1.Analysis of the factors influencing the status of coexistence with cancer in young and middle-aged HCC patients after receiving interventional therapy
Danni LI ; Li YANG ; Liyan QIU ; Zhengkeke TAN ; Longyan WU ; Xin CHEN
Journal of Interventional Radiology 2025;34(7):772-776
Objective To investigate the status of coexistence with cancer in young and middle-aged patients with hepatocellular carcinoma(HCC)after receiving interventional therapy,and to analyze the factors influencing the status of coexistence with cancer.Methods Using convenience sampling method,a total of 189 young and middle-aged patients with HCC,who were admitted to a certain grade Ⅲ-A hospital in the Guangxi Zhuang Autonomous Region of China from October 2023 to January 2024,were selected and used as the subjects of research.The general information questionnaire,long-term conditions questionnaire(LTCQ),stress adaptation scale(SAS),and perceived social support scale(PSSS)were used to make the relevant analysis.Results The results of LTCQ analysis showed that in the young and middle-aged HCC patients the mean LTCQ score was(66.28±5.37)points.The multivariate linear regression analysis indicated that age,per capita monthly income of family members,marital status,main caregiver,hepatitis B history,stress adaptability and perceived social support level were the main factors influencing the status of coexistence with cancer(all P<0.05),explaining 47.0%of the variations.Conclusion The status of coexistence with cancer in young and middle-aged patients with HCC after receiving interventional therapy is at a medium level.Medical workers should implement individualized interventions for patients with different clinical features,so as to improve the quality of life of patients and prevent adverse disease outcomes.
2.Bone filling mesh bag combined with Pedicle anchoring For the treatment of Stage Ⅲ reducible Kummell disease
Shuwei CHEN ; Renyuan TAN ; Yisong LEI ; Anping LIU ; Liyan YI ; Xinghuo WU
Journal of Clinical Surgery 2023;31(11):1081-1084
Objective To investigate the clinical efficacy of bone filling mesh bag combined with pedicle anchoring for the treatment of Stage Ⅲ reducible Kummell disease.Method The 35 paients with Stage Ⅲ reducible Kummell disease were treated with bone filling mesh bag combined with pedicle anchoring from January 2018 to December 2022.The operation Time,intraoperative blood lose,bone cement injection volume and surgical complications were recorded.The VAS score,ODI value,kyphosis Cobb angle and midline height of the injured vertebral were compared at preoperative,postoperative 1 day and last follow-up.Results All patients were followed up for 12-24 months[(15±3.5)months].Operation time was 35-63 min[(45±5.8)min],intraoperative blood loss was 10-35 ml[(20±5)ml],bone cement injection volume was 4.5-7.8 ml[(5.5±1.8)ml].There were 4 cases of bone cement leakage,there were 1 case of intervertebral leakage,2 cases of lateral leakage,1 case of anterior leakage and no patient with intracanal leakage.All bone cement leakage did not lead to clinical symptoms,bone cement poisoning and pulmonary embolism.No cement mass slip.All patients were followed up for 12 to 24 months[(15±3.5)months].VAS scores and Oswestry Disability Index(ODI)values were significantly lower on the first day after surgery than before surgery,with statistical significance(P<0.05).The 3-month follow-up was slightly higher than that on the first day after surgery,and the difference was not statistically significant(P>0.05).The midline height and Cobb Angle of the injured vertebra were measured by imaging.The height of the injured vertebra recovered significantly on the first day after operation,and the Cobb Angle decreased significantly,the difference was statistically significant(P<0.05).The midline height of the injured vertebrae decreased and the Cobb Angle increased slightly at 3 months after the operation,but the difference was not statistically significant(P>0.05).Conclusion In the the treatment of Stage Ⅲ reducible Kummell disease,Bone filling mesh bag combined with Pedicle anchoring have good clinical efficacy,which can significantly reduce the pain of patients,relieve clinical symptoms,improve spinal function,improve quality of life,and reduce the incidence of bone cement leakage and slippage.
