OBJECTIVES: Whether vortioxetine has a utility as an adjuvant drug in the treatment of bipolar depression remains controversial. This study aimed to validate the efficacy and safety of vortioxetine in bipolar depression. METHODS: Patients with bipolar Ⅱ depression were enrolled in this prospective, two-center, randomized, 12-week pilot trial. The main indicator for assessing treatment effectiveness was a Montgomery-Asberg Depression Rating Scale (MADRS) of ≥50%. All eligible patients initially received four weeks of lurasidone monotherapy. Patients who responded well continued to receive this kind of monotherapy. However, no-response patients were randomly assigned to either valproate or vortioxetine treatment for eight weeks. By comprehensively comparing the results of MADRS over a period of 4‍‒‍12 weeks, a systematic analysis was conducted to determine whether vortioxetine could be used as an adjuvant drug for treating bipolar depression. RESULTS: Thirty-seven patients responded to lurasidone monotherapy, and 60 patients were randomly assigned to the valproate or vortioxetine group for eight weeks. After two weeks of combined valproate or vortioxetine treatment, the MADRS score in the vortioxetine group was significantly lower than that in the valproate group. There was no difference in the MADRS scores between the two groups at 8 and 12 weeks. The incidence of side effects did not significantly differ between the valproate and vortioxetine groups. Importantly, three patients in the vortioxetine group appeared to switch to mania or hypomania. CONCLUSIONS This study suggested that lurasidone combination with vortioxetine might have potential benefits to bipolar II depression in the early stage, while disease progression should be monitored closely for the risk of switching to mania.
Humans ; Bipolar Disorder/drug therapy* ; Vortioxetine/therapeutic use* ; Male ; Female ; Middle Aged ; Adult ; Valproic Acid/administration & dosage* ; Lurasidone Hydrochloride/administration & dosage* ; Prospective Studies ; Treatment Outcome ; Pilot Projects ; Drug Therapy, Combination ; Sulfides/therapeutic use* ; Antidepressive Agents/therapeutic use*

Objective:To investigate the effect of high-fat and low-carbohydrate diet combined with radiotherapy on the tumor microenvironment of mice with lung xenografts.Methods:C57BL/6J mice were selected to establish the Lewis lung cancer model, and they were divided into the normal diet group, the high-fat and low-carbohydrate diet group, the normal diet + radiotherapy group, and the high-fat and low-carbohydrate diet + radiotherapy group, with 18 mice in each group. The mice in the normal diet group and the normal diet + radiotherapy group were fed with the normal diet with 12.11% fat for energy supply, and the mice in the high-fat and low-carbohydrate diet group and the high-fat and low-carbohydrate diet + radiotherapy group were fed with high-fat and low-carbohydratediet with 45.00% fat for energy. On the 12th to 14th days, the tumor sites of the mice in the normal diet + radiotherapy group and the high-fat and low-carbohydrate diet + radiotherapy group were treated with radiotherapy, and the irradiation dose was 24 Gy/3f. The body weight, tumor volume, blood glucose and blood ketone level, liver and kidney function, and survival status of the mice were observed and monitored. Immunohistochemical staining was used to detect the tumor-associated microangiogenesis molecule (CD34) and lymphatic endothelial hyaluronan receptor 1 (LYVE-1), Sirius staining was used to detect collagen fibers, and multiplex immunofluorescence was used to detect CD8 and programmed death-1 (PD-1). Expression of immune cell phenotypes (CD3, CD4, CD8, and Treg) was detected by flow cytometry.Results:On the 27th day after inoculation, the body weigh of the common diet group was(24.78±2.22)g, which was significantly higher than that of the common diet + radiotherapy group [(22.15±0.48)g, P=0.030] and high-fat low-carbohydrate diet + radiotherapy group [(22.02±0.77)g, P=0.031)]. On the 15th day after inoculation, the tumor volume of the high-fat and low-carbohydrate diet + radiotherapy group was (220.88±130.05) mm 3, which was significantly smaller than that of the normal diet group [(504.37±328.48) mm 3, P=0.042)] and the high-fat, low-carbohydrate diet group [(534.26±230.42) mm 3, P=0.016], but there was no statistically significant difference compared with the normal diet + radiotherapy group [(274.64±160.97) mm 3]. In the 4th week, the blood glucose values of the mice in the high-fat and low-carbohydrate diet group were lower than those in the normal diet group, with the value being (8.00±0.36) mmol/L and (9.57±0.40) mmol/L, respectively, and the difference was statistically significant ( P＜0.05). The blood ketone values of the mice in the high-fat and low-carbohydrate diet group were higher than those in the normal diet group, with the value