Because of the unclear active substances, metabolic pathways, and targets of new drugs of traditional Chinese medicine(TCM), non-clinical safety evaluation often fails to accurately locate the target organs and tissue exposed to medicinal toxicity. The human use experience(HUE) contains important safety information of TCM, while the clinical safety data in the past HUE are few and have not been effectively applied. Standardized prospective HUE studies should be carried out to collect the clinical safety data, in which appropriate physical and chemical indicators(including blood, urine, and stool routine), liver biochemical indicators, kidney biochemical indicators, and cardiovascular biochemical indicators should be selected for safety evaluation, and the detection time point and sample size should be rationally designed. Importance should be attached to the observation of symptoms and signs of adverse events/reactions in patients as well as the safety information of special groups such as the elderly, children, and pregnant women. The adverse events of TCM should be observed, judged, and treated according to the theory and the diagnosis and treatment mode of TCM. The clinical safety information about the HUE should be comprehensively collected for new drugs of TCM to make up for the lack of extrapolation of toxicological test results to humans. The unique advantages of clinical origin of new drugs of TCM should be given full play for cross-reference of the results of toxicological research and the conclusions of HUE safety evaluation. In addition, benefit-risk assessment should be conducted based on HUE, and a panoramic safety evaluation system characterized by macro and micro combination and in line with the characteristics of TCM should be established to improve the success rate in the research and development of new drugs of TCM.
Humans ; Drugs, Chinese Herbal/adverse effects* ; Medicine, Chinese Traditional/adverse effects* ; Drug-Related Side Effects and Adverse Reactions ; Female

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To evaluate the efficacy and safety of Shexiang Tongxin Dropping Pill (STDP) in treating stable angina patients with phlegm-heat and blood-stasis syndrome by exercise duration and metabolic equivalents. METHODS: This multicenter, randomized, double-blind, placebo-controlled clinical trial enrolled stable angina patients with phlegm-heat and blood-stasis syndrome from 22 hospitals. They were randomized 1:1 to STDP (35 mg/pill, 6 pills per day) or placebo for 56 days. The primary outcome was the exercise duration and metabolic equivalents (METs) assessed by the standard Bruce exercise treadmill test after 56 days of treatment. The secondary outcomes included the total angina symptom score, Chinese medicine (CM) symptom scores, Seattle Angina Questionnaire (SAQ) scores, changes in ST-T on electrocardiogram and adverse events (AEs). RESULTS: This trial enrolled 309 patients, including 155 and 154 in the STDP and placebo groups, respectively. STDP significantly prolonged exercise duration with an increase of 51.0 s, compared to a decrease of 12.0 s with placebo (change rate: -11.1% vs. 3.2%, P<0.01). The increase in METs was significantly greater in the STDP group than in the placebo group (change: -0.4 vs. 0.0, change rate: -5.0% vs. 0.0%, P<0.01). The improvement of total angina symptom scores (25.0% vs. 0.0%), CM symptom scores (38.7% vs. 11.8%), reduction of nitroglycerin consumption (100.0% vs. 11.3%), and all domains of SAQ, were significantly greater with STDP than placebo (all P<0.01). The changes in Q-T intervals at 28 and 56 days from baseline were similar between the two groups (both P>0.05). Twenty-five participants (16.3%) with STDP and 16 (10.5%) with placebo experienced AEs (P=0.131), with no serious AEs observed. CONCLUSION STDP could improve exercise tolerance in patients with stable angina and phlegm-heat and blood stasis syndrome, with a favorable safety profile. (Registration No. ChiCTR-IPR-15006020).
Humans ; Double-Blind Method ; Drugs, Chinese Herbal/adverse effects* ; Male ; Female ; Middle Aged ; Angina, Stable/physiopathology* ; Aged ; Syndrome ; Treatment Outcome ; Placebos ; Tablets

