Because of the unclear active substances, metabolic pathways, and targets of new drugs of traditional Chinese medicine(TCM), non-clinical safety evaluation often fails to accurately locate the target organs and tissue exposed to medicinal toxicity. The human use experience(HUE) contains important safety information of TCM, while the clinical safety data in the past HUE are few and have not been effectively applied. Standardized prospective HUE studies should be carried out to collect the clinical safety data, in which appropriate physical and chemical indicators(including blood, urine, and stool routine), liver biochemical indicators, kidney biochemical indicators, and cardiovascular biochemical indicators should be selected for safety evaluation, and the detection time point and sample size should be rationally designed. Importance should be attached to the observation of symptoms and signs of adverse events/reactions in patients as well as the safety information of special groups such as the elderly, children, and pregnant women. The adverse events of TCM should be observed, judged, and treated according to the theory and the diagnosis and treatment mode of TCM. The clinical safety information about the HUE should be comprehensively collected for new drugs of TCM to make up for the lack of extrapolation of toxicological test results to humans. The unique advantages of clinical origin of new drugs of TCM should be given full play for cross-reference of the results of toxicological research and the conclusions of HUE safety evaluation. In addition, benefit-risk assessment should be conducted based on HUE, and a panoramic safety evaluation system characterized by macro and micro combination and in line with the characteristics of TCM should be established to improve the success rate in the research and development of new drugs of TCM.
Humans ; Drugs, Chinese Herbal/adverse effects* ; Medicine, Chinese Traditional/adverse effects* ; Drug-Related Side Effects and Adverse Reactions ; Female

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To evaluate the efficacy and safety of Shexiang Tongxin Dropping Pill (STDP) in treating stable angina patients with phlegm-heat and blood-stasis syndrome by exercise duration and metabolic equivalents. METHODS: This multicenter, randomized, double-blind, placebo-controlled clinical trial enrolled stable angina patients with phlegm-heat and blood-stasis syndrome from 22 hospitals. They were randomized 1:1 to STDP (35 mg/pill, 6 pills per day) or placebo for 56 days. The primary outcome was the exercise duration and metabolic equivalents (METs) assessed by the standard Bruce exercise treadmill test after 56 days of treatment. The secondary outcomes included the total angina symptom score, Chinese medicine (CM) symptom scores, Seattle Angina Questionnaire (SAQ) scores, changes in ST-T on electrocardiogram and adverse events (AEs). RESULTS: This trial enrolled 309 patients, including 155 and 154 in the STDP and placebo groups, respectively. STDP significantly prolonged exercise duration with an increase of 51.0 s, compared to a decrease of 12.0 s with placebo (change rate: -11.1% vs. 3.2%, P<0.01). The increase in METs was significantly greater in the STDP group than in the placebo group (change: -0.4 vs. 0.0, change rate: -5.0% vs. 0.0%, P<0.01). The improvement of total angina symptom scores (25.0% vs. 0.0%), CM symptom scores (38.7% vs. 11.8%), reduction of nitroglycerin consumption (100.0% vs. 11.3%), and all domains of SAQ, were significantly greater with STDP than placebo (all P<0.01). The changes in Q-T intervals at 28 and 56 days from baseline were similar between the two groups (both P>0.05). Twenty-five participants (16.3%) with STDP and 16 (10.5%) with placebo experienced AEs (P=0.131), with no serious AEs observed. CONCLUSION STDP could improve exercise tolerance in patients with stable angina and phlegm-heat and blood stasis syndrome, with a favorable safety profile. (Registration No. ChiCTR-IPR-15006020).
Humans ; Double-Blind Method ; Drugs, Chinese Herbal/adverse effects* ; Male ; Female ; Middle Aged ; Angina, Stable/physiopathology* ; Aged ; Syndrome ; Treatment Outcome ; Placebos ; Tablets

Deactivation of the mitochondrial pyruvate dehydrogenase complex (PDC) is important for the metabolic switching of cancer cell from oxidative phosphorylation to aerobic glycolysis. Studies examining PDC activity regulation have mainly focused on the phosphorylation of pyruvate dehydrogenase (E1), leaving other post-translational modifications largely unexplored. Here, we demonstrate that the acetylation of Lys 488 of pyruvate dehydrogenase complex component X (PDHX) commonly occurs in hepatocellular carcinoma, disrupting PDC assembly and contributing to lactate-driven epigenetic control of gene expression. PDHX, an E3-binding protein in the PDC, is acetylated by the p300 at Lys 488, impeding the interaction between PDHX and dihydrolipoyl transacetylase (E2), thereby disrupting PDC assembly to inhibit its activation. PDC disruption results in the conversion of most glucose to lactate, contributing to the aerobic glycolysis and H3K56 lactylation-mediated gene expression, facilitating tumor progression. These findings highlight a previously unrecognized role of PDHX acetylation in regulating PDC assembly and activity, linking PDHX Lys 488 acetylation and histone lactylation during hepatocellular carcinoma progression and providing a potential biomarker and therapeutic target for further development.
Humans ; Acetylation ; Carcinoma, Hepatocellular/genetics* ; Liver Neoplasms/genetics* ; Pyruvate Dehydrogenase Complex/genetics* ; Gene Expression Regulation, Neoplastic ; Animals ; Mice ; Cell Line, Tumor ; Protein Processing, Post-Translational ; Histones/metabolism* ; Disease Progression

