Objective To track and evaluate the implementation and application of the occupational health standard Radiation shielding requirements for radiotherapy room—Part 4: Radiotherapy room of ²⁵²Cf neutron afterloading (GBZ/T 201.4-2015) by radiation health technical service agencies, medical institutions, health supervision agencies, and radiotherapy facility design units, and to provide a scientific basis for the further revision and implementation of this standard. Methods Following the Guideline for health standards tracking evaluation (WS/T 536-2017) and the project implementation plan, relevant practitioners were randomly selected for a questionnaire survey. The survey primarily focused on their awareness, standard training, application, and revision suggestions of GBZ/T 201.4-2015. The results were summarized and analyzed. Results A total of 168 evaluation questionnaires were collected from relevant practitioners in 28 provinces. Only 31.6% of the respondents reported being “well familiar” or “ familiar” with the standard, 27.4% of the respondents believed that the standard was widely used, and 45.2% of the respondents believed that the standard could meet the needs of their work. Only 14.9% of the respondents had received relevant training on the standard, more than half of the respondents had not applied the standard within the past 10 years, and 45.2% of the respondents believed that the standard "needs to be revised". Conclusion Due to the small number of californium-252 neutron afterloading radiotherapy devices in operation on the market, the overall awareness of the standard is low, suggesting that relevant authorities need to strengthen training and publicity of the standard, and that certain sections of the standard need to be revised or merged.

Neurofibromatosis type 1 (NF1) presents with a diverse range of symptoms that can affect the skin, bones, eyes, central nervous system, and other organs. This article reports the diagnosis and treatment process of a patient with NF1 complicated by bilateral severe-to-profound sensorineural hearing loss. Genetic testing revealed a heterozygous variant of NF1 NM_ 000267.3: c.4054_ 4058del(p.Ser1352LeufsTer20, supporting the diagnosis of NF1. After thorough evaluation, a right cochlear implantation was performed, yielding satisfactory postoperative results. This case suggests that NF1 patients may exhibit phenotypic heterogeneity and atypicality, providing a reference for clinicians in the diagnosis and treatment of such patients.

Objective To explore the clinical characteristics of autosomal dominant intellectual disability type 21(MRD21)related with CCCTC-binding factor(CTCF)mutations.Methods The clinical data of an outpatient with CTCF mutations,laboratory and genetic test results was retrospectively collected,and relevant literatures were re-viewed.Results A 6-year-old male patient had feeding difficulties during the neonatal period and has experienced constipation since infancy.He has exhibited global developmental delay since early childhood,characterized by intel-lectual and language deficits,as well as autism-like behaviors.There is no history of epileptic seizures.Brain magnet-ic resonance imaging and electroencephalography findings were normal.Physical examination revealed poor eye con-tact,microcephaly and no facial dysmorphism.Whole exome sequencing confirmed by Sanger sequencing detected a de novel heterozygous mutation in CTCF:c.1087-2A＞G.His parents did not have this mutation.Conclusions The clinical manifestations of MRD21 lack specificity.Intellectual disability is the most frequent finding.Other presenta-tions may also include microcephaly,digestive system symptoms like feeding difficulties and constipation,as well as behavioral abnormalities,which are also relatively common.Genetic testing aids in confirming the diagnosis.

Objective:To improve the clinical diagnostic ability of antiphospholipid syndrome (APS) with onset of autoimmune hemolytic anemia (AIHA).Methods:The diagnosis and treatment of one APS patient with AIHA as the initial manifestation were reported and discussed.Results:A young female patient admitted to Peking Union Medical College Hospital on October 15, 2022 suffered from AIHA and persistent lupus anticoagulant (LA) positivity. After being treated with high-dose glucocorticoid, both symptoms and indicators were improved. However, relapses occurred when the glucocorticoid was tapered. Subsequent attempts to combine multiple immunosuppressants and biologics for treatment was ineffective. During the course of the disease, the patient had experienced intermittent intracranial hypertension which was revealed as cerebral venous sinus thrombosis(CVST) by MRV. Laboratory test revealed that antiphospholipid antibodies and antiphospholipid serine/prothrombin antibodies (aPS/PT) were all positive. She was finally diagnosed with APS. After being treated with high-dose glucocorticoids and immunosuppressants, combined with warfarin and aspirin, the patient′s clinical symptoms were significantly improved.Conclusion:AIHA is one of the extra-criteria manifestations of APS. Patients with AIHA and persistent antiphospholipid antibody profiles should be alerted to the possibility of thrombotic events. It is difficult to control APS-CVST-AIHA patients′disease development and recurrence. Early and adequate antithrombotic therapy is essential for improvement of prognosis. Furthermore, some drugs may lead to false positive in LA testing, making aPS/PT a viable alternative method for assessing LA.