being (1.00±0.20) mmol/L and (0.63±0.06) mmol/L, respectively, in the second week. In the third week, the blood ketone values of the two groups of mice were (0.90±0.17) mmol/L and (0.70±0.10) mmol/L, respectively, and the difference was statistically significant ( P＜0.05). On the 30th day after inoculation, there were no significant differences in aspartate aminotransferase, alanine aminotransferase, creatinine, and urea between the normal diet group and the high-fat, low-carbohydrate diet group (all P＞0.05). The hearts, livers, spleens, lungs, and kidneys of the mice in each group had no obvious toxic changes and tumor metastasis. In the high-fat and low-carbohydrate diet + radiotherapy group, the expression of CD8 was up-regulated in the tumor tissues of mice, and the expressions of PD-1, CD34, LYVE-1, and collagen fibers were down-regulated. The proportion of CD8 + T cells in the paratumoral lymph nodes of the high-fat and low-carbohydrate diet + radiotherapy group was (25.13±0.97)%, higher than that of the normal diet group [(20.60±2.23)%, P＜0.050] and the normal diet + radiotherapy group [(19.26±3.07)%, P＜0.05], but there was no statistically significant difference with the high-fat and low-carbohydrate diet group [(22.03±1.75)%, P＞0.05]. The proportion, of CD4 + T cells in the lymph nodes adjacent to the tumor in the normal diet + radiotherapy group (31.33±5.16)% and the high-fat and low-carbohydrate diet + radiotherapy group (30.63±1.70)% were higher than that in the normal diet group [(20.27±2.15)%, P＜0.05] and the high-fat and low-carbohydrate diet group (23.70±2.62, P＜0.05). Treg cells accounted for the highest (16.58±5.10)% of T cells in the para-tumor lymph nodes of the normal diet + radiotherapy group, but compared with the normal diet group, the high-fat and low-carbohydrate diet group, and the high-fat and low-carbohydrate diet + radiotherapy group, there was no statistically significant difference (all P＞0.05). Conclusion:High-fat and low-carbohydrate diet plus radiotherapy can enhance the recruitment and function of immune effector cells in the tumor microenvironment, inhibit tumor microangiogenesis, and thus inhibit tumor growth.

Objective To investigate the value of intestinal fatty acid binding protein(I-FABP)in predicting the development and progression of acute-on-chronic liver failure(ACLF).Methods A retrospective analysis was performed for the clinical data of 168 patients with decompensated liver cirrhosis who were admitted to The Affiliated Hospital of Yanbian University from September 2020 to March 2023.The conditions of the patients with ACLF on admission were observed,and the patients were followed up for 6 months to identify new-onset ACLF cases.ELISA was used to measure the serum level of I-FABP on admission.The Mann-Whitney U test was used for comparison of non-normally distributed continuous data between two groups,and the Kruskal-Wallis H rank sum test was used for comparison between multiple groups;the chi-square test was used for comparison of categorical data between groups;the Jonckheere-Terpstra test was used for trend analysis.The Spearman correlation analysis was used to investigate the correlation between two variables,and the multivariate Cox regression analysis was used to investigate the influencing factors for new-onset ACLF during follow-up.The Kaplan-Meier curve was used to analyze the onset of ACLF in different groups,and the log-rank test was used for the analysis of such differences.The receiver operating characteristic(ROC)curve and the area under the ROC curve(AUC)were used to investigate the performance of I-FABP in predicting the development and progression of ACLF.Results Among the 168 patients enrolled in this study,there were 43 patients with ACLF and 125 patients without ACLF,among whom 19 developed ACLF during follow-up.The patients with ACLF on admission had a significantly higher level of I-FABP than those without ACLF(Z=4.359,P<0.001).The patients with new-onset ACLF had a significantly higher level of I-FABP than those without new-onset ACLF(Z=3.414,P<0.001).The level of I-FABP increased with the increase in ACLF severity grade(H=17.385,P<0.001,Ptrend<0.001).The multivariate Cox regression analysis showed that I-FABP was independently associated with new-onset ACLF during follow-up(hazard ratio=2.138,95%confidence interval[CI]:1.297-3.525,P=0.003),and the tertile of I-FABP showed a good discriminatory ability(χ2=12.16,P<0.001).The ROC curve showed that I-FABP had a good performance in predicting the development and progression of ACLF,with an area under the ROC curve of 0.854(95%CI:0.791-0.903)and 0.747(95%CI:0.661-0.820),respectively,and an optimal cut-off value of 2.07 μg/L and 1.86 μg/L,respectively.Conclusion I-FABP can be used as a biomarker to predict the development and progression of ACLF,and it may help to identify high-risk patients and improve clinical management.