3.Relationship between thyroid hormone level and obesity related indices in patients with type 2 diabetes mellitus
Xiaoyi ZHANG ; Fuman DU ; Liyan TAN ; Binhong DUAN ; Lei LI
Chinese Journal of Primary Medicine and Pharmacy 2023;30(3):411-415
Objective:To investigate the relationship between serum thyroid hormone levels in the normal range and body weight, blood glucose, blood lipids, and other obesity-related indexes in patients with type 2 diabetes mellitus.Methods:Seventy obese patients with type 2 diabetes mellitus and ninety-two patients with type 2 diabetes mellitus with normal weight who were treated in the Nangang Branch of Heilongjiang Provincial Hospital from May 2020 to May 2021 were included in this study. Thyroid-stimulating hormone level was in the normal range (0.35-4.94 mU/L) in all participants. Serum levels of free triiodothyronine, free thyroxine, thyroid-stimulating hormone, thyroid peroxidase antibody, thyroglobulin antibody, triglyceride, total cholesterol, low-density lipoprotein cholesterol, high-density lipoprotein cholesterol, fasting blood glucose, glycosylated hemoglobin, fasting C peptide, fasting insulin, systolic blood pressure, diastolic blood pressure, and serum uric acid were measured in all participants.Results:Free triiodothyronine level was positively correlated with fasting blood glucose and glycosylated hemoglobin levels ( r = 0.19, P = 0.021; r = 0.21, P = 0.017). Free thyroxine level was positively correlated with serum glycosylated hemoglobin level ( r = 0.25, P = 0.009) and negatively correlated with total cholesterol ( r = -0.17, P = 0.029). Thyroid-stimulating hormone level was positively correlated with body mass index as well as total cholesterol and low-density lipoprotein cholesterol levels ( r = 0.33, P < 0.001; r = 0.33, P < 0.001; r = 0.32, P < 0.001). Conclusion:Thyroid hormones in the normal range play an important role in the regulation of body weight, blood glucose, and blood lipids in patients with type 2 diabetes mellitus. Blood glucose level increases markedly in patients with relatively high free triiodothyronine and free thyroxine levels. The risks of obesity and dyslipidemia increase in patients with relatively high serum thyroid-stimulating hormone levels
4.Occupational hazard analysis of workers exposed to chromate in a steel plant
Liyan XU ; Xiaochuan HU ; Ruixia TAN ; Weisong YU
Chinese Journal of Industrial Hygiene and Occupational Diseases 2022;40(6):450-453
Objective:To investigate the occupational damage to workers exposed to chromate in a steel plant.Methods:In January 2021, a retrospective analysis was used to select 850 workers exposed to chromate (observation group) and 598 workers not exposed to chromate (control group) in a steel plant in Shandong Province from 2016 to 2017 as the investigation. We collected their occupational-related information, blood routine, fasting blood sugar, nasal lesions, skin lesions, chest X-rays and other inspection results, compared the differences in the abnormal detection rate of the two groups of respondents, and analyzed the occupational hazards of chromium workers.Results:Incidence of nasal damage, skin lesion, up-regulation of ALT (Alanine aminotransferase), abnormal chest radiograph, abnormal serum biochemical index, and abnormal serum glucose level were observed higher in the exposed group than those in the control group (χ 2=125.69, 12.25, 5.82, 10.37, 10.46, 20.66, P=0.000, 0.000, 0.016, 0.001, 0.001, 0.000). Among the symptoms, the incidence of erythra, nasal septum deviation, nasal mucosal congestion, nasal mucosal erosion and rhinitis were more frequent than those in the control group (χ 2=101.54, 4.07, 13.20, 32.05, P=0.000, 0.044, 0.000, 0.000). There was no significant increase in the incidence of work type, age, length of work and the area of nasal mucosa erosion in the observation group compared with the control table, and the difference was not statistically significant (χ 2=5.31、0.42、0.28, P=0.505, 0.662, 0.871) . Conclusion:Occupational hazards of long-term exposure to chromate cannot be ignored. Attention should be paid to strengthening occupational protection and health education of workers exposed to chromium, and increasing their attention.
