1.Prognostic Roles of Inflammatory Biomarkers in Radioiodine-Refractory Thyroid Cancer Treated with Lenvatinib
Chae A KIM ; Mijin KIM ; Meihua JIN ; Hee Kyung KIM ; Min Ji JEON ; Dong Jun LIM ; Bo Hyun KIM ; Ho-Cheol KANG ; Won Bae KIM ; Dong Yeob SHIN ; Won Gu KIM
Endocrinology and Metabolism 2024;39(2):334-343
Background:
Inflammatory biomarkers, such as the neutrophil-to-lymphocyte ratio (NLR), lymphocyte-to-monocyte ratio (LMR), and platelet-to-lymphocyte ratio (PLR), serve as valuable prognostic indicators in various cancers. This multicenter, retrospective cohort study assessed the treatment outcomes of lenvatinib in 71 patients with radioactive iodine (RAI)-refractory thyroid cancer, considering the baseline inflammatory biomarkers.
Methods:
This study retrospectively included patients from five tertiary hospitals in Korea whose complete blood counts were available before lenvatinib treatment. Progression-free survival (PFS) and overall survival (OS) were evaluated based on the median value of inflammatory biomarkers.
Results:
No significant differences in baseline characteristics were observed among patients grouped according to the inflammatory biomarkers, except for older patients with a higher-than-median NLR (≥2) compared to their counterparts with a lower NLR (P= 0.01). Patients with a higher-than-median NLR had significantly shorter PFS (P=0.02) and OS (P=0.017) than those with a lower NLR. In multivariate analysis, a higher-than-median NLR was significantly associated with poor OS (hazard ratio, 3.0; 95% confidence interval, 1.24 to 7.29; P=0.015). However, neither the LMR nor the PLR was associated with PFS. A higher-than-median LMR (≥3.9) was significantly associated with prolonged OS compared to a lower LMR (P=0.036). In contrast, a higher-than-median PLR (≥142.1) was associated with shorter OS compared to a lower PLR (P=0.039).
Conclusion
Baseline inflammatory biomarkers can serve as predictive indicators of PFS and OS in patients with RAI-refractory thyroid cancer treated with lenvatinib.
2.Dynamic Risk Model for the Medical Treatment of Graves’ Hyperthyroidism according to Treatment Duration
Meihua JIN ; Chae A KIM ; Min Ji JEON ; Won Bae KIM ; Tae Yong KIM ; Won Gu KIM
Endocrinology and Metabolism 2024;39(4):579-589
Background:
Changes in thyrotropin receptor antibody (TRAb) levels are associated with the clinical outcomes of Graves’ hyperthyroidism. However, the effects of the patterns of TRAb changes on patient prognosis according to the treatment duration of antithyroid drugs (ATDs) are not well established.
Methods:
In this retrospective cohort study, 1,235 patients with Graves’ hyperthyroidism who were treated with ATDs for more than 12 months were included. Patients were divided into two groups according to treatment duration: group 1 (12–24 months) and group 2 (>24 months). Risk prediction models comprising age, sex, and either TRAb levels at ATD withdrawal (model A) or patterns of TRAb changes (model B) were compared.
Results:
The median treatment duration in groups 1 (n=667, 54%) and 2 (n=568, 46%) was 17.3 and 37.1 months, respectively. The recurrence rate was significantly higher in group 2 (47.9%) than in group 1 (41.4%, P=0.025). Group 2 had significantly more goiter, thyroid eye disease, and fluctuating and smoldering type of TRAb pattern compared with group 1 (all P<0.001). The patterns of TRAb changes were an independent risk factor for recurrence after adjusting for other confounding factors in all patients, except in group 1. Integrated discrimination improvement and net reclassification improvement analyses showed that model B performed better than model A in all patients, except in group 1.
Conclusion
The dynamic risk model, including the patterns of TRAb changes, was more suitable for predicting prognosis in patients with Graves’ hyperthyroidism who underwent longer ATD treatment duration.
