1.eEF1A1 regulates virus replication of vesicular stomatitis virus and herpes simplex virus:a preliminary study
Meihua CHEN ; Hancui XU ; Linxu WANG ; Hong LUO ; Qi QI ; Bo WANG ; Xiaotao DUAN
Chinese Journal of Pharmacology and Toxicology 2024;38(3):170-176
OBJECTIVE To investigate the effect of eukaryotic translation elongation factor 1A1(eEF1A1)on the replication of vesicular stomatitis virus(VSV)and Herpes simplex virus 1(HSV-1)to identify a potential target for broad-spectrum regulation of viruses.METHODS Small interfering RNA(si-eEF1A)was transfected into human skin fibroblasts(BJ-5ta)to inhibit the expression of eEF1A1,and the negative control group was set up.The transfection efficiency was detected by real-time fluo-rescence quantitative PCR(RT-qPCR)and Western blotting,the cell model of eEF1A1 gene silencing was constructed.The cell model was infected with VSV,the gene copy number and protein expression of VSV in the cells were detected.The cell model was infected with HSV-1,the mRNA and protein expres-sion of HSV-1 in the cells were detected.The cell models were transfected with polyinosinic acid[Poly(I:C)]or sodium deoxyribonucleic acid(HT-DNA),respectively.The mRNA expression of interferon-β(IFN-β),C-X-C Motif Chemokine 10(CXCL10)and interferon-stimulated gene 56(ISG56)were detected by RT-qPCR.The phosphorylation expression of interferon regulatory factor 3(IRF3)and TANK binding kinase 1(TBK1)were detected by Western blotting.RESULT Compared with the negative control group,the mRNA and protein expression of eEF1A1 in the eEF1A1 gene silencing group were signifi-cantly decreased(P<0.01),the cell model of eEF1A1 gene silencing was successfully constructed.Compared with the negative control group,the VSV gene copy number of the eEF1A1 gene silencing group decreased by 70%-80%.The VSV protein expression decreased significantly(P<0.01).The mRNA expression of HSV-1 was decreased by 50%-60%,and the protein expression of HSV-1 was significantly decreased(P<0.01).After stimulation with Poly(I:C)or HT-DNA,compared with the negative control group.there was no significant difference in the mRNA expressions of IFN-β,ISG56 and CXCL10 and the protein phosphorylation expression of IRF3 and TBK1 in the eEF1A1 gene silencing group.CONCLUSION eEF1A1 silencing can inhibit VSV and HSV-1 virus replication,suggesting that eEF1A1 has a potential broad-spectrum regulatory effect on RNA viruses and DNA viruses,and may not recog-nize activated immune pathways through intracellular nucleic acid recognition.
2.27-Hydroxycholesterol/liver X receptor/apolipoprotein E mediates zearalenone-induced intestinal immunosuppression:A key target potentially linking zearalenone and cancer
Ruan HAONAN ; Zhang JING ; Wang YUNYUN ; Huang YING ; Wu JIASHUO ; He CHUNJIAO ; Ke TONGWEI ; Luo JIAOYANG ; Yang MEIHUA
Journal of Pharmaceutical Analysis 2024;14(3):371-388
Zearalenone(ZEN)is a mycotoxin that extensively contaminates food and feed,posing a significant threat to public health.However,the mechanisms behind ZEN-induced intestinal immunotoxicity remain unclear.In this study,Sprague-Dawley(SD)rats were exposed to ZEN at a dosage of 5 mg/kg/day b.w.for a duration of 14 days.The results demonstrated that ZEN exposure led to notable pathological alterations and immunosup-pression within the intestine.Furthermore,ZEN exposure caused a significant reduction in the levels of apolipoprotein E(ApoE)and liver X receptor(LXR)(P<0.05).Conversely,it upregulated the levels of myeloid-derived suppressor cells(MDSCs)markers(P<0.05)and decreased the presence of 27-hydroxycholesterol(27-HC)in the intestine(P<0.05).It was observed that ApoE or LXR agonists were able to mitigate the immunosuppressive effects induced by ZEN.Additionally,a bioinformatics analysis highlighted that the downregulation of ApoE might elevate the susceptibility to colorectal,breast,and lung cancers.These find-ings underscore the crucial role of the 27-HC/LXR/ApoE axis disruption in ZEN-induced MDSCs proliferation and subsequent inhibition of T lymphocyte activation within the rat intestine.Notably,ApoE may emerge as a pivotal target linking ZEN exposure to cancer development.
