Approximately 60% of colorectal cancer (CRC) patients exhibit TP53 mutations, which are strongly associated with tumor progression, chemotherapy resistance, and an unfavorable prognosis. However, targeting p53 has historically been challenging, and currently, there are no approved p53-based therapeutics for clinical use worldwide. In this study, we discovered that ubiquitin carboxyl terminal hydrolase L3 (UCHL3) plays a crucial role in high-level glycolysis, enhanced stem-like properties, and 5-fluorouracil (5-FU) chemoresistance in TP53-mutant CRC by exerting its deubiquitinating enzyme activity to stabilize α-enolase (ENO1) protein. Notably, we identified a newly Food and Drug Administration (FDA)-approved drug, pacritinib, that potently suppresses UCHL3 expression by blocking the janus kinase 2 (JAK2)-signal transducer and activator of transcription 3 (STAT3) pathway in TP53-mutant CRC. Furthermore, Pacritinib was demonstrated to effectively inhibit glycolysis and improve the sensitivity to 5-FU chemotherapy in TP53-mutant CRC. Our findings suggest that targeting the JAK2-STAT3-UCHL3-ENO1 axis is a promising strategy to suppress glycolysis and enhance the efficacy of 5-FU chemotherapy in TP53-mutant CRC. Pacritinib shows potential for clinical application in the treatment of TP53-mutant CRC.

Objective:To investigate the prevalence of diabetes in the elderly aged ≥60 years in Liaoning Province from 2017 to 2019 and analyze the impact of blood glucose control on all-cause mortality and cardiovascular disease (CVD) mortality.Methods:A survey was conducted in the elderly aged ≥60 years in Liaoning from 2017 to 2019 to collect the information about the prevalence of diabetes and other chronic diseases in the diabetes patients. The mortality of the enrolled subjects was investigated in September 2023. Cox proportional hazards regression models were used to estimate the association between blood glucose control in the elderly with diabetes and the risks of all-cause mortality and CVD mortality.Results:The crude prevalence of diabetes in the elderly aged ≥60 years was 20.2% (2 014/9 958) in Liaoning from 2017 to 2019, and the standardized prevalence rate was 19.9%. The prevalence rates of hypertension, dyslipidemia, and overweight/obesity in the diabetes patients were 77.0%, 51.7%, and 67.5% respectively. The median follow-up time was 5.5 years, and the all-cause mortality and CVD mortality rates in the diabetes patients were 244.3/10 000 person-years and 142.9/10 000 person-years, respectively. The results of the Cox proportional hazards regression model analysis showed that compared with non-diabetic individuals, diabetes patients had an increased risk of all-cause mortality by 1.68 times [hazard ratio ( HR)=1.68, 95% CI: 1.44-1.94] and an increased risk of CVD mortality by 1.56 times ( HR=1.56, 95% CI: 1.29-1.89). The differences in risks of all-cause mortality and CVD mortality between the diabetes patients with normal fasting blood glucose and glycated hemoglobin levels and people without diabetes were not significant (all P>0.05). The failure to meet either the FPG or HbA1c target increased the risk of all-cause mortality (all P<0.05). For individuals who failed to meet the HbA1c target, there was an increased risk of CVD mortality (all P<0.05). Conclusions:The comorbidity rate of chronic diseases was higher in the elderly with diabetes than in the elderly without diabetes in Liaoning. Elderly diabetes patients can benefit from good blood glucose control.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.

This paper analyzes the literature on virtual reality(VR)technology interventions for autistic children published from 2014 to 2022.It shows that different VR systems in these studies have improved different symptoms of autism,and points out the feasibility of VR technology interventions for autistic children.

