1.Clinical and genetic analysis of a pedigree affected with Distal arthrogryposis type 5D due to compound heterozygous variants of ECEL1 gene.
Weiyu HU ; Baiyun CHEN ; Yang GAO ; Xiaona WANG ; Yuke LI ; Qianying LI ; Huichun ZHANG ; Chao GAO
Chinese Journal of Medical Genetics 2025;42(3):322-329
OBJECTIVE:
To explore the clinical phenotypes and genetic characteristics of a pedigree with Distal arthrogryposis type 5D (DA5D) caused by compound heterozygous variants in the ECEL1 gene.
METHODS:
A child (proband) diagnosed with DA5D and his family members (proband's parents and sister) who was admitted to the Department of Rehabilitation Medicine of Henan Children's Hospital in July 2022 due to "multiplex distal arthrogryposis" were enrolled into this study. Clinical data of the proband were collected and peripheral blood samples were obtained from the proband and members of his family about 3 mL. Trio-whole genome sequencing (trio-WGS) was carried out to detected the genetic variations of the proband and his family members. The candidate's pathogenic gene variants were screened and analyzed by Genome Aggregation Database (gnomAD) and other databases. The screened variants were annotated for clinical phenotypes using databases like the Online Mendelian Inheritance in Man (OMIM). The pathogenicity of the candidate variants was predicted by bioinformatics tools such as Provean. Based on the guidelines of the American College of Medical Genetics and Genomics (ACMG), pathogenicity ratings were conducted for variant sites. The protein conservation and mutation structure prediction of ECEL1 protein among species were carried out though MEGA-X and PyMOL. The research protocol of this study was reviewed by the Ethics Committee of Henan Provincial Children's Hospital (Approval No. 2023-H-H01), and informed consent for clinical research was obtained from the guardians of the probands.
RESULTS:
The proband had multiplex distal arthrogryposis involving hands, feet, knees, and ankles, and had right ptosis, micrognathia, low auricular position, and upturned nose. The parents and sister both had normal phenotypes. Trio-WGS and Sanger sequencing revealed that the child had compound heterozygous variants of paternal c.1742_c.1743insT and maternal c.2314T>G, for which the father and sister were carriers of the c.1742_c.1743insT heterozygous variant and the mother was carrier of c.2314T>A. Neither mutation site has been reported. According to guidelines of ACMG, the c.1742_c.1743insT variant was classified as likely pathogenic (PSV1+PM2_Supporting), and c.2314T>G was classified as uncertain (PM2_Supporting+PM3+PP3). The results of conserved analysis of amino acid residue sequences of ECEL1 protein showed that the missense mutation of the maternal c.2314T>G (p.Cys772Gly) was highly conserved among humans and other seven species. The protein structure prediction revealed that the c.1742_c.1743insT frameshift mutation led to the protein truncation, and the c.2314T>G missense mutation resulted in the failure of forming 1 disulfide bond.
CONCLUSION
The compound heterozygous variants of ECEL1 gene were considered to be pathogenic for this DA5D patient, which have expanded the mutational spectrum of the ECEL1 gene and provided a reference for clinical diagnosis as well as genetic counseling for this family.
Humans
;
Pedigree
;
Arthrogryposis/genetics*
;
Male
;
Female
;
Heterozygote
;
Phenotype
;
Mutation
;
Child
;
Metalloendopeptidases
2.Prokaryotic expression, purification and identification of recombinant human atrial natriuretic peptide.
Chenhui CHEN ; Ziye ZHAO ; Jin XU ; Xuesong CAO ; Shangjing GUO ; Jun LI ; Hao WANG ; Sheng HOU
Chinese Journal of Biotechnology 2016;32(9):1273-1285
In order to improve the expression of recombinant human atrial natriuretic peptide (ANP), a new plasmid (pET28a(+)/ANP₃) containing 3 tandem ANP genes with lysine codon as the interval linker, was constructed. Target gene was transformed into Escherichia coli BL21 (DE3) and induced by IPTG, about 60% of the total-cell-protein was the target protein, His₆-ANP₃. After denaturation and refolding, it was digested by Endoproteinase Lys-C and Carboxypeptidase B (CPB) and then purified by a series of purification processes, about 16 mg purified ANP monomer could be obtained from one liter bacteria broth of shaking culture. Ultimately, the purity of protein was above 90% determined by UPLC and Tricine SDS-PAGE, its molecular weight was 3 080 Da according to LC-MS identification and it was proved to be equivalent to the reference product by ELISA. The use of tandem gene expression can provide a new possible model for the expression of other peptide drugs.
