1.Bali Chronic Constipation Roundtable Report: Chronic ConstipationManagement in Asia
Yi Ping REN ; Wah Loong CHAN ; Kee Huat CHUAH ; Yong Sung KIM ; Atsushi NAKAJIMA ; Sanjiv MAHADEVA ; Yeong Yeh LEE ; Andrew S B CHUA ; Tao BAI ; Ari Fahrial SYAM ; Chien-Lin CHEN ; Ching-Liang LU ; M. Masudur RAHMAN ; Tanisa PATCHARATRAKUL ; Victoria Ping Y TAN ; Dao Viet HANG ; Xiaohua HOU ; Yinglian XIAO ; Justin WU ; Uday C GHOSHAL ; Hidekazu SUZUKI ; Sutep GONLACHANVIT ; Kewin T H SIAH
Journal of Neurogastroenterology and Motility 2026;32(1):109-128
Background/Aims:
Chronic constipation is prevalent yet under-diagnosed across Asia, compromising quality of life and burdening healthcare systems. Cultural stigma, varied diets, and limited access to standardized diagnostic tools delay timely care.
Methods:
The Bali Chronic Constipation Roundtable in November 2024, brought together experts from 11 Asian countries. The group reviewed epidemiological data, analyzed multinational questionnaire on clinical practice pattern, and conducted structured discussions to identify key barriers and propose region-specific recommendations.
Results:
Chronic constipation prevalence varies across Asia, ranging from 1.8% in India to 16.6% in Japan, with women and the elderly disproportionately affected. Under-reporting persists owing to cultural taboos and widespread self treatment with laxatives and traditional medications. Although the Rome IV criteria remains the global standard, they may not fully reflect Asian symptom profiles, and diagnosis is limited by scarce motility laboratories. First line therapies such as dietary-fiber optimization and osmotic laxatives are widely available, but newer pharmacotherapies (prucalopride, linaclotide, lubiprostone, and elobixibat) remain costly and unevenly accessible. Biofeedback for dyssynergic defecation is underutilized due to limited availability. Experts recommend expanded regional research on to refine diagnostic criteria, coupled with enhanced physician education and public awareness. They advocate accessibility to second-line and novel therapies that incorporate culturally attuned regional guidelines, and improved access to gastrointestinal motility testing.
Conclusions
The Bali Chronic Constipation Roundtable highlighted Asia’s need for region specific diagnostics and management. Addressing diagnostic and treatment gaps will improve outcomes, while ongoing researcher clinician policy collaboration must standardize guidelines, advance research, and ensure equitable care across Asia.
2.Plasma metabolites,immune cells,and hip osteoarthritis:causal inference based on GWAS data from European populations
Xiangbin RONG ; Haibo ZHENG ; Xueshen MO ; Kun HOU ; Ping ZENG
Chinese Journal of Tissue Engineering Research 2026;30(4):1028-1035
BACKGROUND:Some studies have confirmed the changes in the function of immune cell subsets such as monocytes,T cells,B cells,and natural killer cells(NK cells)in patients with osteoarthritis,but the specific regulatory mechanisms are unclear.OBJECTIVE:To explore the causal relationship between plasma metabolite-mediated immune cells and hip osteoarthritis.METHODS:The Genome-Wide Association Studies(GWAS)data of 731 immune cells were used as the exposure,the GWAS data of hip osteoarthritis were used as the outcome,and 1 400 plasma metabolites were selected as mediating factors.The GWAS database is an important database for genetic association studies,maintained by international organizations with no country-specific affiliation.The inverse variance weighting method in the two-sample Mendelian randomization method was the main method,and the Bayesian weighted Mendelian randomization method was used to analyze the prior distribution,sample data and weights,which were then used to calculate the posterior distribution.The accuracy and reliability of the inverse variance weighting results were evaluated according to the posterior distribution,supplemented by MR-Egger,weighted median,simple model,and weighted mode methods.The pliotropy test and heterogeneity test were used to ensure the robustness of the process.The results of the inverse variance weighting method were used for subsequent mediating effect analysis.RESULTS AND CONCLUSION:(1)The inverse variance weighting method identified 4 immune cells strongly correlated with hip osteoarthritis,and 20 metabolites strongly associated with hip osteoarthritis,all of which had no reverse causal relationship.At the same time,the validation results of Bayesian weighted Mendelian randomization method showed that the posterior mean value was similar to the estimated value of the inverse variance weighting,and the posterior variance was relatively lower.One monocyte subtype(PDL-1 on CD14-CD16+)was finally screened out to have a causal relationship with hip osteoarthritis,with a total effect of-0.047(odds ratio=0.954,95%confidence interval:0.926-0.983),and a mediating effect of-0.004(odds ratio=0.939,95%confidence interval:0.902-0.978)mediated by alliin levels,accounting for 8.5%of the total effect.It was concluded that alliin is a protective factor in the progression of hip osteoarthritis,in which this metabolite plays a mediating role.