3.Radiotherapy combined with immunotherapy could improve the immune infiltration of melanoma in mice and enhance the abscopal effect
Yufeng ZHENG ; Xue LIU ; Na LI ; Aimei ZHAO ; Zhiqiang SUN ; Meihua WANG ; Judong LUO
Radiation Oncology Journal 2023;41(2):129-139
Purpose:
To analyze the gene mutation, immune infiltration and tumor growth of primary tumor and distant tumor under different treatment modes.
Materials and Methods:
Twenty B16 murine melanoma cells were injected subcutaneously into the of both sides of the thigh, simulating a primary tumor and a secondary tumor impacted by the abscopal effect, respectively. They were divided into blank control group, immunotherapy group, radiotherapy group, and radiotherapy combined immunotherapy group. During this period, tumor volume was measured, and RNA sequencing was performed on tumor samples after the test. R software was used to analyze differentially expressed genes, functional enrichment, and immune infiltration.
Results:
We found that any treatment mode could cause changes in differentially expressed genes, especially the combination treatment. The different therapeutic effects might be caused by gene expression. In addition, the proportions of infiltrating immune cells in the irradiated and abscopal tumors were different. In the combination treatment group, T-cell infiltration in the irradiated site was the most obvious. In the immunotherapy group, CD8+ T-cell infiltration in the abscopal tumor site was obvious, but immunotherapy alone might have a poor prognosis. Whether the irradiated or abscopal tumor was evaluated, radiotherapy combined with anti-programmed cell death protein 1 (anti-PD-1) therapy produced the most obvious tumor control and might have a positive impact on prognosis.
Conclusion
Combination therapy not only improves the immune microenvironment but may also have a positive impact on prognosis.
4.Single-center clinical analysis of 9 049 children hospitalized for accidental injury
Cui LUO ; Meihua LIU ; Shihua LIU ; Jianxiong PENG ; Zhenghui XIAO ; Jianhui XIE ; Xinping ZHANG ; Jun QIU
Chinese Journal of Practical Nursing 2023;39(33):2579-2585
Objective:To analyze the characteristics of child cases admitted to accidental injury and provide reliable basis for the prevention of accidental injury.Methods:The clinical data of children admitted to Hunan Children′s Hospital aged 0-18 due to accidental injuries from January 1, 2018 to December 31, 2021 were retrospectively analyzed. The type of accidental injury and characteristic factors such as prognosis, gender, age, time, and location of the child were analyzed.Results:A total of 9 049 children with accidental injury were admitted, accounting for 3.72%(9 049/33 697) of the total number of hospitalized children. The top three types of accidental injuries were falls/drop (3 695 cases), foreign bodies/suffocation (2 639 cases) and traffic accidents (1 165 cases), accounting for 82.87%(7 499/9 049). There were 8 760 cases (96.81%) of improvement and recovery, 178 cases (1.97%) of disability, and 111 cases (1.23%) of unhealed/dead. Among the accidental injuries, 5 833 cases (64.46%) were boys and 3 216 cases (35.54%) were girls, and the incidence ratio was 1.81∶1. There was significant difference between boys and girls in the composition ratio of the type of accidental injury such as falls/falls, foreign bodies/suffocation, poisoning, sharp object injury, drowning ( χ2 values were 3.90-20.56, all P<0.05). Among the accidental injuries, the children aged 1 to<3 years had higher accidental injuries than the other age groups (3 263 cases, accounting for 36.06%), and the composition ratio of accidental injuries in different age groups was different ( χ2 values were 12.98-573.97, all P<0.05). Among the accidental injuries, the accidental injuries occurred in the second quarter and the third quarter were higher than those in the other two quarters (4 892 cases, accounting for 54.06%), and the composition ratio of accidental injuries such as falls/falls, foreign bodies/suffocation, burn and scald, drowning occurred in different quarters was different ( χ2 values were 10.79-18.88, all P<0.05). In the case of accidental injuries, the family was the most likely place of accidental injury, with different types of accidental injuries occurring in different places ( χ2 values were 10.08-2 186.54, all P<0.05). Conclusions:Children′s unintentional injuries are most likely to occur in boys aged 1-<3 years, and fall/fall is the main injury type. Traffic accidents are the most important unintentional injury type leading to children′s unhealed/dead. Different injury types were related to child gender, age, quarter, and place of occurrence.Due to the differences in the occurrence mechanism and injury mode of accidental injuries in different countries and regions, and the majority of accidental injuries can be prevented, targeted preventive measures should be taken according to the characteristics of children′s accidental injuries in different regions, and a comprehensive prevention system for children′s accidental injuries should be constructed to ensure children′s safety.