Deactivation of the mitochondrial pyruvate dehydrogenase complex (PDC) is important for the metabolic switching of cancer cell from oxidative phosphorylation to aerobic glycolysis. Studies examining PDC activity regulation have mainly focused on the phosphorylation of pyruvate dehydrogenase (E1), leaving other post-translational modifications largely unexplored. Here, we demonstrate that the acetylation of Lys 488 of pyruvate dehydrogenase complex component X (PDHX) commonly occurs in hepatocellular carcinoma, disrupting PDC assembly and contributing to lactate-driven epigenetic control of gene expression. PDHX, an E3-binding protein in the PDC, is acetylated by the p300 at Lys 488, impeding the interaction between PDHX and dihydrolipoyl transacetylase (E2), thereby disrupting PDC assembly to inhibit its activation. PDC disruption results in the conversion of most glucose to lactate, contributing to the aerobic glycolysis and H3K56 lactylation-mediated gene expression, facilitating tumor progression. These findings highlight a previously unrecognized role of PDHX acetylation in regulating PDC assembly and activity, linking PDHX Lys 488 acetylation and histone lactylation during hepatocellular carcinoma progression and providing a potential biomarker and therapeutic target for further development.
Humans ; Acetylation ; Carcinoma, Hepatocellular/genetics* ; Liver Neoplasms/genetics* ; Pyruvate Dehydrogenase Complex/genetics* ; Gene Expression Regulation, Neoplastic ; Animals ; Mice ; Cell Line, Tumor ; Protein Processing, Post-Translational ; Histones/metabolism* ; Disease Progression

OBJECTIVE: To explore and quantify the association of hot night exposure during the sperm development period (0-90 lag days) with semen quality. METHODS: A total of 6,640 male sperm donors from 6 human sperm banks in China during 2014-2020 were recruited in this multicenter study. Two indices (i.e., hot night excess [HNE] and hot night duration [HND]) were used to estimate the heat intensity and duration during nighttime. Linear mixed models were used to examine the association between hot nights and semen quality parameters. RESULTS: The exposure-response relationship revealed that HNE and HND during 0-90 days before semen collection had a significantly inverse association with sperm motility. Specifically, a 1 °C increase in HNE was associated with decreased sperm progressive motility of 0.0090 (95% confidence interval [ CI]: -0.0147, -0.0033) and decreased total motility of 0.0094 (95% CI: -0.0160, -0.0029). HND was significantly associated with reduced sperm progressive motility and total motility of 0.0021 (95% CI: -0.0040, -0.0003) and 0.0023 (95% CI: -0.0043, -0.0002), respectively. Consistent results were observed at different temperature thresholds on hot nights. CONCLUSION Our findings highlight the need to mitigate nocturnal heat exposure during spermatogenesis to maintain optimal semen quality.
Humans ; Male ; Semen Analysis ; Adult ; Sperm Motility ; Hot Temperature/adverse effects* ; China ; Middle Aged ; Spermatozoa/physiology* ; Young Adult

2-(4-Methylthiazol-5-yl) ethyl nitrate hydrochloride (W1302) is a nitro containing derivative of clomethiazole, which is a novel neuroprotective agent with both carbon monoxide (NO) donor and weak γ-aminobutyric acid type A (GABA_A) receptor allosteric regulatory excitatory effect. The current study used a rat model of transient middle cerebral arteryocclusion (tMCAO) brain injury to evaluate the therapeutic effect of W1302 on ischemic stroke and explore its potential mechanisms of action. This experiment has been reviewed and approved by the Laboratory Animal Management and Use Committee of the Institute of Materia Medica, Chinese Academy of Medical Sciences (ethical review forms No. 620, 632, 5013). The results showed that gavage administration of 1, 3, and 10 mg·kg^-1 of W1302 can significantly reduce the volume of cerebral infarction in rats with ischemia for 2 h and reperfusion for 24 h, and the therapeutic effect was better than that of 200 mg·kg^-1 of DL-3n-butylphthalide. W1302 significantly increased NO levels in blood and brain tissue. It increased cerebral blood flow and brain adenosine triphosphate (ATP) content after reperfusion, as well as, inhibited the expressions of inflammatory factors tumor necrosis factor-α (TNF-α) and interleukin-1β (IL-1β) in brain tissue. The time window of W1302 was between 120-180 min after ischemia. These research results demonstrated that W1302 could increase NO release, dilate blood vessels, and increase cerebral blood flow, improve energy supply to brain tissue and increase ATP levels, and inhibit neuro-inflammation, which playing the protective roles in tMCAO stroke model rats. This provides theoretical support for the clinical application of W1302 in the treatment of ischemic stroke.