Atrial Natriuretic Factor
;
biosynthesis
;
Electrophoresis, Polyacrylamide Gel
;
Escherichia coli
;
metabolism
;
Gene Expression
;
Humans
;
Metalloendopeptidases
;
Peptides
;
Plasmids
;
genetics
;
Recombinant Fusion Proteins
;
biosynthesis
3.Construct a molecular switch based on bacterial quorum sensing.
Chinese Journal of Biotechnology 2013;29(9):1301-1312
Engineering the existing or manual assembling biosynthetic pathways involves two important issues: the activity and expression level of key enzymes in the pathway. Concerning the enzyme expression study, the conventional approach is to use strong promoter to initiate the overexpression of the target protein. The excessive expression of the target protein usually result in the intracellular accumulation of a large number of inactive inclusion bodies, thereby seriously affect the physiological state of the cell and the effective functioning of the relevant biological pathways. To solve this problem, we would like to design a molecular switch to precisely manipulate the expression level of key enzymes in the biosynthetic process, which has important practical value for the study of metabolic rhythm of the biosynthetic pathway and to promote the efficiency of the biosynthetic pathway. Based on the basic principles of quorum sensing existing in the bacterial community and combining the dynamic characteristics of the enzymatic catalysis, we first established cell-cell communication mechanisms mediated by signal molecule homoserine lactone (AHL) in the E. coli community and target protein EGFP was expressed under the control of the promoter P(lux1). In the process of cell growth, AHL accumulated to a certain concentration to start the expression of target gene egfp. At the different cell growth stages, AHL-degrading enzyme AiiA was induced and resulted in the degradation of AHL molecule in a controlled environment, thereby controlling the transcription efficiency of target gene egfp and ultimately achieve the precise control of the level of expression of the target protein EGFP. The detection of cell growth state, the mRNA level and protein expression level of the target gene showed the artificially designed molecular switch can control the level of expression of a target gene in a convenient and efficient manner with a spatial and temporal regulation of rigor. The molecular switch is expected to be widely used in the field of metabolic engineering and synthetic biology research areas.
Carboxylic Ester Hydrolases
;
genetics
;
Escherichia coli
;
enzymology
;
genetics
;
physiology
;
Gene Expression Regulation, Bacterial
;
Green Fluorescent Proteins
;
biosynthesis
;
genetics
;
Metalloendopeptidases
;
genetics
;
Quorum Sensing
;
genetics
;
physiology
4.Effect of Small Hairpin RNA Targeting Endothelin-Converting Enzyme-1 in Monocrotaline-Induced Pulmonary Hypertensive Rats.
Jae Sung SON ; Kwan Chang KIM ; Bo Kyung KIM ; Min Sun CHO ; Young Mi HONG
Journal of Korean Medical Science 2012;27(12):1507-1516
The purpose of this study was to investigate the therapeutic effects of small hairpin RNA (shRNA) targeting endothelin-converting enzyme (ECE)-1 in monocrotaline (MCT)-induced pulmonary hypertensive rats. Ninty-four Sprague-Dawley rats were divided into three groups: control (n = 24), MCT (n = 35) and shRNA (n = 35). Four-week survival rate in the shRNA group was significantly increased compared to that in the MCT group. The shRNA group showed a significant improvement of right ventricular (RV) pressure compared with the MCT group. The MCT and shRNA groups also showed an increase in RV/(left ventricle + septum) ratio and lung/body weight. Plasma endothelin (ET)-1 concentrations in the shRNA group were lower than those in the MCT group. Medial wall thickness of pulmonary arterioles were increased after MCT injection and was significantly decreased in the shRNA group. The number of intra-acinar muscular pulmonary arteries was decreased in the shRNA group. The mRNA expressions of ET-1 and ET receptor A (ETA) were significantly decreased in the shRNA group in week 4. The protein levels of ETA were decreased in the shRNA group in week 2. The protein levels of tumor necrosis factor-alpha and vascular endothelial growth factor were decreased in the shRNA group in week 4. In conclusion, the gene silencing with lentiviral vector targeting ECE-1 could be effective against hemodynamic, histopathological and gene expression changes in pulmonary hypertension.