(2)The large amount of data from international databases and European population analysis is of great significance to Chinese biomedicine,which can provide clues for research on the genetic susceptibility to similar diseases in the Chinese population,aiding in discovering the unique associations.The pharmacogenomic approaches used can be adapted to screen for drug response genes in the Chinese population,enhancing the precision of personalized medicine.Additionally,the advanced high-throughput technologies and statistical methods employed can be learned and applied to disease prevention and treatment research.
3.Plasma metabolites,immune cells,and hip osteoarthritis:causal inference based on GWAS data from European populations
Xiangbin RONG ; Haibo ZHENG ; Xueshen MO ; Kun HOU ; Ping ZENG
Chinese Journal of Tissue Engineering Research 2026;30(4):1028-1035
BACKGROUND:Some studies have confirmed the changes in the function of immune cell subsets such as monocytes,T cells,B cells,and natural killer cells(NK cells)in patients with osteoarthritis,but the specific regulatory mechanisms are unclear.OBJECTIVE:To explore the causal relationship between plasma metabolite-mediated immune cells and hip osteoarthritis.METHODS:The Genome-Wide Association Studies(GWAS)data of 731 immune cells were used as the exposure,the GWAS data of hip osteoarthritis were used as the outcome,and 1 400 plasma metabolites were selected as mediating factors.The GWAS database is an important database for genetic association studies,maintained by international organizations with no country-specific affiliation.The inverse variance weighting method in the two-sample Mendelian randomization method was the main method,and the Bayesian weighted Mendelian randomization method was used to analyze the prior distribution,sample data and weights,which were then used to calculate the posterior distribution.The accuracy and reliability of the inverse variance weighting results were evaluated according to the posterior distribution,supplemented by MR-Egger,weighted median,simple model,and weighted mode methods.The pliotropy test and heterogeneity test were used to ensure the robustness of the process.The results of the inverse variance weighting method were used for subsequent mediating effect analysis.RESULTS AND CONCLUSION:(1)The inverse variance weighting method identified 4 immune cells strongly correlated with hip osteoarthritis,and 20 metabolites strongly associated with hip osteoarthritis,all of which had no reverse causal relationship.At the same time,the validation results of Bayesian weighted Mendelian randomization method showed that the posterior mean value was similar to the estimated value of the inverse variance weighting,and the posterior variance was relatively lower.One monocyte subtype(PDL-1 on CD14-CD16+)was finally screened out to have a causal relationship with hip osteoarthritis,with a total effect of-0.047(odds ratio=0.954,95%confidence interval:0.926-0.983),and a mediating effect of-0.004(odds ratio=0.939,95%confidence interval:0.902-0.978)mediated by alliin levels,accounting for 8.5%of the total effect.It was concluded that alliin is a protective factor in the progression of hip osteoarthritis,in which this metabolite plays a mediating role.(2)The large amount of data from international databases and European population analysis is of great significance to Chinese biomedicine,which can provide clues for research on the genetic susceptibility to similar diseases in the Chinese population,aiding in discovering the unique associations.The pharmacogenomic approaches used can be adapted to screen for drug response genes in the Chinese population,enhancing the precision of personalized medicine.Additionally,the advanced high-throughput technologies and statistical methods employed can be learned and applied to disease prevention and treatment research.
