Objective To explore the establishment of a prognostic model based on machine learning algorithm to predict primary graft dysfunction(PGD)in patients with idiopathic pulmonary fibrosis(IPF)after lung transplantation.Methods Clinical data of 226 IPF patients who underwent lung transplantation were retrospectively analyzed.All patients were randomly divided into the training and test sets at a ratio of 7∶3.Using regularized logistic regression,random forest,support vector machine and artificial neural network,the prognostic model was established through variable screening,model establishment and model optimization.The performance of this prognostic model was assessed by the area under the receiver operating characteristic curve(AUC),positive predictive value,negative predictive value and accuracy.Results Sixteen key features were selected for model establishment.The AUC of the four prognostic models all exceeded 0.7.DeLong and McNemar tests found no significant difference in the performance among different models(both P＞0.05).Conclusions Based on four machine learning algorithms,the prognostic model for grade 3 PGD after lung transplantation is preliminarily established.The overall prediction performance of each model is similar,which may predict the risk of grade 3 PGD in IPF patients after lung transplantation.

Objective To observe the value of shear wave elastography(SWE)for evaluating hepatic iron overload in children with β-thalassemia major(β-TM),as well as the correlations of relative parameters with MR T2*value and serum ferritin.Methods Totally 96 children with β-TM and 100 healthy children(control group)were retrospectively enrolled.Children with β-TM were divided into hematopoietic stem cell transplantation(HSCT)group(n=41)or non-HSCT group(n=55)according to underwent HSCT or not.SWE parameters were compared among groups.Spearman correlation was performed to observe the correlations of liver shear wave velocity with MR T2*value and serum ferritin,as well as Young's modulus with MR T2*value and serum ferritin in children with β-TM.Results Liver shear wave velocity(LSWV)and Young's modulus in HSCT group and non-HSCT group were all higher than those in control group(all P＜0.001).No significant difference of LSWV nor Young's modulus was found between HSCT group and non-HSCT group(both P＞0.05).SWE parameters of children with β-TM were moderately and negatively correlated with MR T2*value(r=-0.501,P＜0.05;r=-0.514,P＜0.05),while weakly and positively correlated with serum ferritin(r=0.488,P＜0.05;r=0.470,P＜0.05).Conclusion SWE was helpful for evaluating hepatic iron overload in children with β-TM,with parameters being negatively correlated with MR T2*value and positively correlated with serum ferritin.

Objective:To establish a feasible mouse model of post-stroke dysphagia(PSD).Methods:Thirty C57BL/6 male mice were randomly divided into a sham-operated group(Sham)and a model group(PSD),and the PSD mouse model was made by the photothrombosis method(PT)method,and the sham-operated group was only injec-ted with rose bengal staining solution in the tail vein.The cerebral blood flow of the mice was measured by laser scatter imaging,the ratio of cerebral infarct area was detected by TTC staining,the electromyographic area of the in vivo pha-ryngeal muscle group of mice swallowing was recorded by a multi-conductor physiological recorder MP160,the drinking function of the mice was measured by the 4-min water drinking experiment,and the weight changes were recorded,respectively,at 1,3,and 7 d.Results:Cerebral blood flow decreased at all time points,with a sharp drop in cerebral blood flow at 1 d,gradual recovery of cerebral blood flowat 3 and 7 d,establishment of collateral circulation,and gradu-al reduction of cerebral infarction area;compared with the Sham group,the myoelectric area of the PSD group was reduced at 1 and 3 d(P＜0.05),but with a trend of gradual recovery,and there was no significant difference between the PSD group and the Sham group at 7 d,and water consumption and weight decreased at 4 min at 1,3,and 7 d(P＜0.05).Conclusion:The mice showed some degree of dysphagia symptoms and are expected to be a translational model for PSD.

Objective: To investigate the expression of miR-155 in peripheral blood of type 2 diabetes patients(T2 DM) associated with diabetic foot ulcer(DFU) and its relationship with the onset of DFU. Methods: Sixty newly diagnosed T2 DM patients without DFU(T2 DM group), 112 T2 DM patients with DFU(DFU group), and 60 healthy controls with normal glucose tolerance(NC group) were included. MiR-155 levels were determined by quantitative real-time PCR, while clinical features and risk factors of DFU were explored. Results: A significant decrease in the expression level of miR-155 in peripheral blood was observed in T2 DM group compared with NC group(P<0.05), and a markedly increased miR-155 expression level was noted in DFU group compared with T2 DM group(P<0.01). Moreover, there was a positive correlation between the expression level of miR-155 in peripheral blood and the course of foot ulcer and Wagner grade of foot ulcer(P=0.02,P=0.01) while a negative correlation in the expression level of miR-155 with healing rate of DFU after eight weeks(P=0.04). The multiple stepwise logistic regression analysis confirmed that a high expression of miR-155 was an independent risk factor for DFU(OR=3.98,P=0.002). Conclusion An increased expression of miR-155 in peripheral blood of T2 DM patients is an independent risk factor for DFU and is closely related to the prognosis of DFU.

