ObjectiveTo investigate the feasibility and safety of endoscopic retrograde cholangiopancreatography （ERCP） combined with oral cholangiopancreatography in the treatment of major duodenal papilla gallbladder polyps. MethodsA retrospective analysis was performed for the clinical data of eight patients with choledocholithiasis and gallbladder polyps who underwent ERCP and combined with oral cholangiopancreatography for major duodenal papilla cholecystectomy in Center of Digestive Endoscopy， Jilin People’s Hospital， from May 2022 to June 2024， and related data were collected， including the success rate of surgery， the technical success rate of gallbladder polyp removal， the superselective method of cystic duct， the time of operation， the time of gallbladder polyp removal， and surgical complications. ResultsBoth the success rate of surgery and the technical success rate of gallbladder polyp removal reached 100%， and of all eight patients， three patients used guide wire to enter the gallbladder under direct view， while five patients received oral cholangiopancreatography to directly enter the gallbladder. The time of operation was 51.88±12.34 minutes， and the time of gallbladder polyp removal was 23.13±10.94 minutes. The diameter of gallbladder polyp was 2‍ ‍—‍ ‍8 mm， and pathological examination showed inflammatory polyps in three patients， adenomatous polyps in one patient， and cholesterol polyps in four patients. There were no complications during or after surgery. The patients were followed up for 2‍ ‍—‍ ‍27 months after surgery， and no recurrence of gallbladder polyp was observed. ConclusionOral cholangiopancreatography is technically safe and feasible in endoscopic major duodenal papilla cholecystectomy.

ObjectiveTo evaluate pharmacological effects of Shengmai injection（SMI）on cerebral ischemia and study its neuroprotective mechanism. MethodsMale specific pathogen-free （SPF） Sprague-Dawley （SD） rats were randomly divided into a sham group， a model group， a low-dose SMI group（3 mL·kg^-1）， a middle-dose SMI group（6 mL·kg^-1）， a high-dose SMI group（12 mL·kg^-1）， and a Ginaton group（4 mL·kg^-1）according to the random number table method， with 12 rats in each group. The rat model of cerebral ischemia-reperfusion（MCAO/R）was prepared via the suture method. The administration groups were intraperitoneally injected with corresponding concentrations of SMI or Ginaton injection after reperfusion， which was conducted for 3 consecutive days. The sham group and model group were administered the equivalent volume of physiological saline. The pharmacological effects of SMI on brain injury in MCAO/R rats were evaluated by neurological function scores， cerebral infarction area， hematoxylin-eosin （HE） staining， Nissl staining， terminal deoxynucleotidyl transferase dUTP nick-end labeling （TUNEL） staining， and Western blot. The dominant link and key protein of SMI treating cerebral injury were explored using proteomic analysis. The related mechanisms of SMI were further validated using enzyme-linked immunosorbent assay （ELISA）， Western blot， and chloride ion fluorescence probe with oxygen-glucose deprivation/reoxygenation（OGD/R）-treated PC12 cells and MCAO/R rats. ResultsCompared with the sham group， the model group showed significantly increased neurological function scores， cerebral infarction area， neuronal apoptosis rate， and expression levels of apoptosis related proteins （P<0.05， P<0.01）and significantly decreased density of Nissl bodies and neurons（P<0.01）. Compared with the model group， the SMI groups exhibited significantly decreased neurological function scores， cerebral infarction area， neuronal apoptosis rate， and expression levels of apoptosis related proteins （P<0.05， P<0.01）and significantly increased density of Nissl bodies and neurons （P<0.05）. The proteomic analysis results showed that oxidative stress and inflammatory response were important processes of SMI intervening in MCAO/R injury， and the chloride intracellular channel protein 1 （CLIC1） was one of key proteins in its action network. The levels of representative indicators of oxidative stress and inflammatory response in the MCAO/R rats of the SMI groups were significantly reduced， compared with those in the model group（P<0.05， P<0.01）， and the expression levels of CLIC1 and downstream NOD-like receptor protein 3 （NLRP3） decreased （P<0.01）. In addition， the experimental results based on the OGD/R PC12 cells showed that SMI significantly increased the cell survival rate（P<0.01） and significantly decreased the intracellular chloride ion concentration（P<0.05）. ConclusionSMI has neuroprotective effects. Oxidative stress and inflammatory response are key processes of SMI intervening in MCAO/R injury. The potential mechanism is closely related to the regulation of CLIC1.

