Approximately 60% of colorectal cancer (CRC) patients exhibit TP53 mutations, which are strongly associated with tumor progression, chemotherapy resistance, and an unfavorable prognosis. However, targeting p53 has historically been challenging, and currently, there are no approved p53-based therapeutics for clinical use worldwide. In this study, we discovered that ubiquitin carboxyl terminal hydrolase L3 (UCHL3) plays a crucial role in high-level glycolysis, enhanced stem-like properties, and 5-fluorouracil (5-FU) chemoresistance in TP53-mutant CRC by exerting its deubiquitinating enzyme activity to stabilize α-enolase (ENO1) protein. Notably, we identified a newly Food and Drug Administration (FDA)-approved drug, pacritinib, that potently suppresses UCHL3 expression by blocking the janus kinase 2 (JAK2)-signal transducer and activator of transcription 3 (STAT3) pathway in TP53-mutant CRC. Furthermore, Pacritinib was demonstrated to effectively inhibit glycolysis and improve the sensitivity to 5-FU chemotherapy in TP53-mutant CRC. Our findings suggest that targeting the JAK2-STAT3-UCHL3-ENO1 axis is a promising strategy to suppress glycolysis and enhance the efficacy of 5-FU chemotherapy in TP53-mutant CRC. Pacritinib shows potential for clinical application in the treatment of TP53-mutant CRC.

Objective:To analyze the characteristics of patients with pneumoconiosis complicated with chronic obstructive pulmonary disease (COPD), and to explore the comorbidity of pneumoconiosis and COPD and its influencing factors.Methods:From October to December 2022, 255 pneumoconiosis patients admitted to an occupational disease prevention and control hospital from January 2018 to December 2021 were selected as the study subjects. According to whether the pneumoconiosis patients were complicated with COPD or not, they were divided into pneumoconiosis and COPD comorbidity group and pneumoconiosis group. The general condition and dust exposure of the two groups of patients were analyzed, and the relationship between different types and different periods of pneumoconiosis and COPD comorbidity was analyzed by multivariate logistic regression.Results:A total of 255 subjects were collected, including 64 patients with comorbidity of pneumoconiosis and COPD, and the comorbidity rate was 25.1%. There were 186 males (72.9%) and 69 females (27.1%), ranging in age from 35 to 90 (63.79±11.79) years, and working age from 1 to 45 (20.31±10.57) years. The comorbidity of pneumoconiosis and COPD increased with the increase of working age (χ 2trend=8.19, P=0.004), and the comorbidity rate for COPD with working age of more than 30 years was 37.7% (23/61). The comorbidity rate of pneumoconiosis and COPD also increased with the increase of the stage of pneumoconiosis (χ 2trend=13.14, P<0.001), and the comorbidity rate of pneumoconiosis and COPD in the stage Ⅲ was as high as 44.0% (11/25). The cumulative dust exposure was negatively correlated with forced expiratory volume in one second/forced vital capacity (FEV 1/FVC), and the linear regression equation y=-0.04 x+78.4. Multivariate logistic regression analysis showed that the length of services ≥30 years ( OR=3.30, 95% CI: 1.15-9.52) and stageⅡ ( OR=3.05, 95% CI: 1.03-9.04) were the risk factors for comorbidity between pneumoconiosis and COPD ( P<0.05) . Conclusion:The comorbidity rate of pneumoconiosis and COPD is high. Working age, pneumoconiosis stage and cumulative dust exposure are the main influencing factors of pneumoconiosis and COPD comorbidity, so more attention should be paid to the comorbidity of pneumoconiosis and COPD.

