1.Immunoprotective effect of combined pneumococcal endopeptidase O and pneumococcal surface adhesin A vaccines against Streptococcus pneumoniae infection.
Jing ZHANG ; Ya-Li CUI ; Yong-Mei JIANG
Chinese Journal of Contemporary Pediatrics 2017;19(5):583-589
OBJECTIVETo investigate the prokaryotic expression of proteins pneumococcal endopeptidase O (PepO) and pneumococcal surface adhesin A (PsaA) in Streptococcus pneumoniae and their immunoprotective effect as vaccine candidate proteins.
METHODSSpecific primers of target gene fragments were designed, and then PCR amplification was performed to establish recombinant plasmids pET28a(+)-pepO and pET28a(+)-psaA, which were transformed into host cells, Escherichia coli BL21 and DE3, respectively, to induce expression. Highly purified target proteins PepO and PsaA were obtained after purification. Mucosal immunization was performed for BALB/c mice and specific antiserum was prepared. ELISA was used to measure the antibody titer, and Western blot was used to analyze the specificity of the antiserum of target proteins. The mice were randomly divided into negative control group, PepO group, PsaA group, and PepO+PsaA combined immunization group, with 18 mice in each group. The models of different serotypes of Streptococcus pneumoniae infection were established to evaluate the immunoprotective effect of target proteins used alone or in combination.
RESULTSThe target proteins PepO and PsaA were successfully obtained and Western blot demonstrated that the antiserum of these proteins had good specificity. There was no significant difference in the titers of IgA in saliva and IgG in serum between the PepO group and the combined immunization group (P>0.05); however, these two groups had significantly higher antibody titers than the PsaA group (P<0.05). The PepO, PsaA, and combined immunization groups had significantly higher protection rates for mice infected with Streptococcus pneumoniae D39 and CMCC31436 in the nasal cavity than the negative control group (P<0.05). The PepO and combined immunization groups had a significantly higher protection rate for mice infected with Streptococcus pneumoniae D39 than the PsaA group (P<0.05). The results of colonization experiment showed that compared with the control group, the PepO, PsaA, and combined immunization groups showed a significant reduction in the colonization of Streptococcus pneumoniae (CMCC31693 and CMCC31207) in the nasopharynx and lung (P<0.05). The combined immunization group showed a better effect on reducing the colonization of CMCC31207 in the lung than the PepO and PsaA alone groups.
CONCLUSIONSCombined PepO/PsaA vaccines may produce a better protective effect by mucosal immunization compared with the vaccine used alone in mice. The combined vaccines can effectively reduce the colonization of Streptococcus pneumoniae in the nasopharynx and lung. Therefore, such protein vaccines may have a great potential for research and development.
Adhesins, Bacterial ; immunology ; Animals ; Antibodies, Bacterial ; analysis ; Bacterial Proteins ; immunology ; Female ; Immunization ; Lipoproteins ; immunology ; Lung ; microbiology ; Metalloendopeptidases ; immunology ; Mice ; Mice, Inbred BALB C ; Pneumococcal Infections ; prevention & control ; Pneumococcal Vaccines ; immunology ; Saliva ; immunology
2.Cloning and bioinformatics analysis of a thrombin-like enzyme gene from Agkistrodon acutus.