Animals
;
Aspartic Acid Endopeptidases/*antagonists & inhibitors/blood/genetics
;
Body Weight
;
Heart Ventricles/physiopathology
;
Hypertension, Pulmonary/chemically induced/*enzymology/mortality
;
Lentivirus/genetics
;
Lung/anatomy & histology/metabolism/pathology
;
Male
;
Metalloendopeptidases/*antagonists & inhibitors/blood/genetics
;
Monocrotaline/toxicity
;
Pulmonary Artery/drug effects/physiopathology
;
RNA, Small Interfering/*metabolism
;
Rats
;
Rats, Sprague-Dawley
;
Receptor, Endothelin A/genetics/metabolism
;
Survival Rate
;
Tumor Necrosis Factor-alpha/metabolism
;
Vascular Endothelial Growth Factor A/metabolism
5.Plutella xylostella granulovirus PP31 interacts with two host proteins.
Pan-Feng LIU ; Si-Min WANG ; Yin LIU ; Lu-Lin LI
Chinese Journal of Virology 2012;28(1):15-22
Protein-protein interactions between viruses and hosts are common during viral infection and replication. In this study, a cDNA library from larvae of Plutella xylostella was constructed and used for screening of genes encoding proteins interacting with Plutella xylostella granulovirus (PlxyGV) proteins. Two cDNA clones containing genes encoding proteins interacting with PlxyGV PP31 were identified by yeast two-hybrid assays. Sequence analysis showed that the genes encoded homologues of receptor for activated protein C kinase (RACK) and methionine aminopeptidase 2 (MetAP2), respectively. The P. xylostella rack gene and the PlxyGV pp31 was expressed in an E. coli strain to produce proteins fused with a 6-His or a GST tag. It was shown that the rack was expressed as a 38kD peptide as prospected. The 38kD His-tagged peptide was co-purified with GST-PP31 by GST-bind resin in GST-pulldown assays, confirming interaction between the PlxyGV PP31 and the RACK protein of P. xylostella.
Aminopeptidases
;
genetics
;
physiology
;
Animals
;
Gene Library
;
Granulovirus
;
physiology
;
Metalloendopeptidases
;
genetics
;
physiology
;
Moths
;
virology
;
Receptors for Activated C Kinase
;
Receptors, Cell Surface
;
genetics
;
physiology
6.Characterization of protein secretion based on structural fusion degree.
Cuifang GAO ; Xiaojun WU ; Fengwei TIAN ; Yu XIA ; Wei CHEN
Chinese Journal of Biotechnology 2010;26(5):687-695
Selection of suitable signal peptides is an important factor for efficient secretion of heterologous proteins. We defined structural fusion degree (SFD) as the compatibility degree of target proteins and signal peptides by a bioinformatics approach. We mathematically analyzed the interaction of fused signal peptides and adjacent residues of proteins, and proposed a mathematical model of extended signal region and the protein. SFD Features was extracted from this model to characterize the secretability of heterologous proteins. Simulation tests showed that SFD features can effectively discriminate high secretory proteins from poor ones in the host Bacillus subtilis. Results from this research will be useful in signal peptide selection and have a better guiding significance for the optimization of heterologous protein secretion.
Amino Acid Sequence
;
Bacillus subtilis
;
genetics
;
metabolism
;
Bacterial Proteins
;
genetics
;
metabolism
;
Biotechnology
;
methods
;
Membrane Transport Proteins
;
genetics
;
metabolism
;
Metalloendopeptidases
;
genetics
;
metabolism
;
Molecular Sequence Data
;
Protein Sorting Signals
;
genetics
;
Proteins
;
secretion
;
Recombinant Fusion Proteins
;
genetics
;
metabolism
7.Two characteristics of a recombinant fusion protein composed of staphylokinase and hirudin: high thrombus affinity and thrombus-targeting release ofanticoagulant activity.