4.Application Value of Scales for Symptom & Syndrome Evaluation in Spleen-Stomach Diseases Related New Drug Research and Development
Fengbin LIU ; Simeng YAO ; Ping WANG ; Liqun BIAN ; Zhengkun HOU ; Xudong TANG
Journal of Traditional Chinese Medicine 2026;67(5):504-509
Symptom and syndrome efficacy evaluation scales are indispensable tools for clinical efficacy assessment in traditional Chinese medicine (TCM), and hold significant value at all stages of new drug research development for spleen and stomach diseases. These scales can provide scientific basis for clinical positioning, efficacy evaluation, and expansion of indications of new drugs. By analyzing the current hotspots and difficulties in research, this study aims to explore the important significance of these scales in the development of new drugs for spleen and stomach diseases, summarize the domestic research progress, and conduct comparative analyses with international studies. Future development trends are also discussed in order to promote the application of symptom and syndrome efficacy evaluation scales in the development of new drugs for spleen and stomach diseases and to advance the moder-nization process of TCM.
5.The Association of Iodixanol With Renal and Cardiovascular Safety in Patients With ST-Elevation Myocardial Infarction Undergoing Primary Percutaneous Coronary Intervention:A Prospective Cohort Study
Zhaoping LIU ; Jian AN ; Aijie HOU ; Yanqin REN ; Lei QIN ; Xiaojie CHEN ; Guozhen HAO ; Xi SU ; Ping YANG ; Guidong SHEN ; Shenghuang WANG ; In-ho CHAE ; Yong HUO
Journal of Cardiovascular Intervention 2026;5(1):38-48
Background:
This study was performed to characterize the incidence, costs, and risk factors associated with renal and cardiovascular adverse outcomes following primary percutaneous coronary intervention (pPCI) in patients with ST-elevation myocardial infarction (STEMI).
Methods:
Patients with STEMI who underwent pPCI using iso-osmolar contrast were enrolled at 39 centers. The incidence of acute kidney injury (AKI) and major adverse renal and cardiovascular events (MARCE) was analyzed, as well as inpatient costs. Logistic regression analysis was performed to identify risk factors.
Results:
Among 2,293 patients, the incidence of AKI and MARCE within 72 hours post-pPCI was 4.14% (n = 95) and 4.40% (n = 101), respectively. AKI and/or MARCE were associated with systolic blood pressure (AKI: odds ratio [OR], 1.009; 95% confidence interval [CI], 1.000–1.018), hypertension (AKI: OR, 1.815; 95% CI, 1.133–2.906; MARCE: OR, 1.760;95% CI, 1.118–2.769), anterior wall infarction (AKI: OR, 1.895; 95% CI, 1.196–3.004; MARCE:OR, 1.939; 95% CI, 1.240–3.032), Killip class (AKI: OR, 1.465; 95% CI, 1.117–1.922; MARCE:OR, 1.467; 95% CI, 1.131–1.903), and serum creatinine (SCr; MARCE: OR, 1.006; 95% CI, 1.000–1.012). Hospitalization costs for patients with STEMI who developed AKI or MARCE were significantly higher than for those without AKI (9,595 ± 5,795 vs. 8,279 ± 3,872 USD, P = 0.003) or without MARCE (9,890 ± 5,616 vs. 8,255 ± 3,859 USD, P < 0.001).
Conclusions
In patients with STEMI undergoing pPCI with iso-osmolar contrast, the incidence of AKI and MARCE was associated with higher hospitalization costs. Systolic blood pressure, hypertension, anterior wall infarction, Killip class, and SCr were identified as risk factors for these outcomes.
6.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
7.Glucocorticoid Discontinuation in Patients with Rheumatoid Arthritis under Background of Chinese Medicine: Challenges and Potentials Coexist.
