OBJECTIVE To investigate the improvement effects and mechanism of Achyranthes bidentata total saponins （ABS） extract on vascular endothelial dysfunction in spontaneously hypertensive rat （SHR） based on cytochrome P450 4A （CYP4A）/20-hydroxyeicosatetetraenoic acid （20-HETE）/G protein-coupled receptor 75 （GPR75） axis. METHODS Ten Wistar- Kyoto rats were taken as the normal control group. Forty SHR were first stratified by systolic blood pressure and then， within each stratum， randomly assigned using a random-number table to the model group （MOD group）， captopril positive control group （CAP group， 10 mg/kg）， ABS low- and high-dose extract groups （ABS-L group， ABS-H group， 60 and 120 mg/kg）， with 10 rats in each group. Animals in each group were given the corresponding drug or equal volume of pure water by gavage， once a day， for 28 consecutive days. After the last administration， systolic blood pressure of rats was measured. The levels of vasoactive substances， inflammatory factors and oxidative stress indicators in serum were measured. The pathological changes of rat thoracic aorta were observed. The level of reactive oxygen species （ROS） in aortic tissue was analyzed. The expressions of endothelial nitric oxide synthase （eNOS）， CYP4A， GPR75， nuclear factor-κB p65 （NF-κB p65）， phosphorylated NF-κB p65， p22phox， and reduced nicotinamide adenine dinucleotide phosphate oxidase 4（NOX4） in thoracic aorta tissue were detected. RESULTS After 28 d of treatment， compared with MOD group， the systolic blood pressure of rats in the ABS-L and ABS-H groups decreased significantly. The levels of 20-HETE， angiotensin Ⅱ， interleukin-1β， interleukin-6， tumor necrosis factor-α， intercellular cell adhesion molecule-1 and malondialdehyde in serum were significantly reduced （P＜0.05 or P＜0.01）， while the levels of nitric oxide， superoxide dismutase， glutathione peroxidase and catalase were significantly increased （P＜0.05 or P＜0.01）. Intimal damage of thoracic aorta was reduced， and endothelial cell morphology was improved. The expressions of ROS， CYP4A， GPR75， p22phox， NOX4 and the phosphorylation level of NF-κB p65 protein in thoracic aorta were down-regulated or reduced （P＜0.05 or P＜0.01）， while the expression of eNOS was up-regulated （P＜0.05 or P＜0.01）. CONCLUSIONS ABS extract may alleviate the inflammatory response and oxidative stress in SHR effectively by down-regulating the expression of CYP4A， reducing the production of 20-HETE， inhibiting the activation of GPR75， and subsequently suppressing the activation of downstream NF-κB and NOX4， thereby improving hypertension-related vascular endothelial dysfunction.

Background/Aims: Growing evidence suggests histologic healing (HH) improves clinical outcomes in ulcerative colitis (UC) patients beyond endoscopic healing (EH). We hypothesize that HH is associated with better clinical outcomes in Asian UC patients, for whom data is lacking. Methods: We performed a retrospective study of UC patients in clinical remission (CR) with a follow-up colonoscopy and minimum 1-year follow-up post-colonoscopy. Primary outcome was clinical relapse (CRL), defined as either a Simple Clinical Colitis Activity Index score of > 2, medication escalation, hospitalization or colectomy. Predictors of CRL and HH were assessed. Results: One hundred patients were included with a median follow-up of 22 months. At index colonoscopy, 80 patients were in EH. On follow-up, 41 patients experienced CRL. Of 80 patients in EH, 34 (42.5%) had persistent histologic activity (Nancy Index ≥ 2) and 29 (36.3%) relapsed during the follow-up period. Amongst patients in CR and EH, those with HH had lower CRL rate (26.1% vs. 50.0%, P= 0.028) and longer CRL-free survival (mean 46.1 months vs. 31.5 months, P= 0.015) than those with persistent histologic activity. On bivariable analysis of 100 patients in CR, HH, and Mayo endoscopic score (MES) of 0 were significantly associated with lower risk of CRL. On multivariable analysis, only MES 0 remained predictive of lower CRL risk. Conclusions Above and beyond CR and EH, achieving HH improves clinical outcomes in Asian UC patients. However, HH may not confer incremental benefit if MES 0 has been achieved. Further prospective studies evaluating the benefit of histologically guided therapeutic decisions are needed.