Objective:To investigate the effect of high-fat and low-carbohydrate diet combined with radiotherapy on the tumor microenvironment of mice with lung xenografts.Methods:C57BL/6J mice were selected to establish the Lewis lung cancer model, and they were divided into the normal diet group, the high-fat and low-carbohydrate diet group, the normal diet + radiotherapy group, and the high-fat and low-carbohydrate diet + radiotherapy group, with 18 mice in each group. The mice in the normal diet group and the normal diet + radiotherapy group were fed with the normal diet with 12.11% fat for energy supply, and the mice in the high-fat and low-carbohydrate diet group and the high-fat and low-carbohydrate diet + radiotherapy group were fed with high-fat and low-carbohydratediet with 45.00% fat for energy. On the 12th to 14th days, the tumor sites of the mice in the normal diet + radiotherapy group and the high-fat and low-carbohydrate diet + radiotherapy group were treated with radiotherapy, and the irradiation dose was 24 Gy/3f. The body weight, tumor volume, blood glucose and blood ketone level, liver and kidney function, and survival status of the mice were observed and monitored. Immunohistochemical staining was used to detect the tumor-associated microangiogenesis molecule (CD34) and lymphatic endothelial hyaluronan receptor 1 (LYVE-1), Sirius staining was used to detect collagen fibers, and multiplex immunofluorescence was used to detect CD8 and programmed death-1 (PD-1). Expression of immune cell phenotypes (CD3, CD4, CD8, and Treg) was detected by flow cytometry.Results:On the 27th day after inoculation, the body weigh of the common diet group was(24.78±2.22)g, which was significantly higher than that of the common diet + radiotherapy group [(22.15±0.48)g, P=0.030] and high-fat low-carbohydrate diet + radiotherapy group [(22.02±0.77)g, P=0.031)]. On the 15th day after inoculation, the tumor volume of the high-fat and low-carbohydrate diet + radiotherapy group was (220.88±130.05) mm 3, which was significantly smaller than that of the normal diet group [(504.37±328.48) mm 3, P=0.042)] and the high-fat, low-carbohydrate diet group [(534.26±230.42) mm 3, P=0.016], but there was no statistically significant difference compared with the normal diet + radiotherapy group [(274.64±160.97) mm 3]. In the 4th week, the blood glucose values of the mice in the high-fat and low-carbohydrate diet group were lower than those in the normal diet group, with the value being (8.00±0.36) mmol/L and (9.57±0.40) mmol/L, respectively, and the difference was statistically significant ( P＜0.05). The blood ketone values of the mice in the high-fat and low-carbohydrate diet group were higher than those in the normal diet group, with the value being (1.00±0.20) mmol/L and (0.63±0.06) mmol/L, respectively, in the second week. In the third week, the blood ketone values of the two groups of mice were (0.90±0.17) mmol/L and (0.70±0.10) mmol/L, respectively, and the difference was statistically significant ( P＜0.05). On the 30th day after inoculation, there were no significant differences in aspartate