5.Occupational hazard analysis of workers exposed to chromate in a steel plant
Liyan XU ; Xiaochuan HU ; Ruixia TAN ; Weisong YU
Chinese Journal of Industrial Hygiene and Occupational Diseases 2022;40(6):450-453
Objective:To investigate the occupational damage to workers exposed to chromate in a steel plant.Methods:In January 2021, a retrospective analysis was used to select 850 workers exposed to chromate (observation group) and 598 workers not exposed to chromate (control group) in a steel plant in Shandong Province from 2016 to 2017 as the investigation. We collected their occupational-related information, blood routine, fasting blood sugar, nasal lesions, skin lesions, chest X-rays and other inspection results, compared the differences in the abnormal detection rate of the two groups of respondents, and analyzed the occupational hazards of chromium workers.Results:Incidence of nasal damage, skin lesion, up-regulation of ALT (Alanine aminotransferase), abnormal chest radiograph, abnormal serum biochemical index, and abnormal serum glucose level were observed higher in the exposed group than those in the control group (χ 2=125.69, 12.25, 5.82, 10.37, 10.46, 20.66, P=0.000, 0.000, 0.016, 0.001, 0.001, 0.000). Among the symptoms, the incidence of erythra, nasal septum deviation, nasal mucosal congestion, nasal mucosal erosion and rhinitis were more frequent than those in the control group (χ 2=101.54, 4.07, 13.20, 32.05, P=0.000, 0.044, 0.000, 0.000). There was no significant increase in the incidence of work type, age, length of work and the area of nasal mucosa erosion in the observation group compared with the control table, and the difference was not statistically significant (χ 2=5.31、0.42、0.28, P=0.505, 0.662, 0.871) . Conclusion:Occupational hazards of long-term exposure to chromate cannot be ignored. Attention should be paid to strengthening occupational protection and health education of workers exposed to chromium, and increasing their attention.
6.Akinesia deformation sequence in a fetus suspected by prenatal ultrasound and confirmed after mid-term termination
Xinyao LUO ; Qiuyang GU ; Xinxiu LIU ; Jianhua LI ; Liyan HUANG ; Xiaohua HUANG ; Shengnan WU ; Jingping YANG ; Meihua TAN
Chinese Journal of Perinatal Medicine 2022;25(3):218-221
We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.
7.Influence of syndrome differentiation and diet on traditional Chinese medicine syndrome score of patients with liver cirrhosis and ascites based on "Gu Ben Kai Qu" theory
Li HU ; Xiaowen TANG ; Liyan LIU ; Danyang SHEN ; Yali ZHANG ; Hongyang TAN
Chinese Journal of Practical Nursing 2021;37(29):2287-2295
Objective:To explore the effect of dialectical diet on traditional Chinese medicine (TCM) syndrome score of cirrhotic ascites patients based on "Gu Ben Kai Qu" theory.Methods:From March 2019 to January 2020, 84 patients with liver cirrhosis and ascites admitted to Shuguang Hospital Affiliated to Shanghai University of TCM were randomly divided into two groups according to the different dialectical types of the subjects, 14 cases in each group. Three non-syndrome differentiation diet groups were given routine nursing care of liver cirrhosis ascites. On the basis of routine nursing, the corresponding medicinal diet was selected according to syndrome differentiation based on "Gu Ben Kai Qu" theory. Patients with spleen and kidney yang deficiency syndrome selected Shenqi lean meat decoction. Patients with Yin deficiency of liver and kidney selected Wolfberry and ophiopogon spareribs decoction. Patients with qi stagnation and blood stasis syndrome selected Danggui Sanqi spareribs decoction. The TCM syndrome score scale for liver disease and the curative effect evaluation of cirrhosis ascites were used to evaluate the effect.Results:Eighty effective cases were included. On the first day of admission, the 14th day and the second week after discharge, the TCM syndrome scores of liver disease were as follows: the group (a1b1) with the spleen and kidney yang deficiency syndrome was 46.38±8.56, 34.20±8.42, 31.40±4.22, respectively. The group (a1b2) with the liver kidney yin deficiency syndrome was 41.50±8.71, 31.35±8.63, 31.12±4.94. The group(a1b3) with the qi stagnation and blood stasis syndrome was 45.92±7.86, 35.17±7.57, 30.83±7.32, respectively. The non-syndrome differentiation diet group (a2b1) with the spleen and kidney yang deficiency syndrome was 46.29±8.38, 39.79±7.65, 36.64±6.83, respectively. The non-syndrome differentiation diet group (a2b2) with the liver and kidney yin deficiency syndrome was 40.50±8.12, 38.10±8.93, 35.38±8.24, respectively. The non-syndrome differentiation diet group (a2b3) with the qi stagnation and blood stasis syndrome was 45.62±7.99, 41.83±7.31, 38.83±7.96, respectively. The comparison of TCM syndrome scores of liver disease at three time points was statistically significant ( χ2 value was 63.998, P<0.05), and the comparison between groups was statistically significant ( χ2 value was 20.993, P<0.05). On the 14th day and the second week after discharge, there were significant differences between the groups with the syndrome differentiation diet and another three groups with non-syndrome differentiation diet ( F values were 3.244, 3.489, all P<0.05). Conclusions:Based on the theory of "strengthening the foundation and opening channels", the syndrome differentiation group can effectively reduce the TCM syndrome score of patients with cirrhosis ascites, improve the symptoms and enhance the curative effect. With the development of time, the score of TCM syndrome in patients with liver disease become lower. On the 14th day of admission, patients with Yin deficiency of liver and kidney given medicated diets had significant effect; patients with spleen kidney yang deficiency syndrome or qi stagnation and blood stasis had significant effect in 2 weeks after discharge; which can effectively improve the clinical symptoms of patients with cirrhosis ascites to worthy of clinical application.