Objective To construct and apply a multidrug-resistant bacteria information management system,and evaluate its effectiveness and accuracy in the management of patients with multidrug-resistant bacteria infection.Methods A system construction team was established to develop a multidrug-resistant bacteria information management system,which includes 4 modules:early warning,execution,monitoring,and statistical decision-making.Patients with positive detection of multidrug-resistant bacteria admitted to a tertiary A obstetrics and gynecology hospital in Zhejiang Province from January to December 2022,members of the system construction team,and clinical medical staff were selected as the research subjects.The execution efficiency of multidrug-resistant bacteria management,as well as the system's accuracy,usability,and satisfaction were compared before(January to June 2022)and after(July to December 2022)the application of the system.Results After the implementation of the system,the immediate feedback rate of multidrug-resistant bacteria early warning information increased from 62.87％to 89.78％;the rate of issuing isolation medical orders rose from 61.07％to 93.33％;the accuracy of the implementation of isolation measures for patients increased from 66.67％to 98.01％;all differences are statistically significant(P＜0.001).The accuracy rate of the system in making decisions is 88.44％;the usability score given by medical staff for the system is 44.04 points,and the satisfaction score of the system construction team members and medical staff to the system is 121.25 points,both at a high level.Conclusion The multidrug-resistant information management system is equipped with features such as immediate alerts,multi-channel notifications,infection control department supervision,and auxiliary decision-making,which can provide medical staff with accurate decision reports.Preliminary application results show that the system has a high level of accuracy and good usability.

The long-term presence of non-steroidal anti-inflammatory drugs (NSAIDs) in the environmental water samples not only affects the life safety of aquatic organisms and disturbs the ecoenvironment, but also poses a serious threat to human health. In this study, amino-functionalized Fe3O4 nanoparticles (Fe3O4-NH2) were firstly prepared by solvothermal method. Subsequently, polyethyleneimine (PEI) with a branched chain structure was successfully grafted onto Fe3O4 nanoparticles by Schiff base reaction in aqueous solution at room temperature using glutaraldehyde as a cross-linking agent, and a recyclable PEI-grafted magnetic nano-sorbent (Fe3O4@PEI) was synthesized and applied for the detection of NSAIDs in the environmental water samples. The compositional properties of Fe3O4@PEI were investigated by different characterization methods and the parameters affecting the extraction of NSAIDs were optimized. Due to high adsorption of Fe3O4@PEI for NSAIDs, the quantitative analysis of four NSAIDs in the environmental water samples, ketoprofen, naproxen, diclofenac and tolfenamic acid, was performed in combination with high-performance liquid chromatography. A good linear relationship between the chromatographic peak area and concentration was observed in the range of 1−500 µg/mL. The recoveries of the samples at three different spiked levels ranged from 85.6% to 107.8%; the intra-day precision was less than 7.8% (n=6); and the inter-day precision was less than 9.5% (n=3). The method is simple, rapid, accurate and reliable, and can be used for the analysis of NSAIDs in the environmental water samples．

Objective:To explore the impact of treatment duration with human urinary kallidinogenase (HUK) on the efficacy and safety of acute ischemic stroke (AIS).Methods:In this subgroup analysis of RESK study, a total of 990 AIS patients recruited from 65 centers in China between August 2015 and June 2020 were included and divided into short medication group (HUK for 8 days, n=185) or long medication group (HUK for 15 days or 21 days, n=805). The proportions of patients with modified Rankin Scale (mRS) score of 0, 0-1, 0-2 at 90 days, National Institutes of Health Stroke Scale (NIHSS) score change from baseline to 22 days, the proportions of patients with Barthel index (BI)≥95 at 90 days, and the incidences of adverse events were analyzed. Comparisons between groups were conducted using chi-square test, single factor and multivariate Logistic regression analysis, etc. Results:Multivariate regression analysis showed that the proportions of patients with 90-day mRS score of 0-2 [74.1% (137/185) vs 75.0% (604/805); OR=1.047, 95% CI 0.676-1.620, P=0.838] and 22-day NIHSS score change from baseline (4.60±2.00 vs 4.26±2.80; OR=-0.390, 95% CI -1.125-0.344, P=0.297) showed no statistically significant difference between the short medication and long medication groups; the proportions of patients with 90-day mRS score of 0-1 [48.1% (89/185) vs 59.1% (476/805); OR=0.674, 95%CI 0.463-0.983, P=0.041] and 90-day BI≥95 [43.6% (79/181) vs 55.1% (442/802); OR=0.614, 95%CI 0.420-0.897, P=0.012] were significantly lower in the short medication group than in the long medication group. There was no statistically significant difference in the incidences of adverse events between these 2 groups. Conclusions:In AIS patients, consecutive 8-day dosing of HUK improved immediate (22-day NIHSS score) and long-term outcome (90-day mRS score 0-2) and was safely tolerated. When applicable, extended duration of HUK could improve long-term disability-free rate (90-day mRS score 0-1) and quality of life (90-day BI) without increasing the risk of adverse events.