aminotransferase, alanine aminotransferase, creatinine, and urea between the normal diet group and the high-fat, low-carbohydrate diet group (all P＞0.05). The hearts, livers, spleens, lungs, and kidneys of the mice in each group had no obvious toxic changes and tumor metastasis. In the high-fat and low-carbohydrate diet + radiotherapy group, the expression of CD8 was up-regulated in the tumor tissues of mice, and the expressions of PD-1, CD34, LYVE-1, and collagen fibers were down-regulated. The proportion of CD8 + T cells in the paratumoral lymph nodes of the high-fat and low-carbohydrate diet + radiotherapy group was (25.13±0.97)%, higher than that of the normal diet group [(20.60±2.23)%, P＜0.050] and the normal diet + radiotherapy group [(19.26±3.07)%, P＜0.05], but there was no statistically significant difference with the high-fat and low-carbohydrate diet group [(22.03±1.75)%, P＞0.05]. The proportion, of CD4 + T cells in the lymph nodes adjacent to the tumor in the normal diet + radiotherapy group (31.33±5.16)% and the high-fat and low-carbohydrate diet + radiotherapy group (30.63±1.70)% were higher than that in the normal diet group [(20.27±2.15)%, P＜0.05] and the high-fat and low-carbohydrate diet group (23.70±2.62, P＜0.05). Treg cells accounted for the highest (16.58±5.10)% of T cells in the para-tumor lymph nodes of the normal diet + radiotherapy group, but compared with the normal diet group, the high-fat and low-carbohydrate diet group, and the high-fat and low-carbohydrate diet + radiotherapy group, there was no statistically significant difference (all P＞0.05). Conclusion:High-fat and low-carbohydrate diet plus radiotherapy can enhance the recruitment and function of immune effector cells in the tumor microenvironment, inhibit tumor microangiogenesis, and thus inhibit tumor growth.

Zearalenone(ZEN)is a mycotoxin that extensively contaminates food and feed,posing a significant threat to public health.However,the mechanisms behind ZEN-induced intestinal immunotoxicity remain unclear.In this study,Sprague-Dawley(SD)rats were exposed to ZEN at a dosage of 5 mg/kg/day b.w.for a duration of 14 days.The results demonstrated that ZEN exposure led to notable pathological alterations and immunosup-pression within the intestine.Furthermore,ZEN exposure caused a significant reduction in the levels of apolipoprotein E(ApoE)and liver X receptor(LXR)(P＜0.05).Conversely,it upregulated the levels of myeloid-derived suppressor cells(MDSCs)markers(P＜0.05)and decreased the presence of 27-hydroxycholesterol(27-HC)in the intestine(P＜0.05).It was observed that ApoE or LXR agonists were able to mitigate the immunosuppressive effects induced by ZEN.Additionally,a bioinformatics analysis highlighted that the downregulation of ApoE might elevate the susceptibility to colorectal,breast,and lung cancers.These find-ings underscore the crucial role of the 27-HC/LXR/ApoE axis disruption in ZEN-induced MDSCs proliferation and subsequent inhibition of T lymphocyte activation within the rat intestine.Notably,ApoE may emerge as a pivotal target linking ZEN exposure to cancer development.