Chuan-Hui YAO ; Chi ZHANG ; Meng-Ge SONG ; Cong-Min XIA ; Tian CHANG ; Xie-Li MA ; Wei-Xiang LIU ; Zi-Xia LIU ; Jia-Meng LIU ; Xiao-Po TANG ; Ying LIU ; Jian LIU ; Jiang-Yun PENG ; Dong-Yi HE ; Qing-Chun HUANG ; Ming-Li GAO ; Jian-Ping YU ; Wei LIU ; Jian-Yong ZHANG ; Yue-Lan ZHU ; Xiu-Juan HOU ; Hai-Dong WANG ; Yong-Fei FANG ; Yue WANG ; Yin SU ; Xin-Ping TIAN ; Ai-Ping LYU ; Xun GONG ; Quan JIANG
Chinese journal of integrative medicine 2025;31(7):581-589
OBJECTIVE:
To evaluate the dynamic changes of glucocorticoid (GC) dose and the feasibility of GC discontinuation in rheumatoid arthritis (RA) patients under the background of Chinese medicine (CM).
METHODS:
This multicenter retrospective cohort study included 1,196 RA patients enrolled in the China Rheumatoid Arthritis Registry of Patients with Chinese Medicine (CERTAIN) from September 1, 2019 to December 4, 2023, who initiated GC therapy. Participants were divided into the Western medicine (WM) and integrative medicine (IM, combination of CM and WM) groups based on medication regimen. Follow-up was performed at least every 3 months to assess dynamic changes in GC dose. Changes in GC dose were analyzed by generalized estimator equation, the probability of GC discontinuation was assessed using Kaplan-Meier curve, and predictors of GC discontinuation were analyzed by Cox regression. Patients with <12 months of follow-up were excluded for the sensitivity analysis.
RESULTS:
Among 1,196 patients (85.4% female; median age 56.4 years), 880 (73.6%) received IM. Over a median 12-month follow-up, 34.3% (410 cases) discontinued GC, with significantly higher rates in the IM group (40.8% vs. 16.1% in WM; P<0.05). GC dose declined progressively, with IM patients demonstrating faster reductions (median 3.75 mg vs. 5.00 mg in WM at 12 months; P<0.05). Multivariate Cox analysis identified age <60 years [P<0.001, hazard ratios (HR)=2.142, 95% confidence interval (CI): 1.523-3.012], IM therapy (P=0.001, HR=2.175, 95% CI: 1.369-3.456), baseline GC dose ⩽7.5 mg (P=0.003, HR=1.637, 95% CI: 1.177-2.275), and absence of non-steroidal anti-inflammatory drugs use (P=0.001, HR=2.546, 95% CI: 1.432-4.527) as significant predictors of GC discontinuation. Sensitivity analysis (545 cases) confirmed these findings.
CONCLUSIONS
RA patients receiving CM face difficulties in following guideline-recommended GC discontinuation protocols. IM can promote GC discontinuation and is a promising strategy to reduce GC dependency in RA management. (Trial registration: ClinicalTrials.gov, No. NCT05219214).
Adult
;
Aged
;
Female
;
Humans
;
Male
;
Middle Aged
;
Arthritis, Rheumatoid/drug therapy*
;
Glucocorticoids/therapeutic use*
;
Medicine, Chinese Traditional
;
Retrospective Studies
8.Nonsurgical Treatment of Chronic Subdural Hematoma Patients with Chinese Medicine: Case Report Series.
Kang-Ning LI ; Wei-Ming LIU ; Ying-Zhi HOU ; Run-Fa TIAN ; Shuo ZHANG ; Liang WU ; Long XU ; Jia-Ji QIU ; Yan-Ping TONG ; Tao YANG ; Yong-Ping FAN
Chinese journal of integrative medicine 2025;31(10):937-941
9.International clinical practice guideline on the use of traditional Chinese medicine for functional dyspepsia (2025).
