1.Clinical features and genetic analysis of a patient with type 2 neurofibromatosis manifested as oculomotor nerve palsy.
Xinghuan DING ; Bo LIANG ; Tingyu LIANG ; Jingjing LI ; Fang WANG ; Enshan FENG
Chinese Journal of Medical Genetics 2023;40(7):851-855
OBJECTIVE:
To report on a rare case of Neurofibromatosis type 2 (NF2) manifesting as oculomotor nerve palsy and explore its genetic basis.
METHODS:
A patient with NF2 who had presented at Beijing Ditan Hospital Affiliated to Capital Medical University on July 10, 2021 was selected as the study subject. Cranial and spinal cord magnetic resonance imaging (MRI) was carried out on the patient and his parents. Peripheral blood samples were collected and subjected to whole exome sequencing. Candidate variant was verified by Sanger sequencing.
RESULTS:
MRI revealed bilateral vestibular Schwannomas, bilateral cavernous sinus meningiomas, popliteal neurogenic tumors, and multiple subcutaneous nodules in the patient. DNA sequencing revealed that he has harbored a de novo nonsense variant of the NF2 gene, namely c.757A>T, which has replaced a codon (AAG) encoding lysine (K) at position 253 with a stop codon (TAG). This has resulted in removal of the Merlin protein encoded by the NF2 gene from position 253 onwards. The variant was not found in public databases. Bioinformatic analysis suggested that the corresponding amino acid is highly conserved. Based on the guidelines from the American College of Medical Genetics and Genomics (ACMG), the variant was rated as pathogenic (PVS1+PS2+PM2_Supporting+PP3+PP4).
CONCLUSION
The heterozygous nonsense variant c.757A>T (p.K253*) of the NF2 gene probably underlay the disease in this patient with an early onset, atypical but severe phenotype.
Male
;
Humans
;
Neurofibromatosis 2/genetics*
;
Genes, Neurofibromatosis 2
;
Oculomotor Nerve Diseases/genetics*
;
Computational Biology
;
Genomics
;
Mutation
2.Simultaneous cochlear implantation and translabyrinthine removal of vestibular schwannoma in type 2 neurofibromatosis caused by a deletion of 22q12.1-q12.2 including NF2 gene.
Qiu Jing ZHANG ; Guo Jian WANG ; Wei Dong SHEN ; Meng Di HONG ; Fen XIONG ; Qiu Ju WANG ; Dong Yi HAN
Chinese Journal of Otorhinolaryngology Head and Neck Surgery 2021;56(11):1199-1204
3.Expression of NF2 Modulates the Progression of BRAFV600E Mutated Thyroid Cancer Cells
Mi Hyeon YOU ; Min Ji JEON ; Tae Yong KIM ; Won Bae KIM ; Young Kee SHONG ; Won Gu KIM
Endocrinology and Metabolism 2019;34(2):203-212
BACKGROUND: We previously reported the frequent neurofibromatosis 2 (NF2) gene mutations in anaplastic thyroid cancers in association with the BRAF V600E mutation. We aimed to investigate the role of NF2 in thyroid cancer with BRAF mutation. METHODS: To identify the function of NF2 in thyroid cancers, we investigated the changes in cell proliferation, colon formation, migration and invasion of thyroid cancer cells (8505C, BHT101, and KTC-1) with BRAF V600E mutation after overexpression and knock-down of NF2. We also examined how cell proliferation changed when NF2 was mutagenized. Human NF2 expression in papillary thyroid carcinoma (PTC) was analyzed using the The Cancer Genome Atlas (TCGA) data. RESULTS: First, NF2 was overexpressed in 8505C and KTC-1 cells. Compared to control, NF2 overexpressed group of both thyroid cancer cells showed significant inhibition in cell proliferation and colony formation. These results were also confirmed by cell migration and invasion assay. After knock-down of NF2 in 8505C cells, there were no significant changes in cell proliferation and colony formation, compared with the control group. However, after mutagenized S288* and Q470* sites of NF2 gene, the cell proliferation increased compared to NF2 overexpression group. In the analysis of TCGA data, the mRNA expression of NF2 was significantly decreased in PTCs with lateral cervical lymph node (LN) metastasis compared with PTCs without LN metastasis. CONCLUSION: Our study suggests that NF2 might play a role as a tumor suppressor in thyroid cancer with BRAF mutation. More studies are needed to elucidate the mechanism how NF2 acts in thyroid cancer with BRAF mutation.