Yan-Yu ZHANG ; Ping MA ; Yi-Ming LU ; Li-Ping LÜ ; Sheng-Yang JIANG ; Xi-Peng ZHOU ; Shu-Han SUN ; Jin-Bo XU
Journal of Experimental Hematology 2005;13(4):542-547
The venoms of Viperidae and Crotalidae snakes contain a large variety of proteins and peptides affecting the hemostatic system, which classified as coagulant, anticoagulant and fibrinolytic factors. To obtaind the thrombin-like enzyme gene of snake venoms, primers 1 5' ATGGTGCTGATCAGAGTGCTAGC 3' and 2 5' CTCCTCTTAA-CTTTTTCAAAAGTTT 3' were designed according to the snake venom thrombin-like enzyme highly conserved regions of 5' and 3'. Total RNA was prepared from the venom glands of a D. acutus specimen collected from Guangxi province of China, RT-PCR was conducted to amplify the gene of the venom thrombin-like enzyme (TLE). A 0.8 kb DNA fragment was specifically amplified, inserted into the pMD18-T vector and transformed into Escherichia coli strain DH5alpha, then identified by PCR and sequencing. The results showed that this cDNA shared great sequence homology (98.5%) with the published snake TLE cDNA sequence, the deduced amino acid sequence of this TLE encoded by the 783 bp consisted of 260 amino acids, which included a signal peptide of 24 amino acids and a matured peptide of 236 amino acids. In conclusion, a new cDNA encoding snake TLE was obtained by amplificantion.
Agkistrodon
;
genetics
;
Amino Acid Sequence
;
Animals
;
Base Sequence
;
Cloning, Molecular
;
Crotalid Venoms
;
biosynthesis
;
enzymology
;
genetics
;
DNA, Complementary
;
chemistry
;
genetics
;
Escherichia coli
;
genetics
;
Metalloendopeptidases
;
biosynthesis
;
genetics
;
Molecular Sequence Data
;
Recombinant Proteins
;
biosynthesis
;
Reverse Transcriptase Polymerase Chain Reaction
;
Sequence Analysis, DNA
;
Sequence Homology, Nucleic Acid
;
Thrombin
;
biosynthesis
;
genetics
3.The Role of Angiostatin, Vascular Endothelial Growth Factor, Matrix Metalloproteinase 9 and 12 in the Angiogenesis of Hepatocellular Carcinoma.
Sook KIM ; Ho Sung PARK ; Hyun Jin SON ; Woo Sung MOON
The Korean Journal of Hepatology 2004;10(1):62-72
BACKGROUND/AIMS: Tumor angiogenesis, a major requirement for tumor growth and metastasis, is regulated by pro- and anti-angiogenic factors. Hepatocellular carcinoma (HCC) has become a common malignant tumor worldwide. It is characterized by a high vascularity. METHODS: We studied the immunohistochemical expression of angiostatin, vascular endothelial cell growth factor (VEGF), matrix metalloproteinase (MMP)-9 and MMP-12, and the relationship between these results and the microvessel density (MVD) in 48 HCC specimens. To determine whether HCC cells express angiostatin per se, we examined the expression of angiostatin, MMP-9 and MMP-12 by Western blotting in four HCC cell lines. RESULTS: Expression of angiostatin and MMP-12 (but not MMP-9) were strongly correlated with decreased MVD in HCCs (P=0.006, P=0.038, respectively). VEGF positive tumors showed a significantly higher MVD than VEGF negative tumors (P=0.01). We divided the 48 cases into the following four groups: group A, angiostatin (+), MMP-9 or -12 (+), and VEGF (-); group B, angiostatin (-) and VEGF (-); group C, angiostatin (+), MMP-9 or -12 (+), and VEGF (+); group D, angiostatin (-) and VEGF (+). There was a significant correlation with MVD among these groups (P<0.001). Angiostatin was detected by Western blotting in 2 out of 4 HCC cell lines and was associated with plasminogen and MMP expression. CONCLUSIONS: These results indicate that angiogenesis in HCC is a complex process involving multiple factors including angiostatin, VEGF, and MMP. Our results suggest that angiostatin is generated by MMP-mediated proteolysis of plasminogen in HCC cells.
Adult
;
Aged
;
Angiogenesis Inhibitors/analysis/physiology
;
Angiostatins/analysis/physiology
;
Carcinoma, Hepatocellular/*blood supply/chemistry
;
English Abstract
;
Female
;
Gelatinase B/analysis/physiology
;
Humans
;
Liver Neoplasms/*blood supply/chemistry
;
Male
;
Metalloendopeptidases/analysis/physiology
;
Middle Aged
;
Neovascularization, Pathologic/metabolism/*physiopathology
;
Vascular Endothelial Growth Factor A/analysis/physiology
4.Expression of mRNA for membrane-type 1, 2, and 3 matrix metalloproteinases in human laryngeal cancer.