Objective:To analyze the mechanism of Kaixin San in treating Alzheimer disease (AD) based on the TCM integrated pharmacology platform combined with GEO chip differential gene analysis method.Methods:By searching TCMIP and Drugbank database, the active components and related molecular targets of Kaixin San were obtained. GSE4757 chip data was obtained through GEO database, and its differential genes were obtained using R language to draw heat map and volcano map. Molecular target map of differentially expressed genes between Kaixin San and AD was constructed through Cytoscape 3.7.2. Bisogenet and CytoNCA were used to draw the target topological network, and GO enrichment analysis and KEGG enrichment analysis of Kaixin San and AD gene were carried out.Results:86 active components of Kaixin San were obtained to treat AD, and 29 differential genes shared with GEO were obtained. PPI topological network was constructed. 6 core candidate genes were screened, and were merged with KEGG pathway enriched genes to obtain important genes for disease treatment, such as CHRM1, CHRM2, ACHE, CHRM3, CASP8, PTGS2, DRD1, CACN1S, ADRB1. 375 GO entries were obtained, mainly involving biological processes such as vasoconstriction, postsynaptic membrane plasticity, neurotransmitter transmission, etc. KEGG enrichment analysis mainly involved cholinergic synaptic signal pathway, cAMP signal pathway, calcium signal pathway, nerve ligand receptor interaction signal pathway, etc.Conclusions:Kaixin San shows the features of multi-component, multi-target and multi-channel in treating AD. It can play a role in the treatment of AD by inhibiting inflammatory reaction, reducing the activity of acetylcholinesterase and regulating the concentration of calciumion.

Objective:To evaluate the status of T, B and NK lymphocytes in peripheral blood of patients with chronic hepatitis B virus(HBV) infection and low-level viremia after nucleos(t)ide analogue (NA) treatment and to provide ideas for solving low-level viremia.Methods:This retrospective study involved 344 patients with chronic HBV infection who had been treated with NAs. They were divided into two groups: low-level viremia group (LLV group) and complete virological response group (CVR group). Clinical data including basic information, biochemistry and coagulation test results, HBV DNA, peripheral blood lymphocyte counts, PD1 and CD28 expression by T lymphocytes, and perforin and granzyme B expression by NK lymphocytes were collected and compared between the two groups. Propensity matching analysis was performed to verify the accuracy of the results.Results:Among the 344 cases, 162 were in the LLV group and 182 in the CVR group. There were no significant differences in disease diagnosis, alanine aminotransferase (ALT), aspartate aminotransferase (AST) or albumin (ALB) level between the two groups ( P>0.05), but the differences in gender and age were statistically significant ( P<0.05). The differences in the counts and percentages of peripheral blood CD3 +, CD4 + and CD8 + T lymphocyte and CD4 + /CD8 + ratios between the two groups were not statistically significant ( P>0.05), but the expression of PD1 and CD28 by peripheral blood CD3 +, CD4 + and CD8 + T lymphocytes was higher in the LLV group than in the CVR group ( P<0.05). The count of peripheral blood CD19 + B lymphocytes in the LLV group was higher than that in the CVR group ( P>0.05), and the percentage of peripheral blood CD19 + B lymphocytes was also higher in the LLV group ( P<0.05). The count of peripheral blood CD16 + CD56 + NK lymphocytes and the expression of perforin in the LLV group were lower than those in the CVR group ( P>0.05). The percentage of peripheral blood CD16 + CD56 + NK lymphocytes and the expression of granzyme B in the LLV group were lower than those in the CVR group ( P<0.05). After propensity score matching, 108 cases in the LLV group and 108 cases in the CVR group showed no significant differences in basic information ( P>0.05); the percentage of CD4 + T lymphocytes and CD4 + /CD8 + ratio in peripheral blood T lymphocyte subsets were higher in the LLV group than in the CVR group, while the percentage of CD8 + lymphocytes was lower in the LLV group ( P<0.05); the expression of PD1 and CD28 by CD3 +, CD4 + and CD8 + T lymphocytes remained higher in the LLV group ( P<0.05); the differences in the counts and percentages of peripheral blood CD19 + B lymphocytes as well as CD16 + CD56 + NK lymphocytes between the two groups were not statistically significant ( P>0.05); no significant difference in the expression of perforin by CD16 + CD56 + NK lymphocytes was found between the two groups ( P>0.05), and the expression of granzyme B remained lower in the LLV group ( P<0.05). Conclusions:Abnormal number and function of T lymphocytes and decreased function of NK lymphocytes might be related to the development of LLV in patients with chronic HBV infection after treatment. Therefore, in addition to adjusting NAs, targeting of T and NK lymphocytes might also be a feasible measure for future LLV treatment.