Background/Aims: Growing evidence suggests histologic healing (HH) improves clinical outcomes in ulcerative colitis (UC) patients beyond endoscopic healing (EH). We hypothesize that HH is associated with better clinical outcomes in Asian UC patients, for whom data is lacking. Methods: We performed a retrospective study of UC patients in clinical remission (CR) with a follow-up colonoscopy and minimum 1-year follow-up post-colonoscopy. Primary outcome was clinical relapse (CRL), defined as either a Simple Clinical Colitis Activity Index score of > 2, medication escalation, hospitalization or colectomy. Predictors of CRL and HH were assessed. Results: One hundred patients were included with a median follow-up of 22 months. At index colonoscopy, 80 patients were in EH. On follow-up, 41 patients experienced CRL. Of 80 patients in EH, 34 (42.5%) had persistent histologic activity (Nancy Index ≥ 2) and 29 (36.3%) relapsed during the follow-up period. Amongst patients in CR and EH, those with HH had lower CRL rate (26.1% vs. 50.0%, P= 0.028) and longer CRL-free survival (mean 46.1 months vs. 31.5 months, P= 0.015) than those with persistent histologic activity. On bivariable analysis of 100 patients in CR, HH, and Mayo endoscopic score (MES) of 0 were significantly associated with lower risk of CRL. On multivariable analysis, only MES 0 remained predictive of lower CRL risk. Conclusions Above and beyond CR and EH, achieving HH improves clinical outcomes in Asian UC patients. However, HH may not confer incremental benefit if MES 0 has been achieved. Further prospective studies evaluating the benefit of histologically guided therapeutic decisions are needed.

Background/Aims: Growing evidence suggests histologic healing (HH) improves clinical outcomes in ulcerative colitis (UC) patients beyond endoscopic healing (EH). We hypothesize that HH is associated with better clinical outcomes in Asian UC patients, for whom data is lacking. Methods: We performed a retrospective study of UC patients in clinical remission (CR) with a follow-up colonoscopy and minimum 1-year follow-up post-colonoscopy. Primary outcome was clinical relapse (CRL), defined as either a Simple Clinical Colitis Activity Index score of > 2, medication escalation, hospitalization or colectomy. Predictors of CRL and HH were assessed. Results: One hundred patients were included with a median follow-up of 22 months. At index colonoscopy, 80 patients were in EH. On follow-up, 41 patients experienced CRL. Of 80 patients in EH, 34 (42.5%) had persistent histologic activity (Nancy Index ≥ 2) and 29 (36.3%) relapsed during the follow-up period. Amongst patients in CR and EH, those with HH had lower CRL rate (26.1% vs. 50.0%, P= 0.028) and longer CRL-free survival (mean 46.1 months vs. 31.5 months, P= 0.015) than those with persistent histologic activity. On bivariable analysis of 100 patients in CR, HH, and Mayo endoscopic score (MES) of 0 were significantly associated with lower risk of CRL. On multivariable analysis, only MES 0 remained predictive of lower CRL risk. Conclusions Above and beyond CR and EH, achieving HH improves clinical outcomes in Asian UC patients. However, HH may not confer incremental benefit if MES 0 has been achieved. Further prospective studies evaluating the benefit of histologically guided therapeutic decisions are needed.

Background Fine particulate matter (PM_2.5) monitoring stations may generate missing data for a certain period of time due to various factors. This data loss will adversely affect air quality assessment and pollution control decision-making. Objective To propose an inverse distance weighted (IDW) spatiotemporal interpolation method based on particle swarm optimization (PSO) to interpolate and fill missing PM_2.5 spatiotemporal sequence data and increase interpolation accuracy. Methods An interpolation experiment was designed into two parts. The first part used hourly PM_2.5 observational data from four moments on January 1, 2017 in the Yangtze River Delta region. The second part employed daily PM_2.5 observational data from the first 10 d of January 2017 in the Beijing-Tianjin-Hebei region. Interpolation accuracy was evaluated using four metrics: root mean square error (RMSE), mean absolute error (MAE), mean absolute percentage error (MAPE), and mean relative error (MRE). Results IDW spatiotemporal interpolation method optimized with PSO significantly improved the accuracy of filling missing PM_2.5 spatiotemporal sequence data. In the hourly-scale experiment conducted in the Yangtze River Delta region, compared to a distance index of 2, the accuracy metrics RMSE, MAE, MAPE, and MRE generated by the proposed method improved on average by 0.17 μg·m⁻³, 0.27 μg·m⁻³, 0.17%, and 0.01%, respectively. The PM_2.5 spatial field maps generated for four moments based on this method clearly illustrated the spatiotemporal distribution characteristics of hourly PM_2.5 concentrations in the Yangtze River Delta region. In the daily-scale experiment conducted in the Beijing-Tianjin-Hebei region, the PSO-optimized distance index outperformed the traditional method, with interpolation accuracy improvements of approximately 0.215 μg·m⁻³, 0.283 μg·m⁻³, 0.174%, and 0.014%, respectively. Furthermore, the seasonal PM_2.5 spatial field maps generated by this method revealed the spatiotemporal distribution characteristics of PM_2.5 concentrations in the Beijing-Tianjin-Hebei region across different seasons, further validating the effectiveness and applicability of this method. Conclusion The IDW spatiotemporal interpolation method optimized with PSO is highly accurate and reliable for interpolating the missing data in the Yangtze River Delta region and the Beijing-Tianjin-Hebei region, providing valuable insights for air pollution control and public health protection.