3.Immunoglobulin G4-Related Thyroid Disease: A Single-Center Experience and Literature Review
Meihua JIN ; Bictdeun KIM ; Ahreum JANG ; Min Ji JEON ; Young Jun CHOI ; Yu-Mi LEE ; Dong Eun SONG ; Won Gu KIM
Endocrinology and Metabolism 2022;37(2):312-322
Background:
Immunoglobulin G4 (IgG4)-related disease is an entity that can involve the thyroid gland. The spectrum of IgG4-related thyroid disease (IgG4-RTD) includes Hashimoto thyroiditis (HT) and its fibrotic variant, Riedel thyroiditis, as well as Graves’ disease. The early diagnosis of IgG4-RTD is important because it is a medically treatable disease, and a delay in the diagnosis might result in unnecessary surgery. We present a case series of IgG4-RTD with a review of the literature.
Methods:
We retrospectively reviewed the clinical presentation and the radiological and pathological findings of patients diagnosed with IgG4-RTD between 2017 and 2021 at a tertiary medical center in Korea. We also conducted a literature review of IgG4-RTD.
Results:
Five patients were diagnosed with IgG4-RTD during the study period. The patients’ age ranged from 31 to 76 years, and three patients were men. Most patients visited the clinic for a neck mass, and hypoechogenic nodular lesions were observed on neck ultrasonography. Three patients had IgG4 HT, and two patients had IgG4 Riedel thyroiditis. All patients developed hypothyroidism that necessitated L-thyroxine replacement. The diagnosis of IgG4-RTD was confirmed after a pathological examination of the surgical specimen in the first two cases. However, the early diagnosis was possible after a core needle biopsy in three clinically suspected patients.
Conclusion
The diagnosis of IgG4-RTD requires clinical suspicion combined with serology and histological analyses using IgG4 immunostaining. The early diagnosis of IgG4-RTD is difficult; thus, biopsy with IgG4 immunostaining and serum IgG4 measurements will help diagnose patients suspected of having IgG4-RTD.
4.Akinesia deformation sequence in a fetus suspected by prenatal ultrasound and confirmed after mid-term termination
Xinyao LUO ; Qiuyang GU ; Xinxiu LIU ; Jianhua LI ; Liyan HUANG ; Xiaohua HUANG ; Shengnan WU ; Jingping YANG ; Meihua TAN
Chinese Journal of Perinatal Medicine 2022;25(3):218-221
We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.
5.Construction and application effect of Internet + linkage model based on medical alliance
Zhemin WANG ; Hongbo ZHANG ; Liu SHEN ; Hong CHEN ; Pei HUANG ; Yan FEI ; Hui ZHU ; Meihua GU
Chinese Journal of Modern Nursing 2022;28(6):793-797
Objective:To construct an Internet + linkage model based on medical alliance and evaluate its implementation effect.Methods:From October 2020 to June 2021, convenience sampling was used to select 132 patients with malignant tumors who were treated with peripherally inserted central catheters (PICC) chemotherapy and discharged with catheters in Chongming Branch of Xinhua Hospital Affiliated to Shanghai Jiaotong University School of Medicine. The 67 patients who returned to the PICC outpatient clinic of Chongming Branch, Xinhua Hospital Affiliated to Shanghai Jiaotong University School of Medicine during the treatment interval for PICC maintenance were set as the control group, and the routine maintenance method was adopted. A total of 65 patients who chose maintenance points near their residence for PICC maintenance during the treatment interval were set as the observation group. On the basis of the control group, the maintenance method based on the Internet + linkage mode of medical alliance was adopted. The PICC self-management ability, catheter-carrying satisfaction, PICC complication, average cost and average time spent on PICC maintenance during treatment were compared between the two groups.Results:There were no significant differences in the scores of daily life with catheters, exercise with catheters, catheter abnormality handling, compliance with catheter maintenance and confidence in catheter management between the two groups ( P>0.05) . There was no significant difference in the scores of Catheter Satisfaction Survey in the two groups of patients ( P>0.05) .There was also no significant difference in the incidence of PICC complications between the two groups ( P>0.05) . The registration fee, maintenance fee, and transportation fee for PICC maintenance in the observation group were lower than those in the control group, and the round-trip time and visit time were shorter than those in the control group, and the differences were statistically significant ( P<0.05) . Conclusions:The Internet + linkage model based on the medical alliance can ensure the quality of PICC maintenance for patients with malignant tumors undergoing PICC chemotherapy and discharged with catheters, and improve their PICC self-management ability, which has good economic and time benefits.