OBJECTIVE: To explore and quantify the association of hot night exposure during the sperm development period (0-90 lag days) with semen quality. METHODS: A total of 6,640 male sperm donors from 6 human sperm banks in China during 2014-2020 were recruited in this multicenter study. Two indices (i.e., hot night excess [HNE] and hot night duration [HND]) were used to estimate the heat intensity and duration during nighttime. Linear mixed models were used to examine the association between hot nights and semen quality parameters. RESULTS: The exposure-response relationship revealed that HNE and HND during 0-90 days before semen collection had a significantly inverse association with sperm motility. Specifically, a 1 °C increase in HNE was associated with decreased sperm progressive motility of 0.0090 (95% confidence interval [ CI]: -0.0147, -0.0033) and decreased total motility of 0.0094 (95% CI: -0.0160, -0.0029). HND was significantly associated with reduced sperm progressive motility and total motility of 0.0021 (95% CI: -0.0040, -0.0003) and 0.0023 (95% CI: -0.0043, -0.0002), respectively. Consistent results were observed at different temperature thresholds on hot nights. CONCLUSION Our findings highlight the need to mitigate nocturnal heat exposure during spermatogenesis to maintain optimal semen quality.
Humans ; Male ; Semen Analysis ; Adult ; Sperm Motility ; Hot Temperature/adverse effects* ; China ; Middle Aged ; Spermatozoa/physiology* ; Young Adult

Objective To explore the acupoint selection rules of acupuncture treatment for cerebellar ataxia using data mining techniques.Methods Taking the related literature of acupuncture treatment of cerebellar ataxia as the retrieval content,the computer retrieval of China National Knowledge Internet(CNKI),China Biomedical Literature Database(SinoMed),Wanfang Data Knowledge Service Platform(Wanfang),China Science and Technology Journal Database(VIP),American Biomedical Information Retrieval System(PubMed)and other major databases.The eligible acupoints in the literature were entered into the Microsoft Excel 2021 software table to establish a database of acupoints frequency,meridian tropism,specific acupoints,distribution sites and other information for acupuncture treatment of cerebellar ataxia.SPSS Modeler 18.0 Apriori algorithm,SPSS Statistics 25.0 and SPSS Modeler 18.0 Web complex network were used to analyze the association rules of the included prescription acupoints,Ward cluster analysis and draw the tree diagram and the Web network diagram of high-frequency acupoints and core prescriptions.Results(1)A total of 93 articles were included,including 117 acupuncture prescriptions and 172 acupoints,with a total frequency of 1 199 times of acupoints.(2)The top 10 acupoints were Fengchi(GB20),Zusanli(ST36),Hegu(LI4),Baihui(DU20),Sanyinjiao(SP6),Taichong(LR3),Quchi(LI11),Yanglingquan(GB34),Wangu(GB12),and Tianzhu(BL10).(3)The top five meridians used frequently were gallbladder meridian of foot shaoyang,governor vessel(GV),stomach meridian of foot yangming,large intestine meridian of hand yangming and bladder meridian of foot taiyang.(4)The selection of acupoints is mainly based on the head,face,neck and lower limbs.(5)The highest frequency of the use of specific points is the intersection point.(6)The high-frequency acupoints for acupuncture treatment of cerebellar ataxia are Fengchi-Wangu,Fengchi-Tianzhu and Fengchi-Tianzhu-Wangu.The top 31 high-frequency acupoints(frequency＞10 times)can be divided into nine effective clusters.Conclusion Acupuncture treatment for cerebellar ataxia has formed a compatibility rule with the main principle of"regulating the mind and constraining the bones,extinguishing wind and stopping the movement",with the far and near acupoints as the main body,and attaches importance to the application of yang meridians with multiple qi and blood,presenting the basic acupoint prescription with Fengchi-Wanggu-Tianzhu as the core.