5.Automatic synthesis and in vivo imaging of Al 18F-NOTA-FAPI-04
Xiao JIANG ; Xiaoxiong WANG ; Taipeng SHEN ; Yutang YAO ; Xiuli LI ; Jiaqi SHEN ; Ying KOU ; Meihua CHEN ; Shirong CHEN ; Dingqiong XIAO ; Meng ZHAO ; Hao LU ; Jiayu LI ; Shengyan HU ; Xiaoping HU ; Zhifu LUO ; Xing ZHOU ; Chuan LI ; Zhuzhong CHENG
Chinese Journal of Nuclear Medicine and Molecular Imaging 2022;42(1):31-35
Objective:To automatically synthesize Al 18F-1, 4, 7-triazacyclononane-1, 4, 7-triacetic acid (NOTA)-fibroblast activation protein inhibitor (FAPI)-04, perform PET/CT imaging in vivo, and evaluate its diagnostic efficacy on tumors. Methods:Al 18F-NOTA-FAPI-04 was produced in All-in-one automatic synthesis module and its quality control was conducted by high performance liquid chromatography (HPLC) equipped with a radioactive detector. Al 18F-NOTA-FAPI-04 PET/CT imaging was performed in normal BALB/c mice ( n=3) and 4T1 breast cancer models ( n=3) to determine its biodistribution. Then Al 18F-NOTA-FAPI-04 and 18F-FDG PET/CT imaging were performed in a hepatocellular carcinoma patient (male, 51 years old). Results:The synthesis time of Al 18F-NOTA-FAPI-04 was about 35 min, and the radiochemical yield was (25.2±1.9)% (attenuation correction, n=3). The product was colorless transparent solution with pH value of 7.0-7.5, and the specific activity was (46.11±3.07) GBq/μmol (attenuation correction, n=3). The radiochemical purity was above 99.0% and was still above 98.0% at room temperature after 6 h. PET/CT imaging in mice showed that physiological uptake of Al 18F-NOTA-FAPI-04 was mainly in biliary system and bladder, and Al 18F-NOTA-FAPI-04 highly concentrated in tumor xenografts. PET/CT imaging in the patient showed that Al 18F-NOTA-FAPI-04 obtained high tumor background ratio (TBR) values of 4.1, 8.9, 5.4, 4.8, 2.2 in parasternal lymph nodes, anterior diaphragmatic lymph nodes, hilar lymph nodes, pancreaticoduodenal ligament lymph nodes, abdominal aortic lymph nodes, respectively, while TBR values were 1.0, 2.8, 5.0, 2.1, 1.1 by 18F-FDG. Conclusions:Al 18F-NOTA-FAPI-04 can be synthesized with short time, high radiochemical yield and good stability using All-in-one module. Al 18F-NOTA-FAPI-04 PET/CT imaging has high contrast and excellent diagnostic efficacy on tumors.
6.Akinesia deformation sequence in a fetus suspected by prenatal ultrasound and confirmed after mid-term termination
Xinyao LUO ; Qiuyang GU ; Xinxiu LIU ; Jianhua LI ; Liyan HUANG ; Xiaohua HUANG ; Shengnan WU ; Jingping YANG ; Meihua TAN
Chinese Journal of Perinatal Medicine 2022;25(3):218-221
We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.
7.Construction of evaluation index system of pediatric specialized nurses' core competence
Qian TANG ; Jianjun CHEN ; Dahua ZHANG ; Meihua LIU ; Xiang DING ; Na ZHANG ; Yuqiong XIANG ; Tingwei LUO ; Lihui ZHU
Chinese Journal of Modern Nursing 2022;28(32):4467-4473
Objective:To construct the evaluation index system of pediatric specialized nurses' core competence, so as to provide a basis for accurate measurement of pediatric specialized nurses' core competence.Methods:A research group was established in August 2021. Based on the quality onion model and literature analysis, a qualitative interview was conducted in September 2021 with 10 provincial and above hospitals pediatric specialist nurses, 5 pediatric nursing managers, 5 pediatric chief physicians and 5 primary caregivers for children selected by objective sampling. From September 2021 to February 2022, questionnaires were sent to 16 experts via email or WeChat for three rounds of Delphi expert consultation. The evaluation indexes of pediatric specialized nurses' core competence were determined according to the authority coefficient, Kendall coordination coefficient, coefficient of variation and other factors.Results:Among three rounds of expert consultation, the effective recovery rates of the questionnaire were all 100.00% (16/16) , and the authority coefficients were 0.813, 0.888 and 0.895, respectively, and the Kendall coordination coefficients were 0.175 (χ 2=289.348, P<0.01) , 0.239 (χ 2=408.131, P<0.01) and 0.288 (χ 2=467.280, P<0.01) , respectively. The final evaluation index system of pediatric specialized nurses' core competence included 6 first level indicators, 18 second level indicators and 84 third level indicators. Conclusions:The evaluation index system of pediatric specialized nurses' core competence is scientific and reliable, which can be used as an effective tool to measure the core competence of pediatric specialized nurses.