With the widespread use of antibiotics, drug-resistant bacterial infections have become a significant threat to human health. Finding new antibacterial strategies that can effectively control drug-resistant bacterial infections has become an urgent task. Unlike small molecule drugs that target bacterial proteins, antisense oligonucleotide (ASO) can target genes related to bacterial resistance, pathogenesis, growth, reproduction and biofilm formation. By regulating the expression of these genes, ASO can inhibit or kill bacteria, providing a novel approach for the development of antibacterial drugs. To overcome the challenge of delivering antisense oligonucleotide into bacterial cells, various drug delivery systems have been applied in this field, including cell-penetrating peptides, lipid nanoparticles and inorganic nanoparticles, which have injected new momentum into the development of antisense oligonucleotide in the antibacterial realm. This review summarizes the current development of small nucleic acid drugs, the antibacterial mechanisms, targets, sequences and delivery vectors of antisense oligonucleotide, providing a reference for the research and development of antisense oligonucleotide in the treatment of bacterial infections.

In this study, we constructed a GLP-2R-HEK293 cell line and established a method for the determination of the in vitro biological activity of teduglutide based on HTRF, after optimizing experimental conditions and methodological verification. We also carried out relative potency detection of teduglutide pharmaceutical products using this method. The result showed that there was a quantitative-efficient relationship between the teduglutide activity and cAMP contents in GLP-2R-HEK293 cells, which conformed to four-parameter model. Method verification results of five concentrations of teduglutide (64%, 80%, 100%, 125% and 156%) met the requirements of the General Rules of Chinese Pharmacopoeia, 2020 edition, Volume IV (9401). We then analyzed the relative potency of three batches of teduglutide drug substances and three batches of drug products. The linearity, regression and parallelism of the obtained curves all fit the system suitability requirements. The relative potency of six batches of teduglutide was from 83% to 105%. In summary, the biological activity detection method established in this study was accurate, precise, simple and time-saving, which can be used for quality control of teduglutide pharmaceutical products.

Idiopathic pulmonary fibrosis （IPF） can be classified as pulmonary collateral disease，and its pathogenesis is mainly characterized by the loss of Qi meridian nourishment，the loss of Yin meridian nourishment，and the formation of blood stasis in the blood vessels. Qi Yin deficiency is the pathological basis that runs through IPF，and obstruction of meridians and collaterals is a key element in the development of the disease. The dysfunction of "spleen being in charge of the defensive function" is closely related to the formation of the pathological pattern of "lung deficiency and collateral stasis" in IPF. The term "spleen being in charge of the defensive function" originated from the Yellow Emperor's Inner Canon. If the spleen is healthy，the Qi will be filled with vitality. Positive energy is stored inside，evil cannot be dried up. Its concept is quite similar to the immune defense function in modern medicine. If the principle of "spleen being in charge of the defensive function" is lost，the key structure and function of the IPF alveolar epithelial barrier may be abnormal，and it can interact with various innate immune cells to promote inflammation and fibrosis processes. Therefore，this article explains the imbalance of immune homeostasis in IPF alveolar epithelium from two aspects：the barrier function of alveolar epithelial cells（AECs） and their interaction with innate immune cells. And based on the theory of "spleen being in charge of the defensive function"，using traditional Chinese medicine for strengthening the spleen and nourishing Qi to treat IPF from the perspective of the spleen. This not only strengthens the scientific connotation of "spleen being in charge of the defensive function" in the pathogenesis of IPF，but also provides new research directions and ideas for its future clinical prevention and treatment.

Insulin-like growth factor 2 (IGF2) is a critical endocrine mediator implicated in male reproductive physiology. To investigate the correlation between IGF2 protein levels and various aspects of male infertility, specifically focusing on sperm quality, inflammation, and DNA damage, a cohort of 320 male participants was recruited from the Women's Hospital, Zhejiang University School of Medicine (Hangzhou, China) between 1 st January 2024 and 1 st March 2024. The relationship between IGF2 protein concentrations and sperm parameters was assessed, and Spearman correlation and linear regression analysis were employed to evaluate the independent associations between IGF2 protein levels and risk factors for infertility. Enzyme-linked immunosorbent assay (ELISA) was used to measure IGF2 protein levels in seminal plasma, alongside markers of inflammation (tumor necrosis factor-alpha [TNF-α] and interleukin-1β [IL-1β]). The relationship between seminal plasma IGF2 protein levels and DNA damage marker phosphorylated histone H2AX (γ-H2AX) was also explored. Our findings reveal that IGF2 protein expression decreased notably in patients with asthenospermia and teratospermia. Correlation analysis revealed nuanced associations between IGF2 protein levels and specific sperm parameters, and low IGF2 protein concentrations correlated with increased inflammation and DNA damage in sperm. The observed correlations between IGF2 protein levels and specific sperm parameters, along with its connection to inflammation and DNA damage, underscore the importance of IGF2 in the broader context of male reproductive health. These findings lay the groundwork for future research and potential therapeutic interventions targeting IGF2-related pathways to enhance male fertility.
Humans ; Male ; Insulin-Like Growth Factor II/metabolism* ; Infertility, Male/genetics* ; DNA Damage ; Adult ; Inflammation/metabolism* ; Spermatozoa/metabolism* ; Semen Analysis ; Semen/metabolism* ; Tumor Necrosis Factor-alpha/metabolism* ; Histones/metabolism* ; Interleukin-1beta/metabolism*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test