Objective:To screen interleukin(IL)-1β secretion-related membrane transporters by macrophage experiment in vitro and conventional knockout mice.Methods:THP-1 cell line was differentiated to obtain human THP-1-derived macrophages,and the primary macrophages were obtained from human peripheral blood.FVB wild-type mice with the same sex and age were used as the controls of MRP1 knockout mice.The macrophages in abdominal cavity and bone marrow of mice were cultivated.The cells were treated with ABCC1/MRP1,ABCG2/BCRP,ABCB1/P-gp,OATP1B1,and MATE transporter inhibitors,then stimulated by lipopolysaccharide and adenosine triphosphate.The secretion level of IL-iβ was detected by ELISA,Western blot,and immunofluorescence.Results:After inhibiting ABCC1/MRP1 transporter,the secretion of IL-1β decreased significantly,while inhibition of the other 4 transporters had no effect.In animal experiment,the level of IL-1 β secreted by macrophages in bone marrow of MRP1 knockout mice was significantly lower than control group(P＜0.05).Conclusion:ABCC1/MRP1 transporter is a newly discovered IL-1β secretion pathway,which is expected to become a new target for solving clinical problems such as cytokine release syndrome.

Objective:To investigate the correlation of peripheral blood T lymphocyte subsets with overall survival(OS)and clinical baseline characteristics in mantle cell lymphoma(MCL).Methods:The clinical data of 55 MCL patients who were newly diagnosed in the Department of Hematology,Second Hospital of Shanxi Medical University from January 2012 to July 2022 were analyzed retrospectively.The percentages of T lymphocyte subsets and CD4+/CD8+ratio in peripheral blood were detected by flow cytometry,and their correlation with clinical characteristics of patients were analyzed.Kaplan-Meier method was used for survival analysis and survival curves were drawn.Log-rank test was used for univariate analysis,while Cox proportional hazards model was used for multivariate analysis.Results:The median follow-up was 40(1-68)months,and the median overall survival(OS)was 47 months.Among the 55 patients,30(54.5％)patients had a decrease in peripheral blood CD4+T lymphocyte,while 17(30.9％)patients had a increase in peripheral blood CD8+T lymphocyte,and 20(36.4％)patients had a decrease in CD4+/CD8+ratio.There were no significant correlations between CD4+/CD8+ratio and sex,age,Ki-67,B symptoms,leukocytes,hemoglobin,lymphocytes,platelets,albumin,lactate dehydrogenase(LDH),β2-microglobulin,splenomegaly,bone marrow invasion,primary site and MIPI score.Survival analysis showed that patients with CD4+T cell＞23.3％,CD8+Tcell ≤33.4％and CD4+/CD8+ratio＞0.6 had longer OS(P=0.020,P＜0.001,P＜0.001).Univariate analysis showed that Ki-67＞30％,LDH＞250 U/L,splenomegaly,bone marrow involvement,CD4+T cells 23.3％,CD8+T cells＞33.4％,CD4+/CD8+ratio ≤0.6 were adverse prognostic factors affecting OS of MCL patients.Multivariate analysis showed that CD4+/CD8+ratio ≤0.6(HR=4.382,P=0.005)was an independent adverse prognostic factor for OS of MCL patients.Conclusions:Low CD4+/CD8+ratio is associated with poor prognosis in MCL,and the CD4+/CD8+ratio can be used as an important indicator to evaluate the prognosis risk in MCL patients.

Objective:To analyze the genotypes distribution of common and rare thalassemia in people of reproductive age in Huadu district of Guangzhou,enhance the database of thalassemia.Methods:Peripheral blood samples were collected for genotype analysis in Maternity and Child Health Hospital of Huadu District from January 2016 to October 2022.Gap-PCR and Reverse dot blot hybridization were used to detect common thalassemia genotypes.DNA sequencing was performed in samples suspected of rare genotypes.Results:A total of 16 171 subjects were identified as thalassemia carriers,and the positive rate was 44.41％(16 171/36 412).The genotypes of 114 cases(0.31％)were rare.A total of 10 845 cases were identified as α-thalassemia carriers(29.78％),and--SEA/αα was the most common genotype in those people,followed by-α3.7/αα and-α4.2/αα.A total of 4 531 subjects were identified as common β-thalassemia carriers(12.44％).The most common β-thalassemia mutation in the population was β41-42/βN,followed by β654/βN and β-28/β N.A total of 681 subjects were identified as αβ thalassemia carriers(1.87％),among them--SEA/αα compounded withβ CD41-42/β N was the most common genotype.A total of 48 cases were identified as rare α-thalassemia carriers,14 types of mutations,in which Fusion gene/αα was the most common.A total of 52 cases were identified as rare β-thalassemia carriers,11 types of mutation,in which βSEA-HPFH/βN was the most common.Conclusion:The thalassemia genotypes in Huadu district are complex and diverse.We should attach great importance to the detection of rare thalassemia genotypes.