8.Effect of ultrasound guided thoracic paravertebral nerve block on quality of recovery from general anesthesia in patients with tuberculous empyema surgery in post anesthesia recovery unit
Songhua LIU ; Yi FANG ; Liyan CAO ; Hongyi TAN ; Qiongcan LI ; Zhigang CHENG
Journal of Chinese Physician 2021;23(1):10-14
Objective:To study on the effect of ultrasound-guided thoracic paravertebral nerve (TPVB) block on quality of recovery from general anesthesia in tuberculosis patients with fiberboard exfoliation in post anesthesia recovery unit (PACU).Methods:From May 2018 to December 2019, 40 tuberculosis patients in Changsha Central Hospital with pulmonary fibreboard exfoliation and focal abscess lesions cleaning were randomly divided into two groups, with 20 patients in each group. The patients in group A received endobronchial general anesthesia and in group B received ultrasound-guided TPVB combined with endobronchial general anesthesia. Patients in the two groups were maintained under anesthesia by propofol, and the bispectral index (BIS) was maintained within the range of 40-50. The dosage of propofol and sufentanil was adjusted according to changes in BIS and hemodynamics. The mean arterial pressure (MAP), heart rate (HR) in two groups of patients were recorded at before anesthesia induction (T 0), before cutting leather (T 1), cut skin after (T 2), the end of operation (T 3), extubation time (T 4), and T 5 (time of leaving PACU). The visual analogue scale (VAS) of all patients in resting and cough state was recorded at 5, 30 min after extubation and the time of leaving PACU. The dosage of propofol and sufentanil in the operation and the additional dosage of sufentanil in PACU were recorded in both two groups. And the respiratory recovery time, consciousness recovery time, extubation time and sedation agitation scale(SAS) were observed. The adverse reactions such as nausea, vomiting, drowsiness and hypotension were observed in PACU. Results:Compared with group A, MAP and HR of patients at T 2, T 3, T 4, T 5 in group B were more stable during anesthesia, and VAS of patients in group B were lower than that in group A at each time point after extubation ( P<0.05). The dosage of sufentanil and propofol in group B were (35.92±8.12)μg and (749.56±95.30)mg respectively, which were significantly lower than those in group A [(45.74±4.42)μg and (862.83±105.34)mg, P<0.05]; the dosage of sufentanil in postoperative anesthesia recovery room of group B was (5.26±2.10)μg, significantly less than that of group A (10.35±5.86)μg ( P<0.05). The respiratory recovery time, consciousness recovery time and extubation time in group B were (12.92±5.12) min, (20.56±5.10) min and (26.87 ± 6.16) min, which were shorter than those in group A [(15.74±4.72)min, (25.83±5.34)min and (35.35±5.80)min, P<0.05]. The incidence of postoperative nausea, vomiting, lethargy and hypotension in group B were 10%, 10%, 35% and 20%, which were significantly lower than those in group A (30%, 20%, 75% and 45%, P<0.05). Conclusions:Ultrasound-guided paravertebral nerve block may significantly reduce the dosage of opioid analgesics for general anesthesia in tuberculosis patients with fiberboard exfoliation, accelerate the speed of anesthesia recovery, reduce the agitation during recovery, and improve the quality of anesthesia recovery.
