Objective By organizing and implementing a laboratory proficiency validation plan for air change rate testing, this study aims to explore proficiency testing approaches in laboratory animal facilities, assess the current status of relevant laboratories regarding standard application and test capabilities, standardize air change rate testing methods, and ensure the accuracy and reliability of test results. Methods From September to November 2023, the National Institutes for Food and Drug Control (NIFDC) organized a laboratory proficiency validation plan for air change rate testing in laboratory animal facilities (Plan Number: NIFDC-PT-417). The proficiency testing was conducted on-site and consisted of two parts: a written test and practical operation. The written test was open-book. True/false questions focused on participants' understanding of specific clauses in relevant standards, while application-based questions assessed their ability to handle data processing in simulated testing scenarios. The practical operation was conducted according to the relevant criteria of the China National Accreditation Service for Conformity Assessment (CNAS). Two laboratory animal rooms were prepared as proficiency testing samples using a sample splitting approach. These rooms underwent uniformity and stability testing according to CNAS requirements and were approved. Participating laboratories were required to conduct three tests on each of the two laboratory animal rooms, complete the testing and calculation of air change rate within the specified timeframe, and submit their test result reports and original records. Results A total of 27 laboratories registered and participated in the proficiency testing. All participating laboratories submitted their results within the designated timeframe, and the outcomes of all tested laboratories were rated as satisfactory. Conclusion This proficiency validation program objectively and scientifically evaluates the air change rate testing capabilities of selected domestic laboratories, effectively promoting the overall improvement of testing capabilities in the industry. It provides technical support for regulatory authorities to standardize testing institutions and offers reliable references for the purchase of testing services. Through this activity, it was identified that some laboratories need to further enhance their calibration of instruments and the utilization of calibration results. Future efforts should focus on refining related standards to improve the accuracy and reliability of testing.

AIM: To compare the application of two distinct suspension suture fixation techniques in intraocular lens implantation.METHODS: Retrospective study. A total of 60 patients(60 eyes)who underwent intraocular lens suspension surgery at ophthalmology department of our hospital between January 1, 2021, and December 1, 2023 were included. Patients were divided into two groups based on the suturing techniques: the control group(n=30)received sub-scleral flap suture fixation, while the intervention group(n=30)underwent Z-shaped suture fixation. A 6 mo postoperative follow-up was conducted to assess surgical duration, visual acuity and quality, ocular structure, clinical efficacy, postoperative expose rate of sutures, diopters and decentration of intraocular lens.RESULTS:The mean operative time was significantly longer in the intervention group(50.5±3.1 min)compared to the control group(40.9±2.8 min; P<0.01). At 6 mo postoperatively, both groups demonstrated significant improvements in uncorrected and best-corrected visual acuity compared to preoperative values(both P<0.01), and there were no statistically significant differences in the uncorrected and best corrected visual acuity between the two groups(all P>0.05); at 6 mo postoperatively, the visual quality of the intervention group was better than that of the control group(P<0.05). While both groups exhibited a significant reduction in corneal endothelial cell count postoperatively(both P<0.01), there was no significant difference between the groups(P>0.05). The overall efficacy rate and suture exposure rate were comparable between the groups at 6 mo postoperatively(P=0.542 and P>0.05, respectively). However, significant differences were observed in postoperative diopters and intraocular lens decentration between the two groups(both P<0.01).CONCLUSION:Although both suture fixation techniques yielded satisfactory clinical outcomes in intraocular lens implantation, the Z-shaped suture fixation demonstrated superior performance in terms of visual quality and preservation of ocular structural integrity.

Objective: To explore the effects of Cldn14 gene knockout on renal metabolism and stone formation in rats，so as to provide reference for research in the field of urinary calium metabolism and stone formation. Methods: Cldn14 gene knockout homozygous rats and wild-type rats of the same age were randomly divided into 4 groups：wild-type control (WC) group，wild-type ethylene glycol (WE) group，gene knockout control (KC) group and gene knockout ethylene glycol (KE) group，with 10 rats in each group.The WE and KE groups were induced with ethylene glycol + ammonium chloride to form kidney stones，while the WC and KC groups received normal saline gavage.After 4 weeks of standard maintenance feeding，the urine samples were collected to detect the venous blood.The kidneys were collected for HE，Pizzolatto's staining and transmission electron microscopy.The protein in renal tissues was extracted to detect the expressions of Claudin16 and Claudin19. Results: Crystal deposition was observed in the renal tubular lumen of the WE and the KE groups，and more crystals were detected in the KE group.The WE group had a large number of intracytoplasmic black crystalline inclusions observed in renal tubular epithelial cells under transmission electron microscope，followed by the KE and KC groups.Compared with WC and WE groups，KC and KE groups had significantly decreased serum calcium and magnesium levels but significantly increased urinary calcium level.In addition，the urinary calcium level was higher in the WE group than in the WC group and higher in the KE group than in the KC group.The KE group had lower level of Claudin16，but there was no significant difference in the level of Claudin19 among the 4 groups(P>0.05). Conclusion: Knockout of Cldn14 gene alone cannot effectively reduce urinary calcium excretion or reduce the risk of stone formation in rats，which may be related to the decrease of Claudin16 level.