AIM: To compare the application of two distinct suspension suture fixation techniques in intraocular lens implantation.METHODS: Retrospective study. A total of 60 patients(60 eyes)who underwent intraocular lens suspension surgery at ophthalmology department of our hospital between January 1, 2021, and December 1, 2023 were included. Patients were divided into two groups based on the suturing techniques: the control group(n=30)received sub-scleral flap suture fixation, while the intervention group(n=30)underwent Z-shaped suture fixation. A 6 mo postoperative follow-up was conducted to assess surgical duration, visual acuity and quality, ocular structure, clinical efficacy, postoperative expose rate of sutures, diopters and decentration of intraocular lens.RESULTS:The mean operative time was significantly longer in the intervention group(50.5±3.1 min)compared to the control group(40.9±2.8 min; P<0.01). At 6 mo postoperatively, both groups demonstrated significant improvements in uncorrected and best-corrected visual acuity compared to preoperative values(both P<0.01), and there were no statistically significant differences in the uncorrected and best corrected visual acuity between the two groups(all P>0.05); at 6 mo postoperatively, the visual quality of the intervention group was better than that of the control group(P<0.05). While both groups exhibited a significant reduction in corneal endothelial cell count postoperatively(both P<0.01), there was no significant difference between the groups(P>0.05). The overall efficacy rate and suture exposure rate were comparable between the groups at 6 mo postoperatively(P=0.542 and P>0.05, respectively). However, significant differences were observed in postoperative diopters and intraocular lens decentration between the two groups(both P<0.01).CONCLUSION:Although both suture fixation techniques yielded satisfactory clinical outcomes in intraocular lens implantation, the Z-shaped suture fixation demonstrated superior performance in terms of visual quality and preservation of ocular structural integrity.

ObjectiveTo investigate the expression of C1q tumor necrosis factor-related protein 3 （C1QTNF3） in liver cancer tissue， its association with the clinicopathological features of patients， and its potential value in predicting the prognosis of liver cancer. MethodsRelated data were collected from TIMER， UALCAN， TNMplot， and GEO databases， and the bioinformatics methods were used to measure the expression level of C1QTNF3 in pan-cancer， normal tissue/liver cancer tissue， and cancerous tissue/paracancerous tissue. Cancerous and paracancerous tissue samples were collected from 90 patients with liver cancer， and related clinical data were collected， including age， sex， tumor diameter， and tumor number. The independent-samples t test or the paired t-test was used for comparison of continuous data between groups， and the chi-square test was used for comparison of categorical data between groups. The Kaplan-Meier method was used to plot survival curves， and the Log-rank test was used to investigate the association between the expression level of C1QTNF3 and the survival of patients with liver cancer. The Cox regression model was used to identify the risk factors for the prognosis of patients with liver cancer， and the receiver operating characteristic （ROC） curve was used to analyze the ability of C1QTNF3 expression at different time points for predicting the prognosis of patients with liver cancer. ResultsThe bioinformatics analysis showed that the expression of C1QTNF3 was upregulated in various malignant tumors， especially in liver cancer tissue （P<0.001）， and the expression level of C1QTNF3 in liver cancer tissue was significantly higher than that in normal tissue and paracancerous tissues （all P<0.01）. The immunohistochemical staining results of 90 patients with liver cancer showed that C1QTNF3 was mainly expressed in cytoplasm， with a small amount in nucleus， and it had negative expression in paracancerous tissue and positive expression in liver cancer tissue. The positive expression rate and strong positive expression rate of C1QTNF3 protein in liver cancer tissue were significantly higher than those in paracancerous tissue （positive expression rate： 76.67% vs 33.33%， χ²=34.141， P<0.01； strong positive expression rate： 54.44% vs 