Chinese Medical Sciences Journal 2004;19(3):170-173
OBJECTIVETo investigate correlation of expressions of membrane-type 1, 2, and 3 matrix metalloproteinases (MT1, MT2, and MT3-MMP) to the invasion and metastases in laryngeal cancer.
METHODSReverse transcription-polymerase chain reaction (RT-PCR) was used to examine the mRNA level of MT1, MT2, and MT3-MMP in 24 patients with laryngeal cancer. The relationships of these three MT-MMP expressions to clinicopathology were analyzed by statistics.
RESULTSThe expressions of MT1, MT2, and MT3-MMP were significantly higher in laryngeal cancer tissues than those in para-tumorous tissues (P < 0.01) and had a close relationship with invasive depth (P < 0.05). But no significantly different expressions of these three MT-MMPs were found in different primary location and different histological grade of laryngeal cancer (P > 0.05). The expression of MT1-MMP was obviously higher in patients with metastatic lymph nodes than that in patients without metastatic lymph nodes (P < 0.05).
CONCLUSIONMT1, MT2, and MT3-MMP play an important role in the progression of laryngeal cancer, and MT1-MMP may serve as a reliable marker in estimating invasive and metastatic potency of laryngeal cancer. Suppressing expressions of MT1, MT2, and MT3-MMP early may inhibit the invasion and metastases of laryngeal cancer.
Adult ; Aged ; Biomarkers, Tumor ; analysis ; Female ; Gene Expression Regulation, Neoplastic ; Humans ; Laryngeal Neoplasms ; metabolism ; pathology ; Larynx ; metabolism ; Lymphatic Metastasis ; Male ; Matrix Metalloproteinase 16 ; Matrix Metalloproteinases, Membrane-Associated ; Metalloendopeptidases ; biosynthesis ; genetics ; Middle Aged ; Neoplasm Invasiveness ; RNA, Messenger ; biosynthesis
5.Pathogenesis of cigarette smoke-induced chronic obstructive pulmonary disease and therapeutic effects of glucocorticoids and N-acetylcysteine in rats.
Ling XU ; Bai-Qiang CAI ; Yuan-Jue ZHU
Chinese Medical Journal 2004;117(11):1611-1619
BACKGROUNDT lymphocytes and matrix metalloproteinase (MMP) play an important role in the pathogenesis of chronic obstructive pulmonary disease (COPD). However, the details of the mechanisms involved are unclear. The aims of this study were to investigate the changes in interferon-gamma (IFN-gamma), interleukin-4 (IL-4), MMP-9, MMP-12 and tissue inhibitor of metalloproteinase-1 (TIMP-1) levels in a smoke-induced COPD rat model and the therapeutic effects of glucocorticoids and N-acetylcysteine.
METHODSMale Wistar rats were exposed to cigarette smoke for 3.5 months. Budesonide or N-acetylcysteine was given in the last month. Lung function was measured at the end of the study. IL-4 and IFN-gamma levels were then determined in bronchoalveolar lavage fluid and lung tissue samples by enzyme-linked immunosorbent assay. The expression of MMP-9, MMP-12 and TIMP-1 mRNA in lung tissue was determined by RT-PCR.