Objective To evaluate the therapeutic efficacy for surgical treatments among patients with hepatic cystic echinococcosis in Gansu Province from 2006 to 2023, so as to provide insights into optimization of the diagnosis and treatment strategies against hepatic cystic echinococcosis. Methods The demographic and clinical data of all echinococcosis cases included in central government fiscal transfer payment program for echinococcosis control and undergoing surgical treatments in Gansu Province from 2006 to 2023 were captured. Hepatic cystic echinococcosis patients with complete medical records and follow-up data were included in the study, and patients’ characteristics, including hospital where patients received diagnosis and treatment, methods of case identification, year of surgery, classification of lesions, number of lesions, size of lesions, course of disease, surgical methods, and post-surgical follow-up data. The cure and recurrence of hepatic cystic echinococcosis were evaluated according to the Guidelines for Management of Echinococcosis Patients in the Central Government Fiscal Transfer Payment Program, and the cure and recurrent rates were calculated. Results Data were collected from 1 686 surgical patients with hepatic cystic echinococcosis. According to the inclusion and exclusion criteria, 1 222 hepatic cystic echinococcosis patients undergoing surgical treatments were included during the period from 2006 to 2022, including 1 166 cured patients (95.42%) and 88 patients with postsurgical recurrence (7.20%), and the cure rate of surgical treatments appeared a tendency towards a rise among patients with hepatic cystic echinococcosis from 2008 to 2022 (χ²_trend = 19.39, P < 0.05). The cure rates of hepatic cystic echinococcosis were 100% (177/177), 94.81% (128/135) and 94.62% (861/910) among patients detected through regular physical examinations, screened by the central government fiscal transfer payment program for echinococcosis control, and those who passively sought healthcare services, respectively (χ² = 9.95, P < 0.05). The cure rates of hepatic cystic echinococcosis were 95.96% (1 046/1 090) among patients with a disease course of 2 years and less and 90.90% (120/132) among patients with a disease course of over 2 years (χ² = 6.87, P < 0.05), and there were significant differences in the cure rates among patients with hepatic cystic echinococcosis in terms of number of lesions (χ² = 24.44, P < 0.05) and surgical methods (P < 0.05). The cure rate of hepatic cystic echinococcosis patients was significantly higher following initiation of the central government fiscal transfer payment program for echinococcosis control (96.06%, 1 096/1 141) than before the program (86.42%, 70/81) (χ² = 16.06, P < 0.05), and the cure rate of hepatic cystic echinococcosis patients was significantly higher in designated hospitals (96.48%, 741/768) than in non-designated hospitals (93.37%, 366/392) (χ² = 5.78, P < 0.05). The median follow-up period was 4 (interquartile range, 7) years among 1 222 hepatic cystic echinococcosis patients undergoing surgical treatments. The recurrent rate of hepatic cystic echinococcosis appeared a tendency towards a decline from 2008 to 2022 (χ²_trend = 36.86, P < 0.05), with a reduction from 23.08% (9/39) in 2008 to 1.85% (1/54) in 2021, and the post-surgical recurrence rate of hepatic cystic echinococcosis was lower following initiation of the central government fiscal transfer payment program for echinococcosis control (5.87%, 67 / 1 141) than before the program (25.93%, 21/81) (χ² = 45.51, P < 0.05). In addition, the post-surgical recurrence rate of hepatic cystic echinococcosis was higher in non-designated hospitals (10.46%, 41/392) than in designated hospitals (5.60%, 43/768) (χ² = 9.12, P < 0.05), and there was a significant difference in the post-surgical recurrence rate among patients with hepatic cystic echinococcosis in terms of surgical methods (P < 0.05), with the highest recurrence rate (11.54%) seen among patients undergoing percutaneous fine-needle aspiration of cyst fluids-based surgical procedures (P < 0.05). Conclusion Since the initiation of the central government fiscal transfer payment program for echinococcosis control in Gansu Province in 2006, an increase in the surgical cure rate and a reduction in the recurrence of hepatic cystic echinococcosis had been found among patients with hepatic cystic echinococcosis, indicating a high overall therapeutic efficacy.