5.56%， χ²=51.217， P<0.01）. The liver cancer patients with a tumor diameter of ≥5 cm， an advanced stage， the presence of liver cirrhosis， negative HBsAg， and gamma-glutamyl transpeptidase （GGT）≥50 U/L had a significantly higher strong positive expression rate of C1QTNF3 protein than those with a tumor diameter of <5 cm， an early stage， the absence of liver cirrhosis， positive HBsAg， and GGT<50 U/L （all P<0.05）. The univariate Cox regression analysis showed that tumor diameter， recurrence， and C1QTNF3 expression were influencing factors for the prognosis of patients with liver cancer （all P<0.05）， and the multivariate Cox regression analysis showed that the expression level of C1QTNF3 and recurrence were independent risk factors for the survival of patients with liver cancer （both P<0.05）. The survival curve analysis showed that for all patients with liver cancer， the patients with high （strong positive） expression of C1QTNF3 had significantly lower overall survival rate and disease-free survival rate than those with low expression （χ²=17.010 and 13.647， both P<0.001）； for liver cancer patients with a tumor diameter of ≥5 cm， an early/advanced stage， recurrence， the presence of liver cirrhosis， positive HBsAg， alanine aminotransferase （ALT） <40 U/L， ALT≥40 U/L， and GGT≥50 U/L， the patients with high expression of C1QTNF3 had a significant reduction in overall survival rate （χ²=11.086， 5.578， 5.295， 19.159， 16.391， 13.774， 10.119， 8.152， and 12.035， all P<0.05）. The ROC curve analysis showed that C1QTNF3 expression had the strongest predictive potential at 5 years， with an area under the ROC curve of 0.77. ConclusionC1QTNF3 is highly expressed in liver cancer tissue， and the expression level of C1QTNF3 and recurrence are closely associated with the survival of patients with liver cancer. Patients with high expression of C1QTNF3 protein tend to have a lower survival rate.

Objective To evaluate the therapeutic efficacy for surgical treatments among patients with hepatic cystic echinococcosis in Gansu Province from 2006 to 2023, so as to provide insights into optimization of the diagnosis and treatment strategies against hepatic cystic echinococcosis. Methods The demographic and clinical data of all echinococcosis cases included in central government fiscal transfer payment program for echinococcosis control and undergoing surgical treatments in Gansu Province from 2006 to 2023 were captured. Hepatic cystic echinococcosis patients with complete medical records and follow-up data were included in the study, and patients’ characteristics, including hospital where patients received diagnosis and treatment, methods of case identification, year of surgery, classification of lesions, number of lesions, size of lesions, course of disease, surgical methods, and post-surgical follow-up data. The cure and recurrence of hepatic cystic echinococcosis were evaluated according to the Guidelines for Management of Echinococcosis Patients in the Central Government Fiscal Transfer Payment Program, and the cure and recurrent rates were calculated. Results Data were collected from 1 686 surgical patients with hepatic cystic echinococcosis. According to the inclusion and exclusion criteria, 1 222 hepatic cystic echinococcosis patients undergoing surgical treatments were included during the period from 2006 to 2022, including 1 166 cured patients (95.42%) and 88 patients with postsurgical recurrence (7.20%), and the cure rate of surgical treatments appeared a tendency towards a rise among patients with hepatic cystic echinococcosis from 2008 to 2022 (χ²_trend = 19.39, P < 0.05). The cure rates of hepatic cystic echinococcosis were 100% (177/177), 94.81% (128/135) and 94.62% (861/910) among patients detected through regular physical examinations, screened by the central government fiscal transfer payment program for echinococcosis control, and those who passively sought healthcare services, respectively (χ² = 9.95, P < 0.05). The cure rates of hepatic cystic echinococcosis were 95.96% (1 046/1 090) among patients with a disease course of 2 years and less and 90.90% (120/132) among patients with a disease course of over 2 years (χ² = 6.87, P < 0.05), and there were significant differences in the cure rates among patients with hepatic cystic echinococcosis in terms of number of lesions (χ² = 24.44, P < 0.05) and surgical