Objective:To explore influence of Treg/Th17 balance on relative risk of acute exacerbation in patients with chronic obstructive pulmonary disease(COPD).Methods:A prospective cohort study was used to select 246 patients with COPD treated in emergency department of Beidaihe Hospital from January 2021 to January 2023,who were divided into acute aggravation group(113 cases)and stable group(133 cases)according to GOLD guidelines.Clinical indicators and lung function levels of two groups were compared,and risk variables of acute exacerbation in COPD patients were analyzed by Logistic multivariate regression.Restricted cubic spline model was used to analyze correlation between Treg/Th17 level and acute exacerbation in COPD patients.A line graph model was constructed and validation based on risk factors.The model was stratified according to risk score of column graph by X-tile software,and clinical application value of model was further discussed.Results:①Th17,IL-17,IL-22,C-reactive protein change rate(ΔCRP),procalcitonin change rate(ΔPCT)and TGF-β1 levels in acute aggravation group were significantly higher than stable group,Treg and Treg/Th17 levels were lower than stable group(P<0.05);②Multivariate Logistic regression analysis found that Treg≤9.06%,Th17≥2.23%,Treg/Th17≤5.27,ΔPCT≥0.845,ΔCRP≥0.554,IL-17≥37.55 ng/L,IL-22≥14.14 ng/L,TGF-β1≥840.56 ng/L were risk factors for COPD patients with acute exacerbation(P<0.05);③Restricted cubic spline model analysis showed that Treg/Th17 level was correlated with COPD acute exacerbation(χ2=7.214,P=0.001),and there was a linear dose-response relationship(χ2=3.542,P=0.112);④A line graph prediction model was constructed based on the above eight risk factors and evaluation results showed that C-index before and after verification were 0.864 and 0.831,respectively;AUC before and after validation were 0.856 and 0.832,respectively,and correction curve before and after validation fitted well with ideal curve.Clinical decision curve showed that when threshold probability was 0.01～0.91,higher net benefit could be obtained by this model;⑤Risk stratification showed that inci-dence of acute exacerbation in high risk group was significantly higher than medium and low risk groups(χ2=6.056,P=0.013).Con-clusion:Monitoring changes in peripheral blood Treg/Th17 cell balance provides a high reference value for acute exacerbations in patients with COPD.

Objective:To explore influence of Treg/Th17 balance on relative risk of acute exacerbation in patients with chronic obstructive pulmonary disease(COPD).Methods:A prospective cohort study was used to select 246 patients with COPD treated in emergency department of Beidaihe Hospital from January 2021 to January 2023,who were divided into acute aggravation group(113 cases)and stable group(133 cases)according to GOLD guidelines.Clinical indicators and lung function levels of two groups were compared,and risk variables of acute exacerbation in COPD patients were analyzed by Logistic multivariate regression.Restricted cubic spline model was used to analyze correlation between Treg/Th17 level and acute exacerbation in COPD patients.A line graph model was constructed and validation based on risk factors.The model was stratified according to risk score of column graph by X-tile software,and clinical application value of model was further discussed.Results:①Th17,IL-17,IL-22,C-reactive protein change rate(ΔCRP),procalcitonin change rate(ΔPCT)and TGF-β1 levels in acute aggravation group were significantly higher than stable group,Treg and Treg/Th17 levels were lower than stable group(P<0.05);②Multivariate Logistic regression analysis found that Treg≤9.06%,Th17≥2.23%,Treg/Th17≤5.27,ΔPCT≥0.845,ΔCRP≥0.554,IL-17≥37.55 ng/L,IL-22≥14.14 ng/L,TGF-β1≥840.56 ng/L were risk factors for COPD patients with acute exacerbation(P<0.05);③Restricted cubic spline model analysis showed that Treg/Th17 level was correlated with COPD acute exacerbation(χ2=7.214,P=0.001),and there was a linear dose-response relationship(χ2=3.542,P=0.112);④A line graph prediction model was constructed based on the above eight risk factors and evaluation results showed that C-index before and after verification were 0.864 and 0.831,respectively;AUC before and after validation were 0.856 and 0.832,respectively,and correction curve before and after validation fitted well with ideal curve.Clinical decision curve showed that when threshold probability was 0.01～0.91,higher net benefit could be obtained by this model;⑤Risk stratification showed that inci-dence of acute exacerbation in high risk group was significantly higher than medium and low risk groups(χ2=6.056,P=0.013).Con-clusion:Monitoring changes in peripheral blood Treg/Th17 cell balance provides a high reference value for acute exacerbations in patients with COPD.