BACKGROUND: Metastasis is the main cause of tumor-associated death and mainly responsible for treatment failure of breast cancer. Autophagy accelerates tumor metastasis. In our work, we aimed to investigate the possibility of microRNAs (miRNAs) which participate in the regulation of autophagy to inhibit tumor metastasis. METHODS: MiRNA array and comprehensive analysis were performed to identify miRNAs which participated in the regulation of autophagy to inhibit tumor metastasis. The expression levels of miR-3653 in breast cancer tissues and cells were detected by quantitative real-time polymerase chain reaction. In vivo and in vitro assays were conducted to determine the function of miR-3653. The target genes of miR-3653 were detected by a dual luciferase reporter activity assay and Western blot. The relationship between miR-3653 and epithelial-mesenchymal transition (EMT) was assessed by Western blot. Student's t -test was used to analyze the difference between any two groups, and the difference among multiple groups was analyzed with one-way analysis of variance and a Bonferroni post hoc test. RESULTS: miR-3653 was downregulated in breast cancer cells with high metastatic ability, and high expression of miR-3653 blocked autophagic flux in breast cancer cells. Clinically, low expression of miR-3653 in breast cancer tissues (0.054 ± 0.013 vs . 0.131 ± 0.028, t  = 2.475, P  = 0.014) was positively correlated with lymph node metastasis (0.015 ± 0.004 vs . 0.078 ± 0.020, t  = 2.319, P  = 0.023) and poor prognosis ( P  < 0.001). miR-3653 ameliorated the malignant phenotypes of breast cancer cells, including proliferation, migration (MDA-MB-231: 0.353 ± 0.013 vs . 1.000 ± 0.038, t  = 16.290, P  < 0.001; MDA-MB-468: 0.200 ± 0.014 vs . 1.000 ± 0.043, t  = 17.530, P  < 0.001), invasion (MDA-MB-231: 0.723 ± 0.056 vs . 1.000 ± 0.035, t  = 4.223, P  = 0.013; MDA-MB-468: 0.222 ± 0.016 vs . 1.000 ± 0.019, t  = 31.050, P  < 0.001), and colony formation (MDA-MB-231: 0.472 ± 0.022 vs . 1.000 ± 0.022, t  = 16.620, P  < 0.001; MDA-MB-468: 0.650 ± 0.040 vs . 1.000 ± 0.098, t  = 3.297, P  = 0.030). The autophagy-associated genes autophagy-related gene 12 ( ATG12 ) and activating molecule in beclin 1-regulated autophagy protein 1 ( AMBRA1 ) are target genes of miR-3653. Further studies showed that miR-3653 inhibited EMT by targeting ATG12 and AMBRA1 . CONCLUSIONS Our findings suggested that miR-3653 inhibits the autophagy process by targeting ATG12 and AMBRA1 , thereby inhibiting EMT, and provided a new idea and target for the metastasis of breast cancer.
Cell Line, Tumor ; Epithelial-Mesenchymal Transition/genetics* ; MicroRNAs/metabolism* ; Autophagy/genetics* ; Genes, Regulator ; Gene Expression Regulation, Neoplastic/genetics* ; Cell Proliferation/genetics* ; Cell Movement/genetics* ; Neoplasms/genetics*