Cell Movement
;
Cell Proliferation
;
Colon
;
Genes, Neurofibromatosis 2
;
Genes, Tumor Suppressor
;
Genome
;
Humans
;
Lymph Nodes
;
Neoplasm Metastasis
;
Neurofibromatosis 2
;
RNA, Messenger
;
Thyroid Carcinoma, Anaplastic
;
Thyroid Gland
;
Thyroid Neoplasms
4.Genetic and clinical characteristics of Korean patients with neurofibromatosis type 2.
Hye ji KIM ; Go Hun SEO ; Yoon Myung KIM ; Gu Hwan KIM ; Eul Ju SEO ; Young Shin RA ; Jin Ho CHOI ; Han Wook YOO ; Beom Hee LEE
Journal of Genetic Medicine 2017;14(2):56-61
PURPOSE: Neurofibromatosis type 2 (NF2) is characterized by multiple tumors, including vestibular schwannoma (VS) and others affecting cranial and peripheral nerves. NF2 is caused by mutation of the NF2 gene. The mutation spectrum of NF2 has not been characterized in Korean patients. In the current study, the clinical and genetic characteristics of Korean NF2 patients were analyzed. MATERIALS AND METHODS: Twenty-five unrelated Korean families were enrolled according to the Manchester criteria. Genetic analysis was performed by direct sequencing and multiplex ligation-dependent probe amplification methods using genomic DNA from peripheral lymphocytes or tumor tissues. RESULTS: All patients had bilateral/unilateral VS and/or other cranial and peripheral nerve tumors. Two patients were familial cases and the other 24 patients were sporadic. Germline NF2 mutations were detected in peripheral lymphocytes from both familial cases, but only in 26.1% of the 23 sporadic families. Somatic mutations were also found in tumor tissues from two of the sporadic families. These somatic mutations were not found in peripheral lymphocytes. A total of 10 different mutations including 2 novel mutations were found in 40.0% of studied families. Five mutations (50.0%) were located in exon 6 of NF2, the FERM domain coding region. CONCLUSION: Family history was an important factor in identifying germline NF2 mutations. Further study is required to investigate whether exon 6 is a mutation hotspot in Korean NF2 patients and its correlation to phenotypic severity.
Clinical Coding
;
DNA
;
Exons
;
Genes, Neurofibromatosis 2
;
Humans
;
Korea
;
Lymphocytes
;
Multiplex Polymerase Chain Reaction
;
Neurofibromatoses*
;
Neurofibromatosis 2*
;
Neuroma, Acoustic
;
Peripheral Nerves
;
Peripheral Nervous System Neoplasms
5.Analysis of NF2 gene mutations in intraspinal Schwannomas.
Shuyi LIU ; Shi CHEN ; Kaichuang ZHANG ; Jian LIN ; Qingwu YANG ; Yongliang ZHANG ; Shuiyuan LIU ; Shengze LIU
Chinese Journal of Medical Genetics 2017;34(5):637-641
OBJECTIVETo explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene.
METHODSSamples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing.
RESULTSFour de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations.
CONCLUSIONThe occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.
Adult ; Aged ; Female ; Genes, Neurofibromatosis 2 ; Humans ; Male ; Middle Aged ; Mutation ; Neurilemmoma ; genetics ; Spinal Cord Neoplasms ; genetics
6.Recurred Segmental Schwannomatosis Without Neurofibromatosis Type 2.
Hyun Jeong KIM ; Jong Kyu HAN ; Jae Wan SO ; Hyeon Deuk JO
Soonchunhyang Medical Science 2016;22(2):163-166
Schwannomas are the most common type of benign peripheral nerve sheath tumors. They typically present as a solitary lesion, but multiple schwannomas rarely occur in patients with neurofibromatosis type 2 (NF2), or patients without the other hallmarks of NF2. The latter is termed schwannomatosis. They most commonly occur in the head and neck involving the brachial plexus and spinal nerves. Although rarely found in the extremities, when these masses occur peripherally, they most commonly affect the sciatic, ulnar, and tibial nerve. It is reported that 2.4% to 5% of all patients undergoing schwannoma excision present as schwannomatosis. One-third of patients with schwannomatosis show tumors limited to a single extremity or segment of the spine and it is referred to as segmental schwannomatosis. We report a case of recurred segmental schwannomatosis of the posterior tibial nerve without features of NF2 after schwannoma excision.
Brachial Plexus
;
Extremities
;
Head
;
Humans
;
Neck
;
Nerve Sheath Neoplasms
;
Neurilemmoma
;
Neurofibromatoses*
;
Neurofibromatosis 2*
;
Spinal Nerves
;
Spine
;
Tibial Nerve
7.Hearing Restoration in Neurofibromatosis Type II Patients.