ObjectiveThis paper aims to verify the therapeutic effect of Cranial Painkiller pills' extract powder prepared by the new process on the rat's trigeminal neuralgia model caused by infraorbital injection of Talci Pulvis， evaluate its potential clinical application value， and compare the therapeutic effect with that of Cranial Painkiller granules， so as to provide data support for the application of the Cranial Painkiller pills' extract powder and precise treatment. MethodsThe rat's trigeminal neuralgia model was constructed by infraorbital injection of Talci Pulvis， and the rats were randomly divided into the normal group， model group， carbamazepine group （60 mg·kg^-1）， Cranial Painkiller granules group （2.70 g·kg^-1）， and low， medium， and high dosage groups of Cranial Painkiller pills' extract powder （1.35， 2.70， 5.40 g·kg^-1） according to the basal mechanical pain thresholds， and there were 10 rats in each group. The drug was administered by gavage to each group 2 h after modeling， and distilled water was given by gavage to the normal and model groups under the same conditions once a day for 10 d. Von Frey brushes were used to measure mechanical pain thresholds in rats. Hematoxylin-eosin （HE） staining was used to detect pathological changes in the trigeminal ganglion， and enzyme-linked immunosorbent assay （ELISA） was used to detect the inflammatory factors interleukin-1 （IL-1）， interleukin-6 （IL-6）， interleukin-8 （IL-8）， and tumor necrosis factor-α （TNF-α） levels in rat serum， as well as neuropeptide substance P （SP） and β-endorphin （β-EP） levels in rat brain tissue. Western blot technique was used to detect the levels of NLRP3， ASC， Caspase-1， and OTULIN proteins in rat brain tissue. ResultsCompared with the normal group， the pain threshold of rats in the model group showed a continuous significant decrease （P<0.01）. The pathological damage of brain tissue was significant （P<0.01）， and the inflammatory levels of IL-1， IL-6， IL-8， and TNF-α in serum were significantly elevated （P<0.01）. The level of the SP in the brain tissue was significantly elevated （P<0.01）， and the level of β-EP was significantly reduced （P<0.01）， while the level of OTULIN was significantly reduced， and NLRP3， ASC， and Caspase-1 protein levels were significantly elevated （P<0.01）. After administration of the drug， compared with the model group， the pain threshold of each dose group of the Cranial Painkiller pills' extract powder and the Cranial Painkiller granules group significantly increased （P<0.01）. The inflammatory levels of IL-1， IL-6， IL-8， and TNF-α and SP levels significantly decreased （P<0.01）， and the β-EP levels were significantly elevated （P<0.01）， while the levels of OTULIN protein were significantly elevated （P<0.05， P<0.01）， and the levels of NLRP3， ASC proteins were decreased （P<0.01）in high dose Cranial Painkiller pills' extract powder. Meanwhile， compared with those in the model group， the trigeminal ganglion lesions of rats in the Cranial Painkiller pills' extract powder and Cranial Painkiller granules groups showed different degrees of improvement （P<0.05， P<0.01）. ConclusionThe Cranial Painkiller pills' extract powder has significant therapeutic effects on the rat model of trigeminal neuralgia induced by infraorbital injection of Talci Pulvis， and its mechanism is related to the improvement of OTULIN-regulated neuroinflammation.