methods (P < 0.05). The cure rate of hepatic cystic echinococcosis patients was significantly higher following initiation of the central government fiscal transfer payment program for echinococcosis control (96.06%, 1 096/1 141) than before the program (86.42%, 70/81) (χ² = 16.06, P < 0.05), and the cure rate of hepatic cystic echinococcosis patients was significantly higher in designated hospitals (96.48%, 741/768) than in non-designated hospitals (93.37%, 366/392) (χ² = 5.78, P < 0.05). The median follow-up period was 4 (interquartile range, 7) years among 1 222 hepatic cystic echinococcosis patients undergoing surgical treatments. The recurrent rate of hepatic cystic echinococcosis appeared a tendency towards a decline from 2008 to 2022 (χ²_trend = 36.86, P < 0.05), with a reduction from 23.08% (9/39) in 2008 to 1.85% (1/54) in 2021, and the post-surgical recurrence rate of hepatic cystic echinococcosis was lower following initiation of the central government fiscal transfer payment program for echinococcosis control (5.87%, 67 / 1 141) than before the program (25.93%, 21/81) (χ² = 45.51, P < 0.05). In addition, the post-surgical recurrence rate of hepatic cystic echinococcosis was higher in non-designated hospitals (10.46%, 41/392) than in designated hospitals (5.60%, 43/768) (χ² = 9.12, P < 0.05), and there was a significant difference in the post-surgical recurrence rate among patients with hepatic cystic echinococcosis in terms of surgical methods (P < 0.05), with the highest recurrence rate (11.54%) seen among patients undergoing percutaneous fine-needle aspiration of cyst fluids-based surgical procedures (P < 0.05). Conclusion Since the initiation of the central government fiscal transfer payment program for echinococcosis control in Gansu Province in 2006, an increase in the surgical cure rate and a reduction in the recurrence of hepatic cystic echinococcosis had been found among patients with hepatic cystic echinococcosis, indicating a high overall therapeutic efficacy.

OBJECTIVE To evaluate the efficacy and safety of guideline-directed medical therapy （GDMT） combined with vericiguat in treating heart failure with reduced ejection fraction （HFrEF）. METHODS A retrospective study was conducted on 346 patients with HFrEF who received standardized diagnosis and treatment at the First People’s Hospital of Changzhou from January 2023 to May 2024. They were divided into standard treatment group （n＝215） and vericiguat group （n＝131）. Patients in the standard treatment group received GDMT， while patients in the vericiguat group received GDMT combined with vericiguat. Propensity score matching （PSM） was used to balance confounding factors between two groups， and the effectiveness （including outcome and prognostic indicators） and safety （occurrence of adverse events） of both groups were evaluated. Kaplan-Meier survival curves for primary and secondary outcome events were drawn， and the influential factors of primary outcome events were screened through univariate and multivariate Cox regression analysis. RESULTS After PSM， there were 100 patients in the standard treatment group and 100 patients in the vericiguat group， and there was no statistically significant differences in baseline data between two groups （P＞0.05）. During a 1-year follow-up， there were statistically significant differences in the cumulative incidence of major outcome events between the standard treatment group and the vericiguat group， cumulative incidence of hospitalization events due to heart failure， changes in N-terminal pro-B-type natriuretic peptide levels before and after treatment between the standard treatment group and the vericiguat group （P＜0.05）. There was no statistically significant difference in the incidence of adverse events between the two groups （P＞0.05）. Multivariate Cox regression analysis results showed that left ventricular ejection fraction ≤35% was a risk factor for the occurrence of major outcome events within 1 year [hazard ratio （HR）＝ 2.090， 95% confidence interval （CI）： 1.175-3.718， P＝0.012]， while the use of vericiguat was a protective factor for the occurrence of major outcome events within 1 year （HR＝0.505， 95%CI： 0.284-0.899， P＝0.020）. CONCLUSIONS Compared with GDMT， GDMT combined with vericiguat can improve the clinical symptoms and prognosis of HFrEF patients， and has good safety.