This experiment aims to study the taste-masking effects of different kinds of corrigent used individually and in combination on ibuprofen oral solution, in order to optimize the taste-masking formulation. Firstly, a wide range of corrigent and the mass fractions were extensively screened using electronic tongue technology. Subsequently, a combination of sensory evaluation, analytic hierarchy process (AHP)-fuzzy mathematics evaluation, and Box-Behnken experimental design were employed to comprehensively assess the taste-masking effects of different combinations of corrigent on ibuprofen oral solution, optimize the taste-masking formulation, and validate the results. The study received ethical approval from the Review Committee of the Beijing University of Chinese Medicine (ethical code: 2024BZYLL0102). The results showed that corrigent fractions and types were screened separately through single-factor experiments. Subsequently, a Box-Behnken response surface design combined with AHP and fuzzy mathematics evaluation was used to fit a functional model: Z = 688.310 11 - 3 023.722 22X₁ - 11.477 00X₂ + 62.721 67X₃ + 14.600 00X₁X₂ - 179.666 67X₁X₃ - 3.152 00X₂X₃ + 4 031.111 11X₁² + 0.525 28X₂² + 9.772 00X₃². This model is stable and reliable, determining the optimal taste-masking formulation to be 3.9 g·L^-1 of stevioside, 100 g L^-1 of xylitol, and 30 g L^-1 of methyl-β-cyclodextrin. The comprehensive score of the verification test is 88.14, with a relative RSD of 0.39%, indicating the feasibility of this model. This study achieved the improvement of the taste of ibuprofen oral solution through a combination of objective and subjective methods. Three types of corrigent were identified for enhancing drug taste, leading to the selection of the optimal taste-masking formulation for ibuprofen oral solution. This significantly enhanced the taste of the original formulation, improved patient compliance, and offered a new approach to mitigating the undesirable taste of formulations.

Objective To study the change of lipidomics in chronic cadmium-exposed mice,thereby screening out lipid subclasses,lipid molecules and enriched metabolic pathways with significant differences.Methods Twelve SPF male C57BL/6J mice(8 weeks old)were randomly divided into the control group(normal water feeding)and the experimental group[cadmium water(0.6 mg/L of CdCl2)feeding],with 6 mice in each group.Mice were sacrificed after 6 months of cadmium exposure,and fresh liver tissues were collected immediately.Lipid oil red O staining and lipidomics analysis were performed on liver tissue.Results Compared with the control group,the liver tissue of mice in the experimental group did not appear red after lipid oil red O staining.Seventeen lipid subclasses with significant differences and 144 lipid molecules with significant differences were screened out by lipidomics.These lipid molecules with significant differences were enriched in glycerophospholipid metabolism,linoleic acid metabolism,alpha-linolenic acid metabolism,glycosylphosphati-dylinositol biosynthesis,glycerolipid metabolism and arachidonic acid metabolism by KEGG.Conclusion This study reveals that chronic cadmium exposure can induce the disorder of lipid subclasses and lipid metabolites in the liver of mice,which provides a basis for understanding the non-alcoholic fatty liver disease caused by chronic cadmium exposure.

Natural products are important sources of drug discovery. However, the traditional methods of extraction and isolation, as well as chemical synthesis for obtaining natural products are associated with issues such as operational complexity, high costs, low efficiency, and environmental pollution. Constructing microbial cell factories through synthetic biology methods to produce medicinal natural products has the advantages of high efficiency, low cost, and environmental protection. Nevertheless, the scope and yield improvement of the products are limited by the limitations of enzymes in microbial cell factories. Protein engineering is considered one of the most effective approaches to overcome these limitations. This article introduces commonly used methods of protein engineering technology and summarizes its specific applications in improving enzyme performance, modifying the enzymatic environment, and promoting the development of synthetic biology tools in the field of pharmaceutical natural product synthesis. Furthermore, it analyzes the current bottlenecks and challenges in protein engineering and looks forward to its future application prospects, offering insights for the development and practical use of protein engineering technology.