8.Effect of danusertib on cell cycle, apoptosis and autophagy of hepatocellular carcinoma HepG2 cells .
Qiaohua ZHU ; Meihua LUO ; Chengyu ZHOU ; Zhixian CHEN ; Wei HUANG ; Jiangyuan HUANG ; Shufeng ZHAO ; Xinfa YU
Journal of Southern Medical University 2018;38(12):1476-1484
OBJECTIVE:
To investigate the effect of danusertib (Danu), an inhibitor of Aurora kinase, on the proliferation, cell cycle, apoptosis, and autophagy of hepatocellular carcinoma HepG2 cells and explore the underlying mechanisms.
METHODS:
MTT assay was used to examine the effect of Danu on the viability of HepG2 cells to determine the IC50 of Danu. The effect of Danu on cell cycle distribution, apoptosis and autophagy were determined using flow cytometry. Western blotting was used to detect the expressions of the proteins related to cell cycle, apoptosis and autophagy. Chloroquine was used to suppress Danuinduced autophagy to test the apoptosis-inducing effect of Danu.
RESULTS:
Danu significantly inhibited the proliferation of HepG2 cells with IC of 39.4 μmol and 14.4 μmol at 24 h and 48 h, respectively. Danu caused cell cycle arrest in G/M phase in HepG2 cells and led to polyploidy accumulation via up-regulating the expressions of p53 and p21 and down-regulating the expressions of cyclin B1 and DC2. Danu also caused apoptosis of HepG2 cells through up-regulating the expressions of Bax, Puma, cleaved caspase-3, cleaved caspase-9, cleaved PARP and cytochrome C and down-regulating the expressions of Bcl-xl and Bcl-2. Danu induced autophagy via activating AMPK signaling and inhibiting PI3K/PTEN/AKT/mTOR axis, and inhibition of Danu-induced autophagy with chloroquine enhanced the pro-apoptotic effect of Danu.
CONCLUSIONS
Danu inhibits cell proliferation and induces cell cycle arrest in G/M phase, apoptosis and cytoprotective autophagy in HepG2 cells.
Apoptosis
;
drug effects
;
Autophagy
;
drug effects
;
Benzamides
;
pharmacology
;
Carcinoma, Hepatocellular
;
pathology
;
Cell Cycle
;
drug effects
;
Cell Division
;
drug effects
;
Cell Proliferation
;
drug effects
;
Hep G2 Cells
;
Humans
;
Liver Neoplasms
;
pathology
;
Neoplasm Proteins
;
metabolism
;
Protein Kinase Inhibitors
;
pharmacology
;
Pyrazoles
;
pharmacology
9.Evaluation of volume overload in critical patients by monitoring change of cardiac output under bed head raising combined with passive leg raising
Long ZHANG ; Luhao WANG ; Weixiong LUO ; Meihua MEI ; Youjuan CHEN ; Bin OUYANG
Chinese Critical Care Medicine 2017;29(8):711-715
Objective To investigate whether the change of cardiac output (CO) with bed head raising (BHR) combined with passive leg raising (PLR) can be used to assess volume overload in critical patients.Methods A prospective observational diagnostic trial was designed. The patients who underwent fluid resuscitation 6 hours or more, and admitted to intensive care unit (ICU) of Meizhou People's Hospital in Guangdong Province from January to December in 2016 were enrolled. Volume overload were identified with the criteria including the increasing of pulmonary rales, the higher levels of N-terminal brain natriuretic peptide (NT-proBNP) and new pulmonary exudates in chest radiograph. CO and heart rate (HR) were monitored with impedance cardiography at supine position and BHR by 30°(BHR30), 60° (BHR60), and PLR in all patients. The changes of CO (?CO30,?CO60,?COPLR) and HR (?HR30,?HR60,?HRPLR) were calculated at different positions. The receiver operating characteristic curve (ROC) was used to evaluate the predictive values of?CO30,?CO60 and combination of?CO60 and?COPLR on volume overload.Results A total of 62 patients were enrolled in this study, with 