Objective To develop a nomogram-based predictive model for assessing the risk of respiratory distress syndrome(RDS)in premature infants in the high-altitude region of Dali.The predictive performance and clinical applicability of the model will be systematically evaluated to provide evidence-based guidance for the early diagnosis and clinical management of respiratory distress in premature infants.Methods A total of 680 preterm infants admitted to the Dali Maternal and Child Health Hospital between January 2020 and December 2024 were enrolled in the study and randomly divided into a training set(n=476)and a validation set(n=204)at a ratio of 7∶3.Independent predictors were identified through univariate logistic regression and multivariate stepwise regression analyses,and a nomogram model was subsequently developed using R software.The performance of the model,including its discrimination,calibration,stability,and clinical applicability,was evaluated using the receiver operating characteristic curve(ROC),Hosmer-Lemeshow goodness-of-fit test,bootstrap resampling method,and decision curve analysis(DCA).Results The final model incorporated seven independent variables:gestational age,birth weight,Apgar score,blood oxygen saturation,gestational hyperglycemia,prenatal glucocor-ticoid therapy,and maternal history of infection.The areas under the curve(AUCs)for the training and validation sets were 0.88(95%CI:0.84～0.92)and 0.83(95%CI:0.76～0.89),respectively,with all Hosmer-Lemeshow test p-values exceeding 0.05.The bootstrap-corrected AUC was 0.85(95%CI:0.81～0.89).DCA indicated that the model achieved the highest net benefit at a risk threshold range of 10%to 35%.Conclusions This model integrates multiple risk factors associated with the occurrence of RDS in plateau environments,demonstrating robust predictive performance for RDS in preterm infants residing in high-altitude areas such as Dali.It can serve as a valuable tool for risk stratification and clinical decision-making,and may also provide a reference for future multicenter prospective studies.

Objective To develop a nomogram-based predictive model for assessing the risk of respiratory distress syndrome(RDS)in premature infants in the high-altitude region of Dali.The predictive performance and clinical applicability of the model will be systematically evaluated to provide evidence-based guidance for the early diagnosis and clinical management of respiratory distress in premature infants.Methods A total of 680 preterm infants admitted to the Dali Maternal and Child Health Hospital between January 2020 and December 2024 were enrolled in the study and randomly divided into a training set(n=476)and a validation set(n=204)at a ratio of 7∶3.Independent predictors were identified through univariate logistic regression and multivariate stepwise regression analyses,and a nomogram model was subsequently developed using R software.The performance of the model,including its discrimination,calibration,stability,and clinical applicability,was evaluated using the receiver operating characteristic curve(ROC),Hosmer-Lemeshow goodness-of-fit test,bootstrap resampling method,and decision curve analysis(DCA).Results The final model incorporated seven independent variables:gestational age,birth weight,Apgar score,blood oxygen saturation,gestational hyperglycemia,prenatal glucocor-ticoid therapy,and maternal history of infection.The areas under the curve(AUCs)for the training and validation sets were 0.88(95%CI:0.84～0.92)and 0.83(95%CI:0.76～0.89),respectively,with all Hosmer-Lemeshow test p-values exceeding 0.05.The bootstrap-corrected AUC was 0.85(95%CI:0.81～0.89).DCA indicated that the model achieved the highest net benefit at a risk threshold range of 10%to 35%.Conclusions This model integrates multiple risk factors associated with the occurrence of RDS in plateau environments,demonstrating robust predictive performance for RDS in preterm infants residing in high-altitude areas such as Dali.It can serve as a valuable tool for risk stratification and clinical decision-making,and may also provide a reference for future multicenter prospective studies.

The intervention and prevention of perioperative hypothermia is not only reflected in the technical level, but also reveals the important role of humanistic care in the whole intervention work. If perioperative patients have hypothermia, it is likely to cause a series of complications such as postoperative shivering, which seriously threatens the life safety of patients. Prevention and intervention was based on a comprehensive understanding of the causes and hazards of hypothermia, especially the impact on the lives of the elderly. Effective supervision was implemented in the whole process of operation, such as dynamic monitoring of vital signs including body temperature, followed by room temperature regulation, body temperature protection and preoperative and postoperative psychological nursing. At this time, the sense of responsibility, good humanistic care of medical staff are of positive significance to effectively prevent and reduce the probability of perioperative hypothermia and accelerate the postoperative rehabilitation of patients.