ObjectiveThis paper aims to verify the therapeutic effect of Cranial Painkiller pills' extract powder prepared by the new process on the rat's trigeminal neuralgia model caused by infraorbital injection of Talci Pulvis， evaluate its potential clinical application value， and compare the therapeutic effect with that of Cranial Painkiller granules， so as to provide data support for the application of the Cranial Painkiller pills' extract powder and precise treatment. MethodsThe rat's trigeminal neuralgia model was constructed by infraorbital injection of Talci Pulvis， and the rats were randomly divided into the normal group， model group， carbamazepine group （60 mg·kg^-1）， Cranial Painkiller granules group （2.70 g·kg^-1）， and low， medium， and high dosage groups of Cranial Painkiller pills' extract powder （1.35， 2.70， 5.40 g·kg^-1） according to the basal mechanical pain thresholds， and there were 10 rats in each group. The drug was administered by gavage to each group 2 h after modeling， and distilled water was given by gavage to the normal and model groups under the same conditions once a day for 10 d. Von Frey brushes were used to measure mechanical pain thresholds in rats. Hematoxylin-eosin （HE） staining was used to detect pathological changes in the trigeminal ganglion， and enzyme-linked immunosorbent assay （ELISA） was used to detect the inflammatory factors interleukin-1 （IL-1）， interleukin-6 （IL-6）， interleukin-8 （IL-8）， and tumor necrosis factor-α （TNF-α） levels in rat serum， as well as neuropeptide substance P （SP） and β-endorphin （β-EP） levels in rat brain tissue. Western blot technique was used to detect the levels of NLRP3， ASC， Caspase-1， and OTULIN proteins in rat brain tissue. ResultsCompared with the normal group， the pain threshold of rats in the model group showed a continuous significant decrease （P<0.01）. The pathological damage of brain tissue was significant （P<0.01）， and the inflammatory levels of IL-1， IL-6， IL-8， and TNF-α in serum were significantly elevated （P<0.01）. The level of the SP in the brain tissue was significantly elevated （P<0.01）， and the level of β-EP was significantly reduced （P<0.01）， while the level of OTULIN was significantly reduced， and NLRP3， ASC， and Caspase-1 protein levels were significantly elevated （P<0.01）. After administration of the drug， compared with the model group， the pain threshold of each dose group of the Cranial Painkiller pills' extract powder and the Cranial Painkiller granules group significantly increased （P<0.01）. The inflammatory levels of IL-1， IL-6， IL-8， and TNF-α and SP levels significantly decreased （P<0.01）， and the β-EP levels were significantly elevated （P<0.01）， while the levels of OTULIN protein were significantly elevated （P<0.05， P<0.01）， and the levels of NLRP3， ASC proteins were decreased （P<0.01）in high dose Cranial Painkiller pills' extract powder. Meanwhile， compared with those in the model group， the trigeminal ganglion lesions of rats in the Cranial Painkiller pills' extract powder and Cranial Painkiller granules groups showed different degrees of improvement （P<0.05， P<0.01）. ConclusionThe Cranial Painkiller pills' extract powder has significant therapeutic effects on the rat model of trigeminal neuralgia induced by infraorbital injection of Talci Pulvis， and its mechanism is related to the improvement of OTULIN-regulated neuroinflammation.