6.Clinicopathological Characteristics and Disease-Free Survival in Patients with Hürthle Cell Carcinoma: A Multicenter Cohort Study in South Korea
Meihua JIN ; Eun Sook KIM ; Bo Hyun KIM ; Hee Kyung KIM ; Yea Eun KANG ; Min Ji JEON ; Tae Yong KIM ; Ho-Cheol KANG ; Won Bae KIM ; Young Kee SHONG ; Mijin KIM ; Won Gu KIM
Endocrinology and Metabolism 2021;36(5):1078-1085
Background:
Hürthle cell carcinoma (HCC), a type of thyroid carcinoma, is rare in South Korea, and few studies have investigated its prognosis.
Methods:
This long-term multicenter retrospective cohort study evaluated the clinicopathological features and clinical outcomes in patients with HCC who underwent thyroid surgery between 1996 and 2009.
Results:
The mean age of the 97 patients included in the study was 50.3 years, and 26.8% were male. The mean size of the primary tumor was 3.2±1.8 cm, and three (3.1%) patients had distant metastasis at initial diagnosis. Ultrasonographic findings were available for 73 patients; the number of nodules with low-, intermediate-, and high suspicion was 28 (38.4%), 27 (37.0%), and 18 (24.7%), respectively, based on the Korean-Thyroid Imaging Reporting and Data System. Preoperatively, follicular neoplasm (FN) or suspicion for FN accounted for 65.2% of the cases according to the Bethesda category, and 13% had malignancy or suspicious for malignancy. During a median follow-up of 8.5 years, eight (8.2%) patients had persistent/recurrent disease, and none died of HCC. Older age, gross extrathyroidal extension (ETE), and widely invasive types of tumors were significantly associated with distant metastasis (all P<0.01). Gross ETE (hazard ratio [HR], 27.7; 95% confidence interval [CI], 2.2 to 346.4; P=0.01) and widely invasive classification (HR, 6.5; 95% CI, 1.1 to 39.4; P=0.04) were independent risk factors for poor disease-free survival (DFS).
Conclusion
The long-term prognosis of HCC is relatively favorable in South Korea from this study, although this is not a nation-wide data, and gross ETE and widely invasive cancer are significant prognostic factors for DFS. The diagnosis of HCC by ultrasonography and cytopathology remains challenging.