9.Effects of hierarchical quantitative evaluation management in quality management of intravenous therapy
Li SHENG ; Liqin WANG ; Liyan TAN
Chinese Journal of Modern Nursing 2020;26(6):806-810
Objective:To implement hierarchical quantitative evaluation management and test its effectiveness in the quality management of intravenous therapy was in order to improve the quality of intravenous therapy and ensure the safety of patients.Methods:In this cross-sectional study, totally 3 935 patients receiving infusion in 42 infusion departments at the Eighth Medical Center of Chinese PLA General Hospital from January to December 2018 were selected. The hierarchical quantitative evaluation management method was developed and applied in the quality management of intravenous therapy. Before the introduction of the hierarchical quantitative evaluation management in early January 2018, a cross-sectional survey of the infusion patients in the hospital that met the inclusion criteria was conducted based on the observation indicators. After the implementation, at the end of December 2018, a cross-sectional survey was performed again on the infusion patients who met the inclusion criteria based on the observation indicators. The infusion route, puncture site, infusion connection, medication, catheter maintenance, application fixation, indwelling time, and infusion-relation complications were compared before and after the implementation.Results:After the implementation of hierarchical quantitative evaluation, steel needle usage, application fixation and maintenance issues, wrong selection of infusion sites (lower limbs and joints) , incidence of redness at puncture points decreased, and the use of indwelling needles increased, and there were statistically significant differences compared with those before the implementation ( P<0.01) . Conclusions:The application of hierarchical quantitative evaluation in the quality management of intravenous therapy gives full play to the role of the intravenous therapy team, effectively mobilizes the enthusiasm for self-improvement of the department, which can improve the quality of intravenous therapy and the level of intravenous therapy for nurses, and ensure patients' safety.
10.The association between the whole blood riboflavin level and the occurrence, development and prognosis of esophageal squamous cell carcinoma
Shanshan LI ; Huazhen TAN ; Yiwei XU ; Zhiyong WU ; Jianyi WU ; Xueke ZHAO ; Lidong WANG ; Lin LONG ; Enmin LI ; Liyan XU ; Jianjun ZHANG
Chinese Journal of Preventive Medicine 2019;53(11):1124-1129
Objective To investigate the association between the whole blood riboflavin level and the occurrence, development and prognosis of esophageal squamous cell carcinoma (ESCC) in China. Methods From March 2014 to September 2018, ESCC patients from three hospitals (the Affiliated Hospital of Medical College of Shantou University, Shantou Central Hospital in Southern Chaoshan area and First Affiliated Hospital of Zhengzhou University in Northern Taihang Mountain) were selected as a case group; non-esophageal patients who had a physical examination were selected as a control group. The case and control group were paired by age (±5 years) and a 1:1 ration. A total of 1 528 subjects were enrolled including 764 patients in the case group and 764 patients in the control group. About 3-5 ml venous blood samples were collected, and the erythrocyte glutathione reductase activity coefficient (GRAC) was measured to assess the whole blood riboflavin level. A multivariate conditional logistic regression model was used to analyze the association between the GRAC and the risk of ESCC. The association between the GRAC and the prognosis of ESCC was analyzed by using Cox proportional risk regression model based on 288 patients with complete survival data. They were divided into two groups, the high GRAC group (GRAC≥7.87) group and the low GRAC group (GRAC<7.87) according to the strongest correlation between the total survival time, survival outcome and GRAC (GRAC=7.87). Results Among the 1 528 patients, 958 patients were from Southern Chaoshan area, including 479 patients in the case group with an average age about (59.90±9.34) years and 479 patients in the control group with an average age about (59.55 ± 8.77) years. Other 570 patients were from Northern Taihang Mountain area, including 285 patients in the case group with an average age (58.39±5.19) years and 285 patients in the control group with an average age about (58.74± 4.57) years. The multivariate conditional logistic regression showed that the OR (95%CI ) of the GRAC and the risk of ESCC was 1.009 (0.998-1.019). The Cox proportional hazard regression model analysis showed that the HR (95%CI ) of the high GRAC group was 1.712 (1.034-2.824) compared with the low GRAC group in the 50-70 years group. Conclusion The whole blood riboflavin level might not be associated with the occurrence of ESCC. The high whole blood riboflavin level would be more beneficial to the prognosis of ESCC patients aged 50-70 years.

Result Analysis
Print
Save
E-mail