ObjectiveThis paper aims to verify the therapeutic effect of Cranial Painkiller pills' extract powder prepared by the new process on the rat's trigeminal neuralgia model caused by infraorbital injection of Talci Pulvis， evaluate its potential clinical application value， and compare the therapeutic effect with that of Cranial Painkiller granules， so as to provide data support for the application of the Cranial Painkiller pills' extract powder and precise treatment. MethodsThe rat's trigeminal neuralgia model was constructed by infraorbital injection of Talci Pulvis， and the rats were randomly divided into the normal group， model group， carbamazepine group （60 mg·kg^-1）， Cranial Painkiller granules group （2.70 g·kg^-1）， and low， medium， and high dosage groups of Cranial Painkiller pills' extract powder （1.35， 2.70， 5.40 g·kg^-1） according to the basal mechanical pain thresholds， and there were 10 rats in each group. The drug was administered by gavage to each group 2 h after modeling， and distilled water was given by gavage to the normal and model groups under the same conditions once a day for 10 d. Von Frey brushes were used to measure mechanical pain thresholds in rats. Hematoxylin-eosin （HE） staining was used to detect pathological changes in the trigeminal ganglion， and enzyme-linked immunosorbent assay （ELISA） was used to detect the inflammatory factors interleukin-1 （IL-1）， interleukin-6 （IL-6）， interleukin-8 （IL-8）， and tumor necrosis factor-α （TNF-α） levels in rat serum， as well as neuropeptide substance P （SP） and β-endorphin （β-EP） levels in rat brain tissue. Western blot technique was used to detect the levels of NLRP3， ASC， Caspase-1， and OTULIN proteins in rat brain tissue. ResultsCompared with the normal group， the pain threshold of rats in the model group showed a continuous significant decrease （P<0.01）. The pathological damage of brain tissue was significant （P<0.01）， and the inflammatory levels of IL-1， IL-6， IL-8， and TNF-α in serum were significantly elevated （P<0.01）. The level of the SP in the brain tissue was significantly elevated （P<0.01）， and the level of β-EP was significantly reduced （P<0.01）， while the level of OTULIN was significantly reduced， and NLRP3， ASC， and Caspase-1 protein levels were significantly elevated （P<0.01）. After administration of the drug， compared with the model group， the pain threshold of each dose group of the Cranial Painkiller pills' extract powder and the Cranial Painkiller granules group significantly increased （P<0.01）. The inflammatory levels of IL-1， IL-6， IL-8， and TNF-α and SP levels significantly decreased （P<0.01）， and the β-EP levels were significantly elevated （P<0.01）， while the levels of OTULIN protein were significantly elevated （P<0.05， P<0.01）， and the levels of NLRP3， ASC proteins were decreased （P<0.01）in high dose Cranial Painkiller pills' extract powder. Meanwhile， compared with those in the model group， the trigeminal ganglion lesions of rats in the Cranial Painkiller pills' extract powder and Cranial Painkiller granules groups showed different degrees of improvement （P<0.05， P<0.01）. ConclusionThe Cranial Painkiller pills' extract powder has significant therapeutic effects on the rat model of trigeminal neuralgia induced by infraorbital injection of Talci Pulvis， and its mechanism is related to the improvement of OTULIN-regulated neuroinflammation.

ObjectiveTo investigate the safety and efficacy of endoscopic retrograde cholangiopancreatography （ERCP） combined with electrohydraulic lithotripsy under the direct view of eyeMax biliary-pancreatic imaging system in the treatment of difficult choledocholithiasis. MethodsA retrospective analysis was performed for the clinical data of 12 patients with difficult choledocholithiasis who underwent ERCP and electrohydraulic lithotripsy under the direct view of eyeMax biliary-pancreatic imaging system in Department of Gastroenterology， Jilin People’s Hospital， from May to November 2022. The clinical effect of lithotripsy and lithotomy was observed， and postoperative complications and time of surgical operation were assessed. ResultsAmong the 12 patients， 11 （91.67%） were successfully treated by electrohydraulic lithotripsy under direct view， 9 （75.00%） achieved first-attempt success in lithotripsy， and 11 （91.67%） had complete removal of calculi； 1 patient was found to have stenosis of the bile ducts caused by multiple biliary tract surgeries， and grade Ⅱ intrahepatic bile duct stones above the sites of stenosis were removed under direct view， but there were still residues of grade Ⅲ intrahepatic bile duct stones， which led to the fact that complete calculus removal was not achieved. The mean time of ERCP operation was 91.3±26.2 minutes， including a time of 41.8±22.2 minutes for energy lithotripsy. There were 2 cases of postoperative biliary tract infection which were improved after anti-infective therapy， 2 cases of hyperamylasemia which were not given special treatment， and 3 cases of mild pancreatitis which were improved after symptomatic medication， and there were no complications such as bleeding and perforation. ConclusionERCP combined with electrohydraulic lithotripsy under the direct view of eyeMax biliary-pancreatic imaging system is safe， effective， and feasible in the treatment of difficult choledocholithiasis.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.