【Objective】 To analyze the effects of different fortified feeding methods on nutritional metabolism and growth rate of preterm very low birth weight infants (VLBWI), in order to provide new clues for improving the prognosis of the preterm infants. 【Methods】 A total of 115 cases of premature VLBWI admitted to Department of Neonatology, The First Affiliated Hospital of Kunming Medical University from January 2019 to December 2020 were included in this study, and were divided into fortified breastfeeding group (HFM group), mixed feeding group, and premature formula feeding group (PF group) based on their feeding methods. The effects of different feeding methods on the nutritional metabolism and growth rate of premature VLBWI were analyzed. 【Results】 1) The hospitalization time of infants in the HFM group was shorter than that in PF group and mixed feeding group (t=7.185, 6.924, P<0.05). 2) The proportion of necrotizing enterocolitis (NEC) in the HFM group during hospitalization was lower than that in the PF group (P<0.05); the proportions of late onset septicemia(LOS) and extra uterine growth restriction(EUGR) in the HFM group during hospitalization were lower than those in the PF group (χ²=5.030, 4.147, P<0.05); the proportion of LOS was lower than that of the mixed feeding group(χ²=6.589, P<0.05). 3) During hospitalization, the proportions of abdominal distension, bloody stools and increased eosinophils in the HFM group were lower than those in the PF group (P<0.05), which in mixed feeding group was lower than those in PF group (Fisher exact test, P<0.05). 4) At discharge, the weight and length growth rate of the HFM group were higher than those of the mixed feeding group (t=3.722, 0.425, P<0.001) and the PF group (t =6.015, 0.496, P< 0.001). 【Conclusion】 Fortified breastfeeding can more effectively increase the growth rate of VLBWI in premature infants, improve nutritional metabolism, reduce complications and adverse feeding reactions related to premature infants, and is safer and more effective.

Objective To investigate the virulence and drug resistance characteristics of diarrheagenic Escherichia coli isolated from patients with infectious diarrhea in our hospital.Methods The preliminary identification of microbes was carried out by the VITEK-MS microbial mass spectrometry detection system and virulence genes were detected by the multiplex real-time PCR.Five types of diarrhea-genic Escherichia coli(DEC)clinically isolated from patients with infectious diarrhea in our hospital were identified.The drug resist-ance characteristics of DEC strains were detected by the microbroth dilution and E-test.The drug-resistant molecular characteristics were analyzed by the next-generation sequencing and bioinformatics.The Fisher exact probability method was used for statistical analy-sis.Results The detection rate of DEC in our hospital was 11.9%,with enteroaggregative E.coli(EAEC)accounting for 37.5%,a-typical enteropathogenic Escherichia coli(EPEC)accounting for 34.38%,enterotoxigenic E.coli(ETEC)accounting for 25.0%,and enteroinvasive E.coli(EIEC)accounting for 3.12%.None of enterohemorrhagic E.coli(EHEC)strain was detected.The resistance rates of 32 DEC strains to ampicillin,tetracycline,and trimethoprim/sulfamethoxazole were 53.12%,43.75%,and 37.5%,respec-tively.ESBLs(+)strains accounted for 18.75%,and the detection rate of multidrug-resistant strains was 83.83%,significantly higher than that of ESBLs(-)strains(P=0.042).A total of 25 ST genotypes were obtained from 32 DEC strains.The dominant genotypes were ST10(4 strains,12.5%),followed by ST28(2 strains,6.25%),ST31(2 strains,6.25%),ST3153(2 strains,6.25%),and the other 21 genotypes(1 strain,3.13%).One carbapenem resistant strain carrying the blaNDM-1 gene was detected in EAEC.Conclu-sion Four virulence genes such as aggR,pic,astA,and eae,are more common in the DEC of patients with infectious diarrhea in our hospital,with EAEC and EPEC as the main subtypes.The genotypes are highly polymorphic,and multidrug-resistant strains have been detected.