Objective:To analyze the characteristics of patients with pneumoconiosis complicated with chronic obstructive pulmonary disease (COPD), and to explore the comorbidity of pneumoconiosis and COPD and its influencing factors.Methods:From October to December 2022, 255 pneumoconiosis patients admitted to an occupational disease prevention and control hospital from January 2018 to December 2021 were selected as the study subjects. According to whether the pneumoconiosis patients were complicated with COPD or not, they were divided into pneumoconiosis and COPD comorbidity group and pneumoconiosis group. The general condition and dust exposure of the two groups of patients were analyzed, and the relationship between different types and different periods of pneumoconiosis and COPD comorbidity was analyzed by multivariate logistic regression.Results:A total of 255 subjects were collected, including 64 patients with comorbidity of pneumoconiosis and COPD, and the comorbidity rate was 25.1%. There were 186 males (72.9%) and 69 females (27.1%), ranging in age from 35 to 90 (63.79±11.79) years, and working age from 1 to 45 (20.31±10.57) years. The comorbidity of pneumoconiosis and COPD increased with the increase of working age (χ 2trend=8.19, P=0.004), and the comorbidity rate for COPD with working age of more than 30 years was 37.7% (23/61). The comorbidity rate of pneumoconiosis and COPD also increased with the increase of the stage of pneumoconiosis (χ 2trend=13.14, P<0.001), and the comorbidity rate of pneumoconiosis and COPD in the stage Ⅲ was as high as 44.0% (11/25). The cumulative dust exposure was negatively correlated with forced expiratory volume in one second/forced vital capacity (FEV 1/FVC), and the linear regression equation y=-0.04 x+78.4. Multivariate logistic regression analysis showed that the length of services ≥30 years ( OR=3.30, 95% CI: 1.15-9.52) and stageⅡ ( OR=3.05, 95% CI: 1.03-9.04) were the risk factors for comorbidity between pneumoconiosis and COPD ( P<0.05) . Conclusion:The comorbidity rate of pneumoconiosis and COPD is high. Working age, pneumoconiosis stage and cumulative dust exposure are the main influencing factors of pneumoconiosis and COPD comorbidity, so more attention should be paid to the comorbidity of pneumoconiosis and COPD.

Objective To construct and apply a multidrug-resistant bacteria information management system,and evaluate its effectiveness and accuracy in the management of patients with multidrug-resistant bacteria infection.Methods A system construction team was established to develop a multidrug-resistant bacteria information management system,which includes 4 modules:early warning,execution,monitoring,and statistical decision-making.Patients with positive detection of multidrug-resistant bacteria admitted to a tertiary A obstetrics and gynecology hospital in Zhejiang Province from January to December 2022,members of the system construction team,and clinical medical staff were selected as the research subjects.The execution efficiency of multidrug-resistant bacteria management,as well as the system's accuracy,usability,and satisfaction were compared before(January to June 2022)and after(July to December 2022)the application of the system.Results After the implementation of the system,the immediate feedback rate of multidrug-resistant bacteria early warning information increased from 62.87％to 89.78％;the rate of issuing isolation medical orders rose from 61.07％to 93.33％;the accuracy of the implementation of isolation measures for patients increased from 66.67％to 98.01％;all differences are statistically significant(P＜0.001).The accuracy rate of the system in making decisions is 88.44％;the usability score given by medical staff for the system is 44.04 points,and the satisfaction score of the system construction team members and medical staff to the system is 121.25 points,both at a high level.Conclusion The multidrug-resistant information management system is equipped with features such as immediate alerts,multi-channel notifications,infection control department supervision,and auxiliary decision-making,which can provide medical staff with accurate decision reports.Preliminary application results show that the system has a high level of accuracy and good usability.