ObjectiveThis paper aims to verify the therapeutic effect of Cranial Painkiller pills' extract powder prepared by the new process on the rat's trigeminal neuralgia model caused by infraorbital injection of Talci Pulvis， evaluate its potential clinical application value， and compare the therapeutic effect with that of Cranial Painkiller granules， so as to provide data support for the application of the Cranial Painkiller pills' extract powder and precise treatment. MethodsThe rat's trigeminal neuralgia model was constructed by infraorbital injection of Talci Pulvis， and the rats were randomly divided into the normal group， model group， carbamazepine group （60 mg·kg^-1）， Cranial Painkiller granules group （2.70 g·kg^-1）， and low， medium， and high dosage groups of Cranial Painkiller pills' extract powder （1.35， 2.70， 5.40 g·kg^-1） according to the basal mechanical pain thresholds， and there were 10 rats in each group. The drug was administered by gavage to each group 2 h after modeling， and distilled water was given by gavage to the normal and model groups under the same conditions once a day for 10 d. Von Frey brushes were used to measure mechanical pain thresholds in rats. Hematoxylin-eosin （HE） staining was used to detect pathological changes in the trigeminal ganglion， and enzyme-linked immunosorbent assay （ELISA） was used to detect the inflammatory factors interleukin-1 （IL-1）， interleukin-6 （IL-6）， interleukin-8 （IL-8）， and tumor necrosis factor-α （TNF-α） levels in rat serum， as well as neuropeptide substance P （SP） and β-endorphin （β-EP） levels in rat brain tissue. Western blot technique was used to detect the levels of NLRP3， ASC， Caspase-1， and OTULIN proteins in rat brain tissue. ResultsCompared with the normal group， the pain threshold of rats in the model group showed a continuous significant decrease （P<0.01）. The pathological damage of brain tissue was significant （P<0.01）， and the inflammatory levels of IL-1， IL-6， IL-8， and TNF-α in serum were significantly elevated （P<0.01）. The level of the SP in the brain tissue was significantly elevated （P<0.01）， and the level of β-EP was significantly reduced （P<0.01）， while the level of OTULIN was significantly reduced， and NLRP3， ASC， and Caspase-1 protein levels were significantly elevated （P<0.01）. After administration of the drug， compared with the model group， the pain threshold of each dose group of the Cranial Painkiller pills' extract powder and the Cranial Painkiller granules group significantly increased （P<0.01）. The inflammatory levels of IL-1， IL-6， IL-8， and TNF-α and SP levels significantly decreased （P<0.01）， and the β-EP levels were significantly elevated （P<0.01）， while the levels of OTULIN protein were significantly elevated （P<0.05， P<0.01）， and the levels of NLRP3， ASC proteins were decreased （P<0.01）in high dose Cranial Painkiller pills' extract powder. Meanwhile， compared with those in the model group， the trigeminal ganglion lesions of rats in the Cranial Painkiller pills' extract powder and Cranial Painkiller granules groups showed different degrees of improvement （P<0.05， P<0.01）. ConclusionThe Cranial Painkiller pills' extract powder has significant therapeutic effects on the rat model of trigeminal neuralgia induced by infraorbital injection of Talci Pulvis， and its mechanism is related to the improvement of OTULIN-regulated neuroinflammation.

Objective: To compare the intervention effects of sitagliptin combined with metformin and insulin aspart combined with metformin among patients with type 2 diabetes mellitus (T2DM), so as to provide the reference for optimizing blood glucose control strategies among patients with T2DM. Methods: T2DM patients admitted to the department of endocrinology of Jinhua Central Hospital from January 2018 to December 2024 were selected as the research objects. According to the propensity score matching, T2DM patients were divided into sitagliptin combined with metformin group and insulin aspart combined with metformin group at a ratio of 1∶1. The basic information, capillary blood glucose, glycosylated hemoglobin blood glucose (HbA1c), total cholesterol (TC), high density lipoprotein cholesterol (HDL-C), triglyceride (TG), body mass index (BMI), systolic blood pressure (SBP) and diastolic blood pressure (DBP) of the two groups were collected by questionnaire survey, physical examination and laboratory test. The generalized estimating equation was used to analyze the changes of various indicators before and after treatment between the two groups of patients, and the intervention effect was compared. Results: There were 69 cases in the sitagliptin combined with metformin group. Among these 42 cases were males, accounting for 60.87%, and 27 cases were females, accounting for 39.13%.Forty-two cases were younger than 60 years, accounting for 60.87%. There were 69 cases in the insulin aspart combined with metformin group. Among these 47 cases were males, accounting for 68.12%, and 22 cases were females, accounting for 31.88%. Forty-five cases were younger than 60 years, accounting for 65.22%. There were no statistically significant differences in gender, age, education level, smoking, drinking, vegetable and fruit intake, and disease duration between the two groups (all P>0.05). After 6 months of treatment, there was an interaction between group and time in capillary blood glucose and HbA1c in the two groups (all P<0.05), and the reduction of capillary blood glucose and HbA1c in the sitagliptin combined with metformin group was greater than that in the insulin aspart combined with metformin group. There were no statistically significant differences between groups and time in TC, HDL-C, TG, BMI, SBP, and DBP, and no interaction effect was found between groups and time (all P>0.05). Conclusion Sitagliptin combined with metformin is more effective than insulin aspart combined with metformin in controlling blood glucose among patients with T2DM.