RESULTSIn comparison with the control group, rats exposed to smoke had a significant increase in IL-4 and MMP-12 levels and a significant decrease in IFN-gamma levels. In addition, the IL-4/IFN-gamma ratio and MMP-12/TIMP-1 ratio were both higher. At the same time, the ratio of forced expiratory volume in 0.3 second to forced vital capacity (FEV(0.3)/FVC) and dynamic compliance (C(dyn)) decreased and expiratory resistance (Re) increased. By measuring pulmonary mean linear intercept and mean alveolar numbers, obvious emphysematous changes were observed in the smoke exposed group. After treatment with budesonide, IL-4 and MMP-12 decreased and IFN-gamma increased. The IL-4/IFN-gamma ratio returned to normal, though the MMP-12/TIMP-1 ratio remained unchanged. FEV(0.3)/FVC was significantly higher and Re was significantly lower than that in untreated smoke exposed rats. No significant differences were found in pulmonary mean linear intercept and mean alveolar numbers. After treatment with N-acetylcysteine, IFN-gamma increased and the IL-4/IFN-gamma ratio decreased. The MMP-12/TIMP-1 ratio remained unchanged. Re and C(dyn) both improved obviously. No significant differences were found in pulmonary mean linear intercept and mean alveolar numbers. Correlation analysis indicated that IL-4 levels in lung tissue correlated negatively with FEV(0.3)/FVC (r = -0.53, P = 0.001), IFN-gamma levels in lung tissue correlated negatively with Re (r = -0.63, P = 0.000) and positively with C(dyn) (r = 0.44, P = 0.009), and that the IL-4/IFN-gamma ratio correlated negatively with FEV(0.3)/FVC (r = -0.44, P = 0.010) and C(dyn) (r = -0.42, P = 0.015) and positively with Re (r = 0.58, P = 0.000). Finally, MMP-12 correlated negatively with FEV(0.3)/FVC (r = -0.36, P = 0.026).
CONCLUSIONSCigarette smoke exposure increases IL-4 levels and decreases IFN-gamma levels. This may be the result of smoke-induced changes in lung function. Budesonide can mitigate the changes in IL-4 and IFN-gamma levels induced by smoke exposure. N-acetylcysteine has no effect on IL-4, but increases IFN-gamma levels and brings the IL-4/IFN-gamma ratio back to normal. Cigarette smoke can also promote MMP-12 gene expression and elevate the MMP-12/TIMP-1 ratio. This effect may play a role in smoke-induced emphysema. Budesonide and N-acetylcysteine do not alter the MMP-12/TIMP-1 ratio in this study when given in the late phase of smoke exposure.
Acetylcysteine ; therapeutic use ; Animals ; Forced Expiratory Volume ; Glucocorticoids ; therapeutic use ; Interferon-gamma ; analysis ; physiology ; Interleukin-4 ; analysis ; physiology ; Lung ; pathology ; physiopathology ; Male ; Matrix Metalloproteinase 12 ; Metalloendopeptidases ; genetics ; Pulmonary Disease, Chronic Obstructive ; drug therapy ; etiology ; physiopathology ; Rats ; Rats, Wistar ; Smoking ; adverse effects ; Tissue Inhibitor of Metalloproteinase-1 ; genetics ; Vital Capacity
6.Investigations on the molecular mechanisms of saponins from Anemarrhena asphodeloides Bunge using oligonucleotide microarrays.
Ze-song LI ; De-liang LI ; Jian HUANG ; Yu DING ; Bai-ping MA ; Sheng-qi WANG
Acta Pharmaceutica Sinica 2003;38(7):496-500
AIMTo investigate the molecular mechanisms of saponins from the rhizome of Anemarrhena asphodeloides Bunge.
METHODSOligonucleotide microarrays consisting of 87 probes representing 87 human cardiovascular disease-related genes were constructed. Effects of saponins on gene expression in human umbilical vein endothelial cells were analyzed by comparing hybridization of Cy 5-labeled cDNAs from saponins-treated human umbilical vein endothelial cells and Cy 3-labeled cDNAs from untreated human umbilical vein endothelial cells.
RESULTSThe results indicate that angiotensinogen gene, alpha 2A-adrenoceptor gene and endothelin-converting enzyme 1 gene were downregulated 2.8, 1.9 and 3.1 folds respectively after human umbilical vein endothelial cells were incubated in medium containing 80 mg.L-1 saponins.