This paper analyzes the literature on virtual reality(VR)technology interventions for autistic children published from 2014 to 2022.It shows that different VR systems in these studies have improved different symptoms of autism,and points out the feasibility of VR technology interventions for autistic children.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.

Objective:To explore the impact of treatment duration with human urinary kallidinogenase (HUK) on the efficacy and safety of acute ischemic stroke (AIS).Methods:In this subgroup analysis of RESK study, a total of 990 AIS patients recruited from 65 centers in China between August 2015 and June 2020 were included and divided into short medication group (HUK for 8 days, n=185) or long medication group (HUK for 15 days or 21 days, n=805). The proportions of patients with modified Rankin Scale (mRS) score of 0, 0-1, 0-2 at 90 days, National Institutes of Health Stroke Scale (NIHSS) score change from baseline to 22 days, the proportions of patients with Barthel index (BI)≥95 at 90 days, and the incidences of adverse events were analyzed. Comparisons between groups were conducted using chi-square test, single factor and multivariate Logistic regression analysis, etc. Results:Multivariate regression analysis showed that the proportions of patients with 90-day mRS score of 0-2 [74.1% (137/185) vs 75.0% (604/805); OR=1.047, 95% CI 0.676-1.620, P=0.838] and 22-day NIHSS score change from baseline (4.60±2.00 vs 4.26±2.80; OR=-0.390, 95% CI -1.125-0.344, P=0.297) showed no statistically significant difference between the short medication and long medication groups; the proportions of patients with 90-day mRS score of 0-1 [48.1% (89/185) vs 59.1% (476/805); OR=0.674, 95%CI 0.463-0.983, P=0.041] and 90-day BI≥95 [43.6% (79/181) vs 55.1% (442/802); OR=0.614, 95%CI 0.420-0.897, P=0.012] were significantly lower in the short medication group than in the long medication group. There was no statistically significant difference in the incidences of adverse events between these 2 groups. Conclusions:In AIS patients, consecutive 8-day dosing of HUK improved immediate (22-day NIHSS score) and long-term outcome (90-day mRS score 0-2) and was safely tolerated. When applicable, extended duration of HUK could improve long-term disability-free rate (90-day mRS score 0-1) and quality of life (90-day BI) without increasing the risk of adverse events.

The long-term presence of non-steroidal anti-inflammatory drugs (NSAIDs) in the environmental water samples not only affects the life safety of aquatic organisms and disturbs the ecoenvironment, but also poses a serious threat to human health. In this study, amino-functionalized Fe3O4 nanoparticles (Fe3O4-NH2) were firstly prepared by solvothermal method. Subsequently, polyethyleneimine (PEI) with a branched chain structure was successfully grafted onto Fe3O4 nanoparticles by Schiff base reaction in aqueous solution at room temperature using glutaraldehyde as a cross-linking agent, and a recyclable PEI-grafted magnetic nano-sorbent (Fe3O4@PEI) was synthesized and applied for the detection of NSAIDs in the environmental water samples. The compositional properties of Fe3O4@PEI were investigated by different characterization methods and the parameters affecting the extraction of NSAIDs were optimized. Due to high adsorption of Fe3O4@PEI for NSAIDs, the quantitative analysis of four NSAIDs in the environmental water samples, ketoprofen, naproxen, diclofenac and tolfenamic acid, was performed in combination with high-performance liquid chromatography. A good linear relationship between the chromatographic peak area and concentration was observed in the range of 1−500 µg/mL. The recoveries of the samples at three different spiked levels ranged from 85.6% to 107.8%; the intra-day precision was less than 7.8% (n=6); and the inter-day precision was less than 9.5% (n=3). The method is simple, rapid, accurate and reliable, and can be used for the analysis of NSAIDs in the environmental water samples．