Objective: To explore the effect of dapagliflozin(DAPA) on the function of rat endothelial progenitor cells(EPCs) culturedin vitroin a high glucose environment. Methods: Bone marrow derived EPCs from sprague-dawley(SD) rats were identified by fluorescence staining. EPCs were divided into control group(CG group), high glucose group(HG group), high glucose + DAPA group(GD group) and high glucose + DAPA + LY294002 group(GDL group). MTT assay, flow cytometry, tubule formation assay were used to detect the viability, apoptosis, tubule formation ability of EPCs, respectively. Western blot was used to detect the protein expression of AKT/eNOS signaling pathway. Results: Compared with CG group, cell viability, the ability to form tubules, the protein expression of p-AKT and p-eNOS, and the ratio of p-AKT/AKT and p-eNOS/eNOS in HG group significantly decreased(P<0.05), while the apoptosis rate of EPCs significantly increased(P<0.05). Compared with HG group, cell viability, the ability to form tubules, the protein expression of p-AKT and p-eNOS, and the ratio of p-AKT/AKT and p-eNOS/eNOS in GD group significantly increased(P<0.05), while the apoptosis rate of EPCs was significantly reduced(P<0.05). Compared with GD group, cell viability, the ability to form tubules, the protein expression of p-AKT and p-eNOS, and the ratio of p-AKT/AKT and p-eNOS/eNOS in GDL group significantly decreased(P<0.05), while the apoptosis rate of EPCs significantly increased(P<0.05). Conclusion DAPA can protect EPCs from high glucose induced functional damage through AKT/eNOS pathway.

A total of 100 insomniacs were randomly divided into intervention and contrast groups (n=50 each).The contrast group took only alprazolam while the intervention group received both alprazolam and other comprehensive regimens,including acupuncture,psychotherapy and traditional Chinese medicine.One course of treatment lasted 10 days for both groups and 6 courses were offered.After comprehensive interventions,as compared with contrast group,the scores of Pittsburgh Sleep Quality Index (PSQI) and Athens Insomnia Scale (AIS) decreased obviously in intervention group (P ＜ 0.05).And the curative rate (46％) and the total efficacious rate (96％) of intervention group were higher than those of contrast group (P ＜ 0.05).

Objective To analyze the dystrophin gene in patients with Duchenne/Becker muscular dystrophy (DMD/BMD) and their family members by multiplex ligation-dependent probe amplification (MLPA) method and to evaluate the application of this method in the mutations detection. Methods The whole dystrophin gene (79 exons) was analyzed by MLPA in 355 patients with DMD/BMD, the mothers of 46 patients with deletion mutation and the mothers of 8 patients with duplication mutation. The results were verified by PCR and sequencing when single exon deletion was found. Results One hundred and ninety cases were found to have deletion of one or more dystrophin exons, and 34 patients were identified to have duplication mutations. In 46 mothers of patients with deletion mutations, 28 were identified the mutations;and of 8 mothers of patients with duplication mutations, 6 were identified the mutations. There was no statistical significance between the carrier incidences in the 2 groups. A 23 bp deletion of AGGGAACAGATCCTGGTAAAGCA fragment in exon 17 was found in a patient. Conclusions Comparing with the traditional quantitative methods, MLPA can detect the deletion and duplication mutation in all the 79 exons of dystrophin gene in DMD/BMD patients, and can identify the carrier status in their family members. Furthermore, MLPA is not apt to be interfered by the concentration and purity of DNA template.

Objective To investigate the spectrum of senataxin gene mutations in Chinese patients with sporadic amyotrophic lateral sclerosis (SALS). Methods Sixty sporadic SALS patients and 200 unrelated normal individuals were screened for mutations of senataxin by PCR-sequencing methodology. Results Two silent mutations, Asp844Asp and Phe998Phe, were identified in two SALS patients, respectively. They were not found in controls. However, a homology search of senataxin gene in different species revealed that these two amino acids were not evolutionarily conserved, indicating that the mutations were not pathogenic. Additional 19 polymorphisms were detected. Conclusion The identification of two silent mutations and 19 polymorphisms has further broadened the spectrum of mutations and polymorhpisms in senataxin.

Objective To evaluate the quantitative technique of real-time amplification refractory mutation system quantitative PCR( RT ARMS-qPCR)in the detection of the mitochondrial DNA A3243G mutation load.To investigate the mutation load in different tissues in patients with mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes (MELAS).Methods Wild type and mutant-type (A3243G) of mitochondrial DNA were cloned into plasmid pMD18-T to construct express vectors. Thirteen standard controls having different proportions of mutation loads were developed by mixing wild-type and mutant-type cloned plasmid DNA in different ratios. The mutation loads in the tissues of blood, muscle, hair follicles and urine from seven patients with MELAS and one carrier, and blood samples in 53 unaffected subjects were detected by lit ARMS-qPCR and PCR-RFLP. ResultsIn standard controls, there was a linear correlation between the expected values and results of mutation loads detected by both methods of PCR-RFLP (R21 = 0. 885 ) and RT ARMS-qPCR (R22 = 0. 991 ) . The results detected by RT ARMS-qPCR were closer to the expected values. The detection of mutation loads in tissues from the patients revealed higher values by liT ARMS-qPCR method than by PCR-RFLP and RT ARMS-qPCR was more sensitive in detecting the lower A3243G mutation load. The mutation load in muscle, hair follicles or urinary sedimem is higher than that in leukoeytas.Conclusion The RT ARMS-qPCR provides a convenient,rapid, sensitive and reliable quantitative detection of heteroplasmic mutant mtDNA A3243G in different tissues.

Objective To investigate the correlation between survival motor neuron (SMN) gene deletion and Chinese patients with sporadic amyotrophic lateral sclerosis (SALS).Methods A total of 141SALS patients and 134 unrelated controls were recruited from the Chinese population.Polymerase chain reaction (PCR) and restriction fragment length polymorphisro (RFLP) analysis were performed to screen SMN gene deletion.Frequencies of deletion were coropared by Chi-square test.Results Four patients and 3 controls were detected to have horoozygous SMN2 deletion.The frequencies of SMN2 deletion were 2.84%(4/141) and 2.24% (3/134), respectively, which was not significantly different (χ2= 0.0001, P =1.000).No subjects were found to have homozygous SMN1 deletion.Condusion There is no correlation between SMN gene deletion and Chinese patients with SALS.