44 males and 18 females, age of (58.9±15.9) years, a body mass index of (22.7±2.4) kg/m2, and an acute physiology and chronic health evaluation Ⅱ (APACHE Ⅱ) score of 18.7±4.4. The CO of 32 patients with volume overload was significantly increased at BHR30 or BHR60 compared with supine position [?CO30 was (14.5±11.5)%,?CO60 was (26.9±17.5)%, bothP< 0.01], and the?CO60 was increased more than the?CO30 (P < 0.01);while CO was slightly decreased after PLR,?COPLR was (-8.4±11.3)% (P > 0.05). There was no consistent change of CO at BHR30 or BHR60 compared with supine position in 30 patients without volume overload,?CO30 was (-3.4±9.1)% (P < 0.05),?CO60 was (-2.4±14.0)% (P > 0.05), while CO was significantly increased after PLR,?COPLR was (12.4±11.3)% (P < 0.01). There was no significant change of HR after BHR and PLR in patients with volume overload and non volume overload. ROC curve showed that when the cut-off value of ΔCO30≥3.3%, the area under ROC curve (AUC) was 0.903±0.039, the sensitivity was 90.6%, the specificity was 80.0%, and the accuracy was 85.5% for predicting volume overload; when the cut-off value of ΔCO60≥5.6%, the AUC was 0.911±0.036, the sensitivity was 96.9%, the specificity was 73.3%, and the accuracy was 85.5% for predicting volume overload. If volume overload was assessed by the increase of ΔCO60 combining with the decrease of ΔCOPLR, the AUC was 0.928±0.034, the optimal cut-off value for the new combined predictive indicator in predicting volume overload was -0.008, and the sensitivity, specificity, accuracy was 96.9%, 83.3%, 90.3%, respectively, and its evaluation effect is better than the use of ΔCO30 or ΔCO60 alone.Conclusion The change of CO with BHR combined with PLR can be used to accurately evaluate volume overload in patient with critically illness.
10.Risk factors of aggressive posterior retinopathy of prematurity:a retrospective,longitudinal study
Jingbo JIANG ; Chuan NIE ; Meihua HE ; Xianqiong LUO
The Journal of Practical Medicine 2017;33(16):2697-2701
Objective To analyze the risk factors of aggressive posterior retinopathy of prematurity (AP-ROP). Methods A retrospective case-control study was applied. Questionnaire was designed through literature research to collect data of AP-ROP and ordinary ROP(except for AP-ROP)from March,2012 to September, 2014 in the department of neonatology in Guangdong Women and Children′s Hospital. Based on the ratio of 1:2 , the two groups were selected with the matching conditions:the closest date of admission in hospital,ordinary ROP children,collection and analysis of the data. Results Univariate analysis:gestational age(P<0.05),birth weight(P<0.05),oxygen therapy days(P<0.05),days of mechanical ventilation(P<0.05),gestational age<32 w(P<0.05),birth weight<1250 g(P<0.05),oxygen(P<0.05),oxygen≥14 d(P<0.05),mechanical ven-tilation(P < 0.05),mechanical ventilation ≥ 14 d(P < 0.05),PS(P < 0.05),neonatal anemia(P < 0.05), blood transfusion≥2 times(P<0.05),RDS(P<0.05),neonatal pneumonia(P<0.05),apnea(P<0.05), BPD(P < 0.05),intracranial hemorrhage(P < 0.05),metabolic acidosis(P < 0.05),and retinal hemorrhage (P < 0.05) were related to AP-ROP. Multivariate analysis with conditional logistic regression analysis indicated that blood transfusion ≥2 times(OR:14.956,95%CI:4.328~51.684)and apnea(OR:7.590,95%CI:2.507~22.978)were regarded as the independent risk factors for AP-ROP. Conclusions AP-ROP is associated with low gestational age,low birth weight,oxygen therapy and related complications including RDS and retinal hemorrhage. Blood transfusion and apnea are important independent risk factors of AP-ROP.

Result Analysis
Print
Save
E-mail