Objective To investigate the predictive value of preoperative combined detection of neutrophil-to-lymphocyte ratio (NLR) and prothrombin time-international normalized ratio to albumin ratio (PTAR) for early abdominal infection after liver transplantation. Methods Clinical data of 287 recipients who underwent liver transplantation at the Liver Transplant Center of Beijing Friendship Hospital, Affiliated to Capital Medical University, from January 2020 to April 2024 were retrospectively analyzed. The patients were divided into infection group (n=60) and non-infection group (n=227) based on whether abdominal infection occurred within 30 days after surgery. The distribution characteristics of pathogens and infection time in infected patients were analyzed. Spearman correlation analysis was used to assess the correlation between NLR, PTAR, Child-Pugh score and preoperative model for end-stage liver disease (MELD) score. Univariate and multivariate logistic regression analyses were performed to identify risk factors for abdominal infection. Receiver operating characteristic (ROC) curves were plotted for NLR, PTAR, and the combined prediction model to evaluate their predictive efficacy for abdominal infection after liver transplantation. Based on the cutoff value of the combined model, recipients were divided into low-risk and high-risk groups, and Kaplan-Meier analysis was used to compare the cumulative incidence of abdominal infection within 30 days after surgery between the two groups. Results Among the 287 recipients who underwent liver transplantation, 60 developed bacterial or fungal abdominal infections postoperatively. A total of 86 strains were isolated from infected patients, with Gram-negative bacteria accounting for 58%, Gram-positive bacteria for 36%, and fungi for 5%. Preoperative NLR and PTAR were positively correlated with Child-Pugh and MELD scores (all 1 > r > 0, P < 0.05). Logistic regression analysis showed that preoperative NLR, preoperative PTAR, postoperative ICU stay duration and postoperative biliary leakage were risk factors for abdominal infection within 30 days after surgery. The area under the curve (AUC) for NLR, PTAR, Child-Pugh score and MELD score were 0.771, 0.735, 0.650 and 0.741, respectively. The AUC for the combined NLR and PTAR prediction model was 0.824 (95% confidence interval: 0.763-0.885, P < 0.001), with a cutoff value of 0.168. Kaplan-Meier analysis showed that the cumulative incidence of abdominal infection within 30 days after surgery was lower in the low-risk group than in the high-risk group, with statistically significant difference (P < 0.001). Conclusions Preoperative NLR and PTAR are independent risk factors for abdominal infection within 30 days after liver transplantation. The combined prediction model of NLR and PTAR may effectively identify high-risk recipients for early abdominal infection after liver transplantation, providing basis for early intervention.

OBJECTIVE To explore the effects of 5，10-methylenetetetrahydrofolate reductase （MTHFR） gene polymorphism on the adverse reactions in patients with osteosarcoma after the first high-dose methotrexate （HD-MTX） treatment. METHODS A prospective study was conducted to include 53 patients with osteosarcoma treated with HD-MTX at the first admission in General Hospital of Eastern Theater Command. The dose of MTX was evaluated according to the polymorphism of rs1801133 in the METHFR gene and demographic factors， then whole pharmaceutical monitoring was conducted. The data on liver toxicity， renal toxicity， hematological toxicity， and gastrointestinal reaction were collected after the first chemotherapy cycle. Single factor analysis and binary Logistic regression analysis were used to analyze the correlation between MTX dose， 24 h blood drug concentration， and rs1801133 locus genotype with four adverse reactions. RESULTS The MTX dosage in patients with CC wild type was significantly higher than that in TT mutant type （7.97 g/m2 vs. 6.98 g/m2， P＝0.030）， but this difference did not affect the 0 h and 24 h blood drug concentrations of MTX. The above four adverse reactions were not related to the dose of MTX. The results of binary Logistic regression analysis showed that carrying one T allele increased the risk of developing hematological toxicity by 4.13 times（95% confidence interval：1.35-12.62，P＝0.013）. When 24 h plasma concentration threshold of MTX was set to 2.65 µmol/L， the sensitivity and specificity of predicting liver function damage were 53.33% and 86.96%， respectively； when the threshold was set to 7.28 μmol/L， the sensitivity and specificity of predicting renal damage were 100% and 81.63%. CONCLUSIONS The polymorphism of the rs1801133 in the MTHFR gene is associated with hematological toxicity of MTX. Patients who take HD-MTX for the first time and carry the T allele have a high risk of hematological toxicity. The 24 h plasma concentration of MTX is related to liver toxicity and renal toxicity. In addition， monitoring the 24 h blood drug concentration can predict liver and renal toxicity， and take early intervention.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.