Jeon Mi LEE ; Jin Woo CHANG ; Jae Young CHOI ; Won Seok CHANG ; In Seok MOON
Yonsei Medical Journal 2016;57(4):817-823
Patients with neurofibromatosis type II will eventually succumb to bilateral deafness. For patients with hearing loss, modern medical science technology can provide efficient hearing restoration through a number of various methods. In this article, several hearing restoration methods for patients with neurofibromatosis type II are introduced.
Cochlear Implantation
;
Deafness/*etiology/*therapy
;
*Hearing Aids
;
Humans
;
Neurofibromatosis 2/*complications
8.Multiple Schwannomas of the Spine: Review of the Schwannomatosis or Congenital Neurilemmomatosis: A Case Report.
Sang Hoon LEE ; Se Hoon KIM ; Bum Joon KIM ; Dong Jun LIM
Korean Journal of Spine 2015;12(2):91-94
Schwannomas are the most common benign nerve sheath tumors originating in Schwann cells. With special conditions like neurofibromatosis type 2 or entity called schwannomatosis, patients develop multiple schwannomas. But in clinical setting, distinguishing schwannomatosis from neurofibromatosis type 2 is challengeable. We describe 58-year-old male who presented with severe neuropathic pain, from schwannomatosis featuring multiple schwannomas of spine and trunk, and underwent surgical treatment. We demonstrate his radiologic and clinical findings, and discuss about important clinical features of this condition. To confirm schwannomatosis, we performed brain magnetic resonance imaging, and took his familial history. Staged surgery was done for pathological confirmation and relief of the pain. Schwannomatosis and neurofibromatosis type 2 are similar but different disease. There are diagnostic hallmarks of these conditions, including familial history, pathology, and brain imaging. Because of different prognosis, the two diseases must be distinguished, so diagnostic tests that are mentioned above should be performed in caution.
Brain
;
Diagnostic Tests, Routine
;
Humans
;
Magnetic Resonance Imaging
;
Male
;
Middle Aged
;
Nerve Sheath Neoplasms
;
Neuralgia
;
Neurilemmoma*
;
Neurofibromatosis 2
;
Neuroimaging
;
Pathology
;
Prognosis
;
Schwann Cells
;
Spine*
9.A Case of Cochlear Implantation in Neurofibromatosis Type II.
Se Joon OH ; Ji Hwan PARK ; Keun Ik YI ; Eui Kyung GOH
Korean Journal of Otolaryngology - Head and Neck Surgery 2015;58(7):509-513
Patients with neurofibromatosis type 2 (NF2) develop bilateral vestibular schwannomas that can cause binaural progressive hearing loss in most individuals. Auditory rehabilitation for bilateral profound sensorineural hearing loss in patients with NF2 poses a great therapeutic challenge. An auditory brainstem implantation may be an option after tumor excision, but its hearing results are still relatively unsatisfactory. A cochlear implantation (CI) may be another option in those cases where the cochlear nerve has been left intact after tumor excision or in those cases that have been kept stable after treating with Gamma-Knife. Here we report a case of undergoing CI after having been treated with Gamma-Knife in NF2 and showing improved open-set speech perception.
Auditory Brain Stem Implantation
;
Auditory Brain Stem Implants
;
Cochlear Implantation*
;
Cochlear Implants*
;
Cochlear Nerve
;
Hearing
;
Hearing Loss
;
Hearing Loss, Sensorineural
;
Humans
;
Neurofibromatosis 2*
;
Neuroma, Acoustic
;
Radiosurgery
;
Rehabilitation
;
Speech Perception
10.Treatment research progress on the treatment of neurofibromatosis type 2-associated vestibular schwannoma.
Yingchao ZHAO ; Qin YANG ; Yao JIANG
Journal of Clinical Otorhinolaryngology Head and Neck Surgery 2015;29(10):955-958
Neurofibromatosis type 2 (NF2) is a dominantly inherited genetic condition. Bilateral vestibular schwannoma, which are benign tumors, composed of neoplastic Schwann cells that arise from the eighth cranial nerve, are the hallmark of NF2. Standard approaches for treatment of growing vestibular schwannoma include observation, surgical removal and radiation therapy. Molecular targeted therapies also present great prosperity in recent years. In this review, we summarize the latest progresses on the treatment of NF2-associated vestibular schwannoma.
Humans
;
Molecular Targeted Therapy
;
Neurofibromatosis 2
;
radiotherapy
;
surgery
;
therapy
;
Neuroma, Acoustic
;
radiotherapy
;
surgery
;
therapy

Result Analysis
Print
Save
E-mail