7.Treatment and prognosis of severe hyperbilirubinemia in full-term infants meeting exchange transfusion criteria: a multicenter retrospective study
Ling LI ; Meihua PIAO ; Wei GUO ; Jingqun WANG ; Shuxia GENG ; Mei YANG ; Xin HE ; Shufen ZHAI ; Lili PING ; Baoli TIAN ; Lixia LIANG ; Fang LIU ; Shaoguang LYU ; Xueai FAN ; Liyuan HUI ; Liyan LIU ; Xiaohong GU ; Xiaojiao WANG ; Jing KANG
Chinese Journal of Perinatal Medicine 2021;24(6):454-460
Objective:To investigate the prognosis of severe hyperbilirubinemia in full-term infants who met the exchange transfusion criteria and were treated by blood exchange transfusion and phototherapy.Methods:A total of 168 full-term infants with severe hyperbilirubinemia who met the criteria for exchange transfusion and were hospitalized in the Neonatology Department of seven tertiary hospitals in Hebei Province from June 2017 to December 2018 were retrospectively included. According to the treatment protocol, they were divided into two groups: exchange transfusion group (38 cases) and phototherapy group (130 cases). Two independent sample t-test and Chi-square test were used to compare the clinical manifestations and follow-up results between the two groups. Multivariate logistic regression was used to analyze the risk factors for poor prognosis. Results:Neonatal severe hyperbilirubinemia in the exchange transfusion and phototherapy group were both mainly caused by hemolytic disease [42.1%(16/38) and 29.2%(38/130)], sepsis [28.9%(11/38) and 11.5%(15/130)] and early-onset breastfeeding jaundice [15.8%(6/38) and 11.5%(15/130)]. Total serum bilirubin level on admission in the exchange transfusion group was significantly higher than that in the phototherapy group [(531.7±141.3) vs (440.0±67.4) μmol/L, t=3.870, P<0.001]. Moreover, the percentage of patients with mild, moderate and severe acute bilirubin encephalopathy in the exchange transfusion group were higher than those in the phototherapy group [15.8%(6/38) vs 3.8%(5/130), 7.9%(3/38) vs 0.8%(1/130), 13.2%(5/38) vs 0.0%(0/130); χ2=29.119, P<0.001]. Among the 168 patients, 135 were followed up to 18-36 months of age and 12 showed poor prognosis (developmental retardation or hearing impairment) with four in the exchange transfusion group (12.9%, 4/31) and eight in the phototherapy group (7.7%, 8/104). Multivariate logistic regression analysis showed that for full-term infants with severe hyperbilirubinemia who met the exchange transfusion criteria, phototherapy alone without blood exchange transfusion as well as severe ABE were risk factors for poor prognosis ( OR=14.407, 95% CI: 1.101-88.528, P=0.042; OR=16.561, 95% CI: 4.042-67.850, P<0.001). Conclusions:Full-term infants who have severe hyperbilirubinemia and meet the exchange transfusion criteria should be actively treated with blood exchange transfusion, especially for those with severe ABE, so as to improve the prognosis.
8.Competencies in health education among pediatric nurses: analysis from GDP percapital level
Qingqing SONG ; Lihui ZHU ; Yuxia ZHANG ; Meihua LIU ; Yin GU ; Jianxiong PENG
Chinese Journal of Practical Nursing 2021;37(15):1169-1176
Objective:To explore whether the inequality of economic development in different provinces in China leads to differences in pediatric nurses ′ health education literacy and to analyze related factors affecting pediatric nurses ′ health education literacy. Methods:Self-designed and tested online questionnaire of competencies in health education (scoring scale 10-50) were distributed to pediatric nurses in China in October 2018. We examined the influencing factors of competencies in health education and its relationship with the province-level data on gross domestic product (GDP) per capita.Results:A total of 15 443 pediatric nurses from 31 provinces were eligible for the analysis. At the regional of GDP per capital over than 20 000 US dollars, 15 000 to 20 000 US dollars, 10 000 to 14 900 US dollars and less than 10 000 US dollars, the health education literacy scores were 40.76±4.52, 40.66±4.08, 40.50± 4.02 and 39.69±4.32 respectively. Significant difference was found between the competencies in health education of pediatric nurses and provinces with different GDP per capita ( F value was 9.21, P<0.001). Regression and hierarchical analysis models based on GDP per capita showed that: nurses with senior professional titles, bachelor degrees or above, aged over 40, and those working in emergency rooms have higher competencies in health education ( OR value was 0.296-4.766, P<0.05) . Lower competencies in health education were demonstrated on nurses who have been working less than 5 years ( OR value was 0.319, P<0.05). Conclusions:Economic development is one of the main factors that affect the competencies in health education of pediatric nurses in China. Pediatric nurses who were young, had limited working experience, with low office titles, with low education background, and who working at non-emergency rooms require more training.