CONCLUSIONThese results suggest that saponins may have beneficial effect on cardiovascular diseases by modulating the function of vein endothial cells and microarray can be used to investigate the biological action of extracts from traditional Chinese medicine.
Anemarrhena ; chemistry ; Angiotensinogen ; genetics ; metabolism ; Aspartic Acid Endopeptidases ; genetics ; metabolism ; Cells, Cultured ; Down-Regulation ; drug effects ; Endothelin-Converting Enzymes ; Endothelium, Vascular ; cytology ; metabolism ; Gene Expression ; drug effects ; Humans ; Metalloendopeptidases ; Oligonucleotide Array Sequence Analysis ; Plants, Medicinal ; chemistry ; Receptors, Adrenergic, alpha-2 ; genetics ; metabolism ; Rhizome ; chemistry ; Saponins ; isolation & purification ; pharmacology ; Umbilical Veins ; cytology ; metabolism
7.Role of tissue inhibitors of metalloproteinases (TIMPs) in colorectal carcinoma.
Young Eun JOO ; Kang Seok SEO ; Jin KIM ; Hyun Soo KIM ; Jong Sun REW ; Chang Soo PARK ; Sei Jong KIM
Journal of Korean Medical Science 1999;14(4):417-423
Increased production of matrix metalloproteinases (MMPs) has been associated with increases in invasive and metastatic potential in many types of human carcinoma. Tissue inhibitors of metalloproteinase (TIMP)-1 inhibits most interstitial collagenases and MMP-9. TIMP-2 binds specifically and noncovalently to the pro-form of MMP-2 and inhibits its enzyme activity. In this study, we examined TIMP-1 and TIMP-2 expressions in relation to clinicopathological variables in colorectal carcinoma with in situ hybridization and immunohistochemistry. TIMP-1 and TIMP-2 expressions were localized overwhelmingly to pericancer stromal cells, while malignant and normal mucosal cells were weak or negative. Strong stromal TIMP-1 immunoreactivity correlated with Dukes' stage (p=0.022), status of lymph node metastasis (p=0.044) and poor survival (p= 0.005). The degree of immunohistochemical staining of TIMP-2 did not correlate with all clinicopathological variables. The correlation between enhanced TIMP-1 expression and advanced stage and poor survival suggest a growth promoting activity of TIMP-1 in colorectal carcinoma.
Adenocarcinoma/pathology
;
Adenocarcinoma/mortality
;
Adenocarcinoma/enzymology*
;
Adult
;
Aged
;
Aged, 80 and over
;
Antibodies
;
Collagenases/immunology
;
Collagenases/genetics*
;
Collagenases/analysis
;
Colorectal Neoplasms/pathology
;
Colorectal Neoplasms/mortality
;
Colorectal Neoplasms/enzymology*
;
DNA Probes
;
Female
;
Gelatinase A
;
Gelatinase B
;
Gelatinases/immunology
;
Gelatinases/genetics*
;
Gelatinases/analysis
;
Gene Expression Regulation, Enzymologic
;
Gene Expression Regulation, Neoplastic
;
Human
;
In Situ Hybridization
;
Male
;
Metalloendopeptidases/immunology
;
Metalloendopeptidases/genetics*
;
Metalloendopeptidases/analysis
;
Middle Age
;
Predictive Value of Tests
;
RNA, Messenger/analysis
;
Stromal Cells/pathology
;
Stromal Cells/enzymology
;
Survival Analysis
;
Tissue Inhibitor-of Metalloproteinase-2/immunology
;
Tissue Inhibitor-of Metalloproteinase-2/genetics*
;
Tissue Inhibitor-of Metalloproteinase-2/analysis
;
Tissue-Inhibitor of Metalloproteinase-1/immunology
;
Tissue-Inhibitor of Metalloproteinase-1/genetics*
;
Tissue-Inhibitor of Metalloproteinase-1/analysis

Result Analysis
Print
Save
E-mail