Sheng-Sheng ZHANG ; Lu-Qing ZHAO ; Xiao-Hua HOU ; Zhao-Xiang BIAN ; Jian-Hua ZHENG ; Hai-He TIAN ; Guan-Hu YANG ; Won-Sook HONG ; Yu-Ying HE ; Li LIU ; Hong SHEN ; Yan-Ping LI ; Sheng XIE ; Jin SHU ; Bin-Fang ZENG ; Jun-Xiang LI ; Zhen LIU ; Zheng-Hua XIAO ; Jing-Dong XIAO ; Pei-Yong ZHENG ; Shao-Gang HUANG ; Sheng-Liang CHEN ; Gui-Jun FEI
Journal of Integrative Medicine 2025;23(5):502-518
Functional dyspepsia (FD), characterized by persistent or recurrent dyspeptic symptoms without identifiable organic, systemic or metabolic causes, is an increasingly recognized global health issue. The objective of this guideline is to equip clinicians and nursing professionals with evidence-based strategies for the management and treatment of adult patients with FD using traditional Chinese medicine (TCM). The Guideline Development Group consulted existing TCM consensus documents on FD and convened a panel of 35 clinicians to generate initial clinical queries. To address these queries, a systematic literature search was conducted across PubMed, EMBASE, the Cochrane Library, China National Knowledge Infrastructure (CNKI), VIP Database, China Biology Medicine (SinoMed) Database, Wanfang Database, Traditional Medicine Research Data Expanded (TMRDE), and the Traditional Chinese Medical Literature Analysis and Retrieval System (TCMLARS). The evidence from the literature was critically appraised using the Grading of Recommendations Assessment, Development, and Evaluation (GRADE) approach. The strength of the recommendations was ascertained through a consensus-building process involving TCM and allopathic medicine experts, methodologists, pharmacologists, nursing specialists, and health economists, leveraging their collective expertise and empirical knowledge. The guideline comprises a total of 43 evidence-informed recommendations that span a range of clinical aspects, including the pathogenesis according to TCM, diagnostic approaches, therapeutic interventions, efficacy assessments, and prognostic considerations. Please cite this article as: Zhang SS, Zhao LQ, Hou XH, Bian ZX, Zheng JH, Tian HH, Yang GH, Hong WS, He YY, Liu L, Shen H, Li YP, Xie S, Shu J, Zeng BF, Li JX, Liu Z, Xiao ZH, Xiao JD, Zheng PY, Huang SG, Chen SL, Fei GJ. International clinical practice guideline on the use of traditional Chinese medicine for functional dyspepsia (2025). J Integr Med. 2025; 23(5):502-518.
Dyspepsia/drug therapy*
;
Humans
;
Medicine, Chinese Traditional/methods*
;
Practice Guidelines as Topic
;
Drugs, Chinese Herbal/therapeutic use*
10.(Meta)transcriptomic Insights into the Role of Ticks in Poxvirus Evolution and Transmission: A Multicontinental Analysis.
Yu Xi WANG ; Jing Jing HU ; Jing Jing HOU ; Xiao Jie YUAN ; Wei Jie CHEN ; Yan Jiao LI ; Qi le GAO ; Yue PAN ; Shui Ping LU ; Qi CHEN ; Si Ru HU ; Zhong Jun SHAO ; Cheng Long XIONG
Biomedical and Environmental Sciences 2025;38(9):1058-1070
OBJECTIVE:
Poxviruses are zoonotic pathogens that infect humans, mammals, vertebrates, and arthropods. However, the specific role of ticks in transmission and evolution of these viruses remains unclear.
METHODS:
Transcriptomic and metatranscriptomic raw data from 329 sampling pools of seven tick species across five continents were mined to assess the diversity and abundance of poxviruses. Chordopoxviral sequences were assembled and subjected to phylogenetic analysis to trace the origins of the unblasted fragments within these sequences.
RESULTS:
Fifty-eight poxvirus species, representing two subfamilies and 20 genera, were identified, with 212 poxviral sequences assembled. A substantial proportion of AT-rich fragments were detected in the assembled poxviral genomes. These genomic sequences contained fragments originating from rodents, archaea, and arthropods.
CONCLUSION
Our findings indicate that ticks play a significant role in the transmission and evolution of poxviruses. These viruses demonstrate the capacity to modulate virulence and adaptability through horizontal gene transfer, gene recombination, and gene mutations, thereby promoting co-existence and co-evolution with their hosts. This study advances understanding of the ecological dynamics of poxvirus transmission and evolution and highlights the potential role of ticks as vectors and vessels in these processes.
Animals
;
Poxviridae/physiology*
;
Ticks/virology*
;
Phylogeny
;
Transcriptome
;
Evolution, Molecular
;
Poxviridae Infections/virology*
;
Genome, Viral

Result Analysis
Print
Save
E-mail