Aiping YU ; Chuanling ZHANG ; Chunna DONG ; Hongyang YU ; Genshen ZHONG ; Lisheng WANG ; Chutse WU
Chinese Journal of Biotechnology 2008;24(11):1955-1961
To improve thrombolytic effect, a fusion protein SFH composed of staphylokinase (SAK) and hirudin (HV) with blood coagulation factor Xa (FXa) recognition peptide as a linker, was designed. SFH showed improved thrombolytic effect and low bleeding in vivo. Two thrombus-targeting mechanisms might account for the above features of SFH. This study was designed to study the two thrombus-targeting mechanisms of SFH. ELISA and immunohistochemistry assay were used to study the improved thrombus selectivity of SFH and the results showed that SFH, compared with SAK, displayed higher affinity for thrombin and thrombin-rich thrombus. To verify the thrombus-targeting release of anticoagulant activity of SFH, FH-a derivative of HV with only FXa recognition sequence at N terminus of HV was designed and used in animal tests. In inferior vena cava thrombosis model, FH showed equal antithrombotic effect as HV, indicating that HV could be successfully released from FH by FXa cleavage in vivo. More importantly, no prolongation of plasma TT, APTT and PT were found in FH group, but significant prolongations were discovered in HV group. This revealed that the anticoagulant activity of FH was released in thrombus-targeting way and limited in the vicinity of the thrombus, and this could be extrapolated to SFH. In conclusion, the high thrombus affinity and thrombus-targeting release of anticoagulant activity of SFH assigned low bleeding risk to SFH.
Animals
;
Anticoagulants
;
pharmacology
;
Factor X
;
pharmacology
;
Hirudins
;
biosynthesis
;
genetics
;
Metalloendopeptidases
;
biosynthesis
;
genetics
;
Mice
;
Rats
;
Recombinant Fusion Proteins
;
biosynthesis
;
genetics
;
pharmacology
;
Thrombolytic Therapy
;
methods
;
Thrombosis
;
drug therapy
;
Vena Cava, Inferior
8.Effect of Tongxinluo on 7 gene expression profile associated with vascular endothelium injure of rats with deficiency of vital energy or qi stagnation.
Yi-Ling WU ; Yan-Ning LI ; Jin-Sheng QI ; Zhen-Hua JIA ; Kun LIU
China Journal of Chinese Materia Medica 2007;32(21):2268-2272
OBJECTIVETo investigate 7 gene expression profile associated with inflammation and oxidative stress in vascular endothelium injure of rats with deficiency of vital energy or qi stagnation, and the effect of Tongxinluo on gene expression profile.
METHODThe model of vascular endothelium injury of rats with deficiency of vital energy or qi stagnation were established by using high L-methionine, with load-carrying swimming or being fastened, respectively. RT-PCR and SAGE database which is available in NCBI, were used to analyze the changes of 7 gene expression related with inflammation and oxidative stress in endothelium injure and the effect of Tongxinluo on the gene expression profile.
RESULTCompared with control group, the gene expression of inflammation related COX-1, COX-2, oxidative stress related iNOS, SOD and blood vessel vasomotion related eNOS, ECE, increased in deficiency of vital energy group (P < 0.05 or P < 0.01), and the gene expression decreased with Tongxinluo treatment (P < 0.05 or P < 0.01). The gene expression of COX-1, COX-2, iNOS and eNOS, ECE, increased (P < 0.01), but the gene expression of PCS and SOD decreased (P < 0.01), in qi stagnation group, and the disorder of gene expression improved with treatment of Tongxinluo (P < 0.01).
CONCLUSIONThe 7 gene expression related to vascular endothelium injure were not the same in rat with deficiency of vital energy or qi stagnation, and Tongxinluo could regulate the disorder of the gene expression, protecting vascular endothelium from injure.
Animals ; Aspartic Acid Endopeptidases ; genetics ; Cyclooxygenase 1 ; genetics ; Cyclooxygenase 2 ; genetics ; Drug Combinations ; Drugs, Chinese Herbal ; chemistry ; pharmacology ; Endothelin-Converting Enzymes ; Endothelium, Vascular ; injuries ; physiopathology ; Gene Expression ; drug effects ; Gene Expression Profiling ; Male ; Medicine, Chinese Traditional ; Metalloendopeptidases ; genetics ; Nitric Oxide Synthase Type II ; genetics ; Nitric Oxide Synthase Type III ; genetics ; metabolism ; Qi ; Random Allocation ; Rats ; Rats, Sprague-Dawley ; Reverse Transcriptase Polymerase Chain Reaction ; Superoxide Dismutase ; genetics
9.Preparation and characterization of PLGA microspheres containing a staphylokinase variant (K35R).