Objective:To analyze the mutation types and distribution characteristics of thalassemia gene among high-risk populations in Sanya City, and to evaluate the effectiveness of blood routine screening, in order to provide scientific basis for formulating measures for prevention and control of thalassemia in Sanya City.Methods:Retrospective analysis was used to collect detection results and clinical data from high-risk individuals who completed genetic screening for thalassemia at Sanya Materal and Child Health Hospital from January 2019 to August 2021. Mutation types and distribution characteristics of thalassemia gene were analyzed, and the missed detection rate and sensitivity of blood routine indicators [mean corpuscular volume (MCV) and mean corpuscular hemoglobin (MCH)] were evaluated based on the results of genetic screening for thalassemia.Results:A total of 5 760 high-risk individuals were included in the screening results of thalassemia genes, and 3 868 samples of thalassemia gene mutations were detected, with a detection rate of 67.15%. Among them, there were 2 979 samples with α-thalassemia genetic mutations, with a detection rate of 51.72%; including 2 966 common genotype samples (99.56%), the main genotype was αα/-α 3.7 (20.14%, 600/2 979); 13 rare genotype samples (0.44%), 4 cases of αα/-- THAI, 3 cases of α CD40(AAG>AA-)α/αα, 2 cases of α PPα/αα, and 1 case of Fusion gene/αα, Fusion gene/α WSα, α WSα/α PPα, and α CD40(AAG>AA-)α/α WSα each. There were 340 samples with β-thalassemia gene mutations, with a detection rate of 5.90%; including 336 common genotype samples (98.82%). The β CD41/42/β N genotype was dominant (57.65%, 196/340); 4 rare genotype samples (1.18%), β CD5(-CT)/β N, β IVS-Ⅱ-2(-T)/β N, β IVS-Ⅱ-761(-T)/β N and β Initiation(ATG>AGG)/β N 1 case each. There were 549 samples of αβ-compound type thalassemia, with a detection rate of 9.53%. The α missing recombination β CD41/42 genotype was dominant (61.02%, 335/549). There were a total of 4 226 samples that could be traced back to MCV and MCH. Among them, 3 007 samples were found to have mutations in thalassemia genes through screening, 2 584 cases were found to have abnormalities in the combination of MCV and MCH indicators, and 423 samples were missed in blood routine screening, with a missed detection rate of 14.07% (423/3 007). The missed samples were mainly α static type, accounting for 89.13% (377/423) of the total missed samples. The screening sensitivity of MCV combined with MCH for α-, β- and αβ-compound type thalassemia was 82.65%, 98.07% and 98.15%, respectively. Conclusion:The types of genetic mutations in thalassemia in Sanya City are complex and diverse, and there are certain omissions in the blood routine screening of MCV combined with MCH.

Objective:To investigate the risk factors of high intraocular pressure (IOP) after femtosecond laser in situ keratomileusis (FS-LASIK) in patients with high myopia, and construct and verify nomogram model.Methods:A retrospective clinical study. From January 2019 to January 2021, 327 patients (654 eyes) with high myopia treated with FS-LASIK in the Department of Ophthalmology of the 910th Hospital of the People's Liberation Army Coalition Security Force were included in the study. The patients were categorized into high IOP group and non-high IOP group according to whether high IOP occurred after surgery, which were 60 cases and 120 eyes (18.35%, 60/327) and 267 cases and 534 eyes (81.65%, 267/327), respectively. The clinical data of patients in the two groups were analyzed and observed, and the indicators with differences were subjected to one-way and multifactorial logistic regression analyses, and the results of the regression analyses were visualized to obtain the column line graphs using R3.5.3 software, and the accuracy of the column line graphs was verified by the consistency index (C-index), the calibration curves, and the subject's work characteristic curves (ROC curves).Results:Comparison of the number of cases of affected corneal thickness ( χ2=7.424), corneal curvature ( χ2=9.849), glucocorticoid treatment ( χ2=7.222), intraoperative IOP fluctuation ( χ2=11.475), corneal hysteresis ( χ2=6.368), and the incidence of intraoperative complications ( χ2=6.673) in the hypertensive IOP group and the nonvisualized IOP group were statistically significant ( P<0.05). Binary logistic regression analysis showed that corneal thickness >450 μm, corneal curvature≤38 D, glucocorticoid treatment, intraoperative IOP fluctuation, corneal hysteresis ≤8.0 mm Hg (1 mm Hg=0.133 kPa), and intraoperative complications were the risk factors for the occurrence of high IOP after FS-LASIK surgery in patients with high myopia ( P<0.05). The C-index of the column-line graph prediction model based on this was 0.722 (95% confidence interval 0.684-0.760), the calibration curve and the ideal curve were basically the same, and the area under the ROC curve was 0.709. Conclusions:Corneal thickness> 450 μm, keratometric curvature ≤38 D, glucocorticoid treatment, intraoperative fluctuation of intraocular pressure, and corneal hysteresis ≤8.0 mm Hg are the risk factors for the development of hyperopic IOP in highly risk factors for the development of high IOP after FS-LASIK surgery in myopic patients. The column-line diagram model constructed on the basis of the risk factors hava good accuracy.