Objective:To improve the clinical diagnostic ability of antiphospholipid syndrome (APS) with onset of autoimmune hemolytic anemia (AIHA).Methods:The diagnosis and treatment of one APS patient with AIHA as the initial manifestation were reported and discussed.Results:A young female patient admitted to Peking Union Medical College Hospital on October 15, 2022 suffered from AIHA and persistent lupus anticoagulant (LA) positivity. After being treated with high-dose glucocorticoid, both symptoms and indicators were improved. However, relapses occurred when the glucocorticoid was tapered. Subsequent attempts to combine multiple immunosuppressants and biologics for treatment was ineffective. During the course of the disease, the patient had experienced intermittent intracranial hypertension which was revealed as cerebral venous sinus thrombosis(CVST) by MRV. Laboratory test revealed that antiphospholipid antibodies and antiphospholipid serine/prothrombin antibodies (aPS/PT) were all positive. She was finally diagnosed with APS. After being treated with high-dose glucocorticoids and immunosuppressants, combined with warfarin and aspirin, the patient′s clinical symptoms were significantly improved.Conclusion:AIHA is one of the extra-criteria manifestations of APS. Patients with AIHA and persistent antiphospholipid antibody profiles should be alerted to the possibility of thrombotic events. It is difficult to control APS-CVST-AIHA patients′disease development and recurrence. Early and adequate antithrombotic therapy is essential for improvement of prognosis. Furthermore, some drugs may lead to false positive in LA testing, making aPS/PT a viable alternative method for assessing LA.

Objective　: To verify the feasibility of using a homemade lung phantom for quality control of Cyberknife by comparing the measurement results of the homemade lung phantom and CIRS dynamic phantom in E2E testing of Cyberknife lung tracking.  Methods　 : The patient treatment process was simulated, including CT positioning, plan design, irra- diation implementation, film scanning, and analysis using the homemade phantom and CIRS phantom. The two phantoms were measured five times using MLC under the S7 generation Cyberknife and five times using Iris under the M6 generation Cyberknife. The differences in measurement results between the two phantoms were analyzed using independent sample t-test. Results　: For the S7 generation Cyberknife, the statistical analysis of differences between the two phantoms in the detection values on the X-axis, Y-axis, Z-axis, and total deviation showed P values of 0.236, 0.175, 0.289, and 0.668, respect- ively. For the M6 generation Cyberknife, the statistical analysis showed P values of 0.880, 0.891, 0.573, and 0.433, respect- ively. The P values were all > 0.05. Therefore, there were no statistically significant differences in the detection results between the homemade lung phantom and the CIRS phantom under the S7 and M6 generation Cyberknife. The total deviation values were <1.5 mm. Conclusion　 The homemade lung phantom and CIRS phantom have consistent measurement results in the E2E testing of Cyberknife lung tracking and meet the requirements of Report of AAPM TG-135 and WS 667- 2019 standard. Therefore, the homemade lung phantom is feasible for clinical quality control of Cyberknife.

Prader-Willi syndrome(PWS)is a genetically imprinted disorder characterized by intellec-tual impairment,obesity,metabolic disorders,and behavioral abnormalities.The pathological mechanisms of metabolic disorders and behavioral abnormalities are not yet clear,and the treatment effect up to now is not satisfactory.In recent years,the role of gut microbiota in metabolic regulation has gradually been recognized.This article will systematically review the research progress of gut microbiota in PWS.Compared to healthy in-dividuals or other simply obese individuals.PWS patients show changes in the gut microbiota.The changes are related to metabolic disorders and inflammatory status in PWS patients.Intervention of gut microbiota through diet or probiotics has played a certain role in controlling weight and improving behavioral abnormalities in PWS patients.

Schimke immuno-osseous dysplasia (SIOD)caused by SMARCAL1 gene mutations is a rare genetic disorder characterized by multi-system involvement, including T-cell dysfunction, skeletal dysplasia, disproportionate short stature, nephrotic syndrome, and kidney failure. This multidisciplinary consultation involved a 9-year-old boy with intrauterine growth retardation, presenting with short stature, T-cell lymphopenia, proteinuria, and degenerative bone and joint disease. Treatment primarily focused on symptomatic and supportive care. Through the multidisciplinary rare disease consultation, holistic support was provided to the patient, offering comprehensive care from various specialtiesx.We also aim to use this case report to enhance clinicians′ under-standing of SIOD and improve the management and treatment of rare diseases.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.

Glycogen storage diseases (GSDs)refer to a group of metabolic disorders caused by congenital enzyme deficiencies. This group of diseases are characterized by abnormal glycogen metabolism. Most subtypes can lead to increased glycogen accumulation in tissues of the liver, muscles, kidneys etc. GSD type Ⅰ (GSDⅠ) is the most common type of the liver glycogen storage diseases that are caused by a deficiency in glucose-6-phosphatase in the liver, kidneys, and intestines. This typle has two subtypes: type Ⅰa and type Ⅰb(GSDⅠb). Recently, research into the molecular mechanisms of GSD Ⅰb made further progress, leading to significant improvements in clinical diagnosis and the new treatment methods based on the pathogenesis. This article summarizes the current research status of diagnosis and screening, molecular genetic mechanisms, and treatment of GSD Ⅰb. The article also points out the opportunities, the challenges and future possibilities.