Jin-Tian HE ; Xian-Mei TAO ; Wei MO ; Hou-Yan SONG
Acta Pharmaceutica Sinica 2006;41(1):12-18
AIMTo produce poly (lactic-co-glycolic acid) (PLGA) microspheres, containing a staphylokinase variant (K35R, DGR) with reduced immunogenecity and antiplatelet aggregation activities, which allowed the preservation of protein stability during both particle processing and drug release.
METHODSDGR-loaded microspheres were fabricated using a double emulsion-solvent evaporation technique. The effects of preparative parameters, such as stirring rate, polymer concentration, and the excipients of both internal and external aqueous phase (W2), on DGR encapsulation efficiency and microsphere characteristics were investigated. In vitro and in vivo release of DGR were conducted and the cause for instability of DGR during release was also investigated.
RESULTSModerate ultrasonic treatment of aqueous DGR/dichloromethane mixtures caused approximately. Eighty four per cent DGR denaturation. However, the activity recovery of DGR almost amounted to 100% when 2% polyvinyl alcohol (PVA) was addled into the aqueous phase. It was found that NaCl in the external water phase significantly increased DGR encapsulation efficiency. Furthermore, NaCl in the external water phase played a role in determining size and surface morphology of microsphere. In vitro release test showed a burst release of DGR from microspheres, followed by sustained release of 50% total activity over 15 days. In vivo experiments showed that DGR released from microspheres sustained 5 days. Denaturation of DGR within microspheres might be resulted from acidic microclimate.
CONCLUSIONThe stability of DGR was effectively protected during microencapsulation and a relatively high encapsulation efficiency of DGR was obtained. PLGA microspheres could be an effective carrier for DGR.
Animals ; Area Under Curve ; Drug Carriers ; Drug Compounding ; Drug Delivery Systems ; Escherichia coli Proteins ; administration & dosage ; genetics ; pharmacokinetics ; Genetic Variation ; Lactic Acid ; Male ; Metalloendopeptidases ; administration & dosage ; genetics ; pharmacokinetics ; Microspheres ; Particle Size ; Polyglycolic Acid ; Polymers ; Rabbits
10.Cloning and bioinformatics analysis of a thrombin-like enzyme gene from Agkistrodon acutus.
Yan-Yu ZHANG ; Ping MA ; Yi-Ming LU ; Li-Ping LÜ ; Sheng-Yang JIANG ; Xi-Peng ZHOU ; Shu-Han SUN ; Jin-Bo XU
Journal of Experimental Hematology 2005;13(4):542-547
The venoms of Viperidae and Crotalidae snakes contain a large variety of proteins and peptides affecting the hemostatic system, which classified as coagulant, anticoagulant and fibrinolytic factors. To obtaind the thrombin-like enzyme gene of snake venoms, primers 1 5' ATGGTGCTGATCAGAGTGCTAGC 3' and 2 5' CTCCTCTTAA-CTTTTTCAAAAGTTT 3' were designed according to the snake venom thrombin-like enzyme highly conserved regions of 5' and 3'. Total RNA was prepared from the venom glands of a D. acutus specimen collected from Guangxi province of China, RT-PCR was conducted to amplify the gene of the venom thrombin-like enzyme (TLE). A 0.8 kb DNA fragment was specifically amplified, inserted into the pMD18-T vector and transformed into Escherichia coli strain DH5alpha, then identified by PCR and sequencing. The results showed that this cDNA shared great sequence homology (98.5%) with the published snake TLE cDNA sequence, the deduced amino acid sequence of this TLE encoded by the 783 bp consisted of 260 amino acids, which included a signal peptide of 24 amino acids and a matured peptide of 236 amino acids. In conclusion, a new cDNA encoding snake TLE was obtained by amplificantion.
Agkistrodon
;
genetics
;
Amino Acid Sequence
;
Animals
;
Base Sequence
;
Cloning, Molecular
;
Crotalid Venoms
;
biosynthesis
;
enzymology
;
genetics
;
DNA, Complementary
;
chemistry
;
genetics
;
Escherichia coli
;
genetics
;
Metalloendopeptidases
;
biosynthesis
;
genetics
;
Molecular Sequence Data
;
Recombinant Proteins
;
biosynthesis
;
Reverse Transcriptase Polymerase Chain Reaction
;
Sequence Analysis, DNA
;
Sequence Homology, Nucleic Acid
;
Thrombin
;
biosynthesis
;
genetics

Result Analysis
Print
Save
E-mail