Objective:To investigate the appetite of patients with lymphoma during chemotherapy and its influencing factors.Methods:A total of 103 patients with lymphoma who underwent chemotherapy were sequentially selected in Fujian Medical University Union Hospital from December 2020 to August 2021. The questionnaire survey was carried out by using general information and Karnofsky score was performed. Appetite score was calculated according to Chinese version of the appetite symptom questionnaire for cancer patients. Multiple linear regression analysis was used to analyze the influencing factors of appetite status of lymphoma patients during chemotherapy, and Pearson correlation analysis was used to explore the relationship between Karnofsky score and appetite score of patients.Results:For patients with lymphoma during chemotherapy, Karnofsky score was (75±18) scores and the appetite score was (25.0±5.0) scores. Univariate analysis showed that age, body mass index (BMI), nausea and vomiting, oral mucosa rupture, gum infection, fever, throat infection were influencing factors of appetite score of patients (all P < 0.05). Multivariate analysis showed that patients ' age ( B = -1.118, β = -0.187, P = 0.016), BMI ( B = -2.047, β = -0.271, P = 0.001), nausea and vomiting ( B = -4.352, β = -0.411, P < 0.001) were the independent influencing factors of appetite score. Correlation analysis showed that the Karnofsky score was positively correlated with appetite score ( r = 0.361, P < 0.05). Conclusions:Special attention should be paid to the appetite of elder lymphoma patients with lower BMI during chemotherapy, and nausea and vomiting should be paid more attention; targeted measures of increasing the patients' appetite could improve their nutritional level and prognosis.

We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.

Objective To investigate the clinical value of von Willebrand factor antigen-to-albumin ratio (VAR) score and glycocalicin index (GCI) score in predicting the development and classification of esophageal varices in comparison with von Willebrand factor antigen-to-platelet ratio (VITRO) score. Methods A retrospective analysis was performed for 146 patients with hepatitis B cirrhosis who were hospitalized from April 2020 to December 2021, and esophageal varices (EV) was diagnosed and graded with the results of gastroscopy as the standard. VITRO, VAR, and GCI were calculated, and their association with EV was analyzed. The t -test was used for comparison of normally distributed continuous data between two groups, and a one-way analysis of variance was used for comparison between multiple groups; the Mann-Whitney U test was used for comparison of non-normally distributed continuous data between two groups. The chi-square test was used for comparison of categorical data between groups. A logistic regression model analysis was used to identify the predictive factors for EV, and the receiver operating characteristic (ROC) curve was used to evaluate the diagnostic accuracy of each index. Results Gastroscopy showed 54 patients without EV, 30 with mild EV, 33 with moderate EV, and 29 with severe EV. The patients with EV had significantly higher VAR and GCI scores than those without EV ( t =-5.819 and -3.449, both P < 0.001). The linear regression analysis showed that VAR and GCI increased with the increase in EV grade ( P =0.002 and 0.005). The multivariate logistic regression analysis showed that VAR (odds ratio [ OR ]=1.46, 95% confidence interval [ CI ]: 1.21-1.75, P < 0.001) and GCI ( OR =1.84, 95% CI : 1.22-2.77, P =0.003) were independently associated with EV. VITRO score had an area under the ROC curve (AUC) of 0.718 in diagnosing EV and 0.863 in diagnosing severe EV, with the optimal cut-off values of 2.77 and 5.37, respectively. VAR and GCI had an AUC of 0.745 and 0.710, respectively, in diagnosing EV, with the optimal cut-off values of 8.88 and 1.70, respectively; VAR and GCI had an AUC of 0.755 and 0.787, respectively, in diagnosing severe EV, with the optimal cut-off values of 9.81 and 2.00, respectively. VAR combined with GCI had significantly better efficacy than VITRO in diagnosing EV ( P =0.009), with an AUC of 0.808, a sensitivity of 55.43%, and a specificity of 94.44%; VAR combined with GCI had an AUC of 0.869 in diagnosing severe EV, which was similar to VITRO ( P =0.421). Conclusion VAR and GCI scores are potential noninvasive markers for the prediction and risk stratification of EV in patients with hepatitis B cirrhosis.