated curve was close to the ideal reference line, indicating good calibration. The Hosmer-Lemeshow test demonstrated that the model fit well, and the clinical decision curve was above the extreme curves. CONCLUSIONS The nomogram prediction model, constructed using five variables (LA/AO ratio, vaginal delivery, duration of mechanical ventilation, 5-minute Apgar score, and the presence of neonatal respiratory distress syndrome requiring surfactant therapy), has reference significance for predicting the occurrence of hsPDA in preterm infants and provides valuable guidance for the early clinical identification of hsPDA.
Humans ; Ductus Arteriosus, Patent/etiology* ; Nomograms ; Female ; Infant, Newborn ; Infant, Premature ; Retrospective Studies ; Male ; Hemodynamics ; Logistic Models ; Pregnancy

OBJECTIVES: To evaluate the clinical utility and translational potential of a remote jaundice monitoring system for home-based screening of neonatal hyperbilirubinemia. METHODS: A prospective self-controlled study was conducted, enrolling 538 newborns with gestational age ≥35 weeks, birth weight ≥2 000 g, and postnatal age ≤14 days at the Women's Hospital of Nanjing Medical University from March to October 2023. Four screening protocols with different predictive indicators were developed based on the Chinese Neonatal Transcutaneous Hourly Bilirubin Nomogram. The effectiveness of the system was evaluated, and the feasibility of using the remote jaundice monitoring system in actual home settings was analyzed. RESULTS: A total of 538 paired transcutaneous bilirubin (TcB) and total serum bilirubin (TSB) measurements showed a strong correlation (r=0.85, P<0.001), with 95.0% (511/538) of samples within the 95% limits of agreement. Using TcB ≥ the 95th percentile as the predictive indicator, the system achieved 100% sensitivity, 46.2% specificity, and an area under the receiver operating characteristic curve of 0.731 (95%CI: 0.682-0.780). This approach could reduce unnecessary hospital visits by 41.4% (221/538). CONCLUSIONS The system integrates the QBH-801 transcutaneous bilirubinometer, intelligent early warning, and remote guidance services, establishing a closed-loop "hospital-to-home" management model. It demonstrates high safety and feasibility, with significant clinical translational value.
Humans ; Infant, Newborn ; Female ; Male ; Bilirubin/blood* ; Feasibility Studies ; Prospective Studies ; Hyperbilirubinemia, Neonatal/diagnosis* ; Neonatal Screening/methods* ; Jaundice, Neonatal/diagnosis*

ObjectiveTo investigate the perceived experience and acceptance of intrapartum ultrasound （IPUS） as a novel method for labor progress assessment among pregnant women. MethodsFrom February 2023 to December 2024， a total of 180 pregnant women admitted to the Labor Ward of Lingnan Hospital， the Third Affiliated Hospital of Sun Yat-sen University， who were planned for vaginal trial of labor ， were accessed for labor progress using IPUS and vaginal examination （VE） after the onset of labor and prior to the initiation n of labor analgesia. A self-designed questionnaire was used to investigate the women's perceived experiences with both examination methods and their acceptance of IPUS. The pain intensity associated with the examinations was evaluated using the visual analogue pain scale （VAS）. Differences in the women's experiences and pain intensity between the two labor progress assessment methods were compared. ResultsThe acceptance rate of IPUS was 96.67% （174/180）， with the remaining 6 cases undecided. Over 60% of the pregnant women reported IPUS assessment as comfortable and none of them felt discomfort， whereas 32.8% felt uncomfortable with VE （χ²=196.02， P＜0.001）. Nearly two-thirds of the pregnant women believed that VE would cause psychological distress， while none reported such effect with IPUS （χ²=261.52， P＜0.001）. Approximately 77.78% （140/180） of the pregnant women believed that IPUS could reduce their fear of vaginal delivery and enhance their confidence if it replaced VE. The VAS score for IPUS ［0 （0， 2）］ was significantly lower than that for VE ［4 （4， 6）］ （Z=-14.62， P＜0.001）. Further stratified analysis showed that over 90% （164/180） of the pregnant women found IPUS painless， with no moderate or severe pain reported， compared to 43.33% （78/180） experienced moderate or severe pain with VE （P＜0.001）. ConclusionAs a novel approach for labor progress assessment， IPUS not only alleviates the pain and discomfort associated with traditional VE and reduces the fear of childbirth but also enhances women's confidence in delivery， thereby achieving a high level of acceptance among parturient women in China.

Intelligent acupuncture-moxibustion medical equipment is an important force in promoting the inheritance, innovation, and modernization of acupuncture-moxibustion. This paper reviews the development status of intelligent acupuncture-moxibustion medical equipment and related new technologies, as well as the challenges faced. It is found that, with the advancement of technologies such as big data and artificial intelligence, acupuncture-moxibustion medical equipment has shown characteristics of greater precision, miniaturization, intelligence, and portability. However, deficiencies remain in areas such as standardization and regulation, including relatively low rates of effective transformation and a lack of innovation in research outcomes. Therefore, there is an urgent need to formulate corresponding strategies: improving the development of relevant standards for intelligent acupuncture-moxibustion medical equipment, encouraging the integration of medicine and engineering, cultivating interdisciplinary talents, and strengthening the protection of invention patents. It is necessary to establish a demand-oriented pathway connecting "equipment development, equipment evaluation, product formation" through multiple stages such as talent training and research project initiation, thereby promoting the modernization and standardization of intelligent acupuncture-moxibustion medical equipment and supporting the revitalization of traditional medicine.
Moxibustion/instrumentation* ; Humans ; Acupuncture Therapy/trends* ; Artificial Intelligence