Objective:To investigate the effect of ultrasound-guided lumbar quadratus muscle plane block combined with general anesthesia on the analgesic effect during and after laparoscopic colon cancer radical surgery in elderly patients.Methods:A prospective study was conducted on 61 elderly patients who underwent radical colon cancer surgery at the Changsha Central Hospital Affiliated to South China University from May 2022 to February 2023, with American Society of Anesthesiologist (ASA) grades Ⅱ to Ⅲ. They were randomly divided into SA and GA groups using a random number table method, with 31 patients in the SA group and 30 patients in the GA group. The SA group received ultrasound-guided plane block of the upper lumbar quadratus muscle in the arcuate ligament combined with general anesthesia, while the GA group received simple general anesthesia. Record the mean artery pressure (MAP) and heart rate (HR) of two groups of patients at the time of entering the operating room (T 0), 5 minutes before skin incision (T 1), at skin incision (T 2), 30 minutes after surgery (T 3), at surgery end (T 4), and during anesthesia resuscitation and extubation (T 5); The Visual Analogue Scale (VAS) of two groups of patients at T 5, upon returning to the ward (T 6), 6 hours (T 7), 12 hours (T 8), 24 hours (T 9), and 48 hours (T 10) after surgery were recorded; The dosage of sufentanil, remifentanil, and propofol used during surgery, anesthesia recovery time, total number of analgesic pump presses within 48 hours after surgery, Lovett muscle strength score, early postoperative recovery, and adverse reactions within 48 hours after surgery were also recorded. Resultsl:The MAP and HR of the SA group were lower than those of the GA group at T 1-5 (all P<0.05); The VAS score of the SA group was lower than that of the GA group at T 5-10 (all P<0.05); The intraoperative dosage of propofol, remifentanil, and sufentanil in the SA group was lower than that in the GA group (all P<0.05); The anesthesia recovery time and first time out of bed in the SA group were earlier than those in the GA group (all P<0.05); The total number of times the analgesic pump was pressed within 48 hours after surgery was less than that of the GA group ( P<0.05); The incidence of nausea and vomiting within 48 hours after surgery in the SA group was lower than that in the GA group ( P<0.05). There was no statistically significant difference in postoperative Lovett muscle strength score, hospital stay, and dizziness incidence between the two groups of patients (all P>0.05). Conclusions:Ultrasound-guided lumbar quadratus muscle plane block on the arcuate ligament can significantly reduce the dosage of intraoperative general anesthesia drugs and postoperative analgesics in elderly patients undergoing laparoscopic colon cancer surgery, reduce postoperative pain scores, effectively alleviate postoperative pain, and thus advance the patient′s first time out of bed activity, reduce postoperative complications, and promote rapid recovery.

We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.

The intervention and prevention of perioperative hypothermia is not only reflected in the technical level, but also reveals the important role of humanistic care in the whole intervention work. If perioperative patients have hypothermia, it is likely to cause a series of complications such as postoperative shivering, which seriously threatens the life safety of patients. Prevention and intervention was based on a comprehensive understanding of the causes and hazards of hypothermia, especially the impact on the lives of the elderly. Effective supervision was implemented in the whole process of operation, such as dynamic monitoring of vital signs including body temperature, followed by room temperature regulation, body temperature protection and preoperative and postoperative psychological nursing. At this time, the sense of responsibility, good humanistic care of medical staff are of positive significance to effectively prevent and reduce the probability of perioperative hypothermia and accelerate the postoperative rehabilitation of patients.

Objective:To investigate the clinical effect of the transverse rectus abdominismuscle (TRAM) on reconstruction of the breast.Methods:The clinical data of 23 patients receiving TRAM breast reconstruction in our department from Jan. 2018 to Dec. 2019 were retrospectively analyzed.Results:The operation time of 23 patients ranged from 240 to 360 mins, andthe average time was about 300 mins. Intraoperative bleeding was about 120 to 200 ml, with an average of 170 ml. All the flaps survived successfully, but 2 cases were complicated with local fat necrosis. The postoperative period was between 6 and 12 months. No local tumor recurrence or metastasis was found inall patients during postoperative follow-up, and the breast shape was maintained in good condition.Conclusion:TRAM can make up for the regret of breast loss caused by breast cancer in female patients. It can bring confidence in life and work to female patients, and the technology is safe and reliable, which is worthy of promotion.

Objective: To explore the association between Vitamin A, E and mycoplasma pneumoniae pneumonia in children. Methods: 153 children with mycoplasma pneumoniae pneumonia and 653 health children were selected as cases and controls, respectively. Propensity score matching (PSM) analysis were conducted to reducing confounding bias between groups. Blood samples were collected to test serum levels of vitamin A and E using high performance liquid chromatography (HPLC). Logistic regression was implemented to determine odds ratios (OR) and 95% confidence intervals (CI) for evaluating the association of mycoplasma pneumoniae pneumonia with the serum levels of Vitamin A and E. Results: After propensity score matching, the study cohort included 153 cases with mycoplasma pneumoniae pneumonia and 306 health children as controls. Before matching, with age and gender adjusted, logistic regression analysis indicated that higher serum levels of Vitamin A and E led to a lower risk of mycoplasma pneumoniae pneumonia (OR=0.075, 95% CI: 0.007-0.815; OR=0.854, 95% CI: 0.792-0.986). After matching, higher serum level of Vitamin E had a significantly lower risk of mycoplasma pneumoniae pneumonia (OR=0.877, 95% CI: 0.810-0.950). Conclusions The serum levels of Vitamin A didn't have a statistically significant association with mycoplasma pneumoniae pneumonia. However, we observed an obvious association between Vitamin E and mycoplasma pneumoniae pneumonia. Hence Vitamin E clinical monitoring and supplementation are vital for preventing and treating mycoplasma pneumoniae pneumonia.