9.Clinical Outcomes after Early and Delayed Radioiodine Remnant Ablation in Patients with Low-Risk Papillary Thyroid Carcinoma: Propensity Score Matching Analysis
Jonghwa AHN ; Meihua JIN ; Eyun SONG ; Min Ji JEON ; Tae Yong KIM ; Jin-Sook RYU ; Won Bae KIM ; Young Kee SHONG ; Ji Min HAN ; Won Gu KIM
Endocrinology and Metabolism 2020;35(4):830-837
Background:
The clinical outcomes of delayed radioiodine remnant ablation (RRA) therapy in patients with low-risk papillary thyroid carcinoma (PTC) are unclear. We aimed to evaluate the clinical impact of the interval between total thyroidectomy (TT) and RRA therapy in patients with low-risk PTC.
Methods:
We included 526 patients who underwent TT and RRA for low-risk PTC with a primary tumor size of >1 cm between 2000 and 2012. Patients were divided into the early (<90 days) and the delayed (≥90 days) RRA groups based on the interval between TT and RRA. The results of diagnostic whole-body scan (DxWBS), ongoing risk stratification (ORS; response to therapy), and disease-free survival (DFS) were evaluated before and after propensity score matching (PSM).
Results:
Among the 526 patients, 75 (14.3%) patients underwent delayed RRA; they had more cervical lymph node metastasis and received a higher RRA dose than those who underwent early RRA. The median follow-up period was 9.1 years after initial therapy, and the structural recurrence rate was 1.9%. In DxWBS, 60 patients had focal iodine uptake limited in operative bed, with no significant difference between groups. According to ORS, 78%, 20%, 1%, and 1% patients were classified into excellent, indeterminate, biochemical incomplete, and structural incomplete response groups, respectively. There was no significant difference in ORS or DFS between groups before and after PSM.
Conclusion
The timing of the first RRA had no clinical impact in patients with low-risk PTC. Thus, the clinical decision for RRA can be determined >3 months after TT considering other prognostic factors.
10.Clinical Implication of World Health Organization Classification in Patients with Follicular Thyroid Carcinoma in South Korea: A Multicenter Cohort Study
Meihua JIN ; Eun Sook KIM ; Bo Hyun KIM ; Hee Kyung KIM ; Hyon-Seung YI ; Min Ji JEON ; Tae Yong KIM ; Ho-Cheol KANG ; Won Bae KIM ; Young Kee SHONG ; Mijin KIM ; Won Gu KIM
Endocrinology and Metabolism 2020;35(3):618-627
Background:
The study aimed to compare the prognostic value of the 4th edition of World Health Organization classification (WHO-2017) with the previous WHO classification (WHO-2004) for follicular thyroid carcinoma (FTC).
Methods:
This multicenter retrospective cohort study included 318 patients with FTC from five tertiary centers who underwent thyroid surgery between 1996 and 2009. We evaluated the prognosis of patients with minimally invasive (MI), encapsulated angioinvasive (EA), and widely invasive (WI) FTC according to WHO-2017. Further, we evaluated the proportion of variation explained (PVE) and Harrell’s C-index to compare the predictability of disease-free survival (DFS) and disease-specific survival (DSS).
Results:
In total, 227, 58, and 33 patients had MI-, EA-, and WI-FTC, respectively. During a median follow-up of 10.6 years, 46 (14.5%) patients had disease recurrence and 20 (6.3%) patients died from FTC. The 10-year DFS rates of patients with MI-, EA-, and WI-FTC were 91.1%, 78.2%, and 54.9%, respectively (P<0.001, PVE=7.1%, C-index=0.649). The corresponding 10-year DSS rates were 95.9%, 93.5%, and 73.5%, respectively (P<0.001, PVE=2.6%, C-index=0.624). The PVE and C-index values were higher using WHO-2017 than using WHO-2004 for the prediction of DFS, but not for DSS. In multivariate analysis, older age (P=0.02), gross extrathyroidal extension (ETE) (P=0.003), and distant metastasis (P<0.001) were independent risk factors for DSS.
Conclusion
WHO-2017 improves the predictability of DFS, but not DSS, in patients with FTC. Distant metastasis, gross ETE and older age (≥55 years) were independent risk factors for DSS.

Result Analysis
Print
Save
E-mail