1.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
2.The taste correction process of ibuprofen oral solution based on the combination of electronic tongue technology and artificial taste comprehensive evaluation
Rui YUAN ; Yun-ping QU ; Yan WANG ; Ya-xuan ZHANG ; Wan-ling ZHONG ; Xiao-yu FAN ; Hui-juan SHEN ; Yun-nan MA ; Jin-hong YE ; Jie BAI ; Shou-ying DU
Acta Pharmaceutica Sinica 2024;59(8):2404-2411
This experiment aims to study the taste-masking effects of different kinds of corrigent used individually and in combination on ibuprofen oral solution, in order to optimize the taste-masking formulation. Firstly, a wide range of corrigent and the mass fractions were extensively screened using electronic tongue technology. Subsequently, a combination of sensory evaluation, analytic hierarchy process (AHP)-fuzzy mathematics evaluation, and Box-Behnken experimental design were employed to comprehensively assess the taste-masking effects of different combinations of corrigent on ibuprofen oral solution, optimize the taste-masking formulation, and validate the results. The study received ethical approval from the Review Committee of the Beijing University of Chinese Medicine (ethical code: 2024BZYLL0102). The results showed that corrigent fractions and types were screened separately through single-factor experiments. Subsequently, a Box-Behnken response surface design combined with AHP and fuzzy mathematics evaluation was used to fit a functional model:
3.Diabetes Promotes Myocardial Fibrosis via AMPK/EZH2/PPAR-γ Signaling Pathway
Shan-Shan LI ; Lu PAN ; Zhen-Ye ZHANG ; Meng-Dan ZHOU ; Xu-Fei CHEN ; Ling-Ling QIAN ; Min DAI ; Juan LU ; Zhi-Ming YU ; Shipeng DANG ; Ru-Xing WANG
Diabetes & Metabolism Journal 2024;48(4):716-729
Background:
Diabetes-induced cardiac fibrosis is one of the main mechanisms of diabetic cardiomyopathy. As a common histone methyltransferase, enhancer of zeste homolog 2 (EZH2) has been implicated in fibrosis progression in multiple organs. However, the mechanism of EZH2 in diabetic myocardial fibrosis has not been clarified.
Methods:
In the current study, rat and mouse diabetic model were established, the left ventricular function of rat and mouse were evaluated by echocardiography and the fibrosis of rat ventricle was evaluated by Masson staining. Primary rat ventricular fibroblasts were cultured and stimulated with high glucose (HG) in vitro. The expression of histone H3 lysine 27 (H3K27) trimethylation, EZH2, and myocardial fibrosis proteins were assayed.
Results:
In STZ-induced diabetic ventricular tissues and HG-induced primary ventricular fibroblasts in vitro, H3K27 trimethylation was increased and the phosphorylation of EZH2 was reduced. Inhibition of EZH2 with GSK126 suppressed the activation, differentiation, and migration of cardiac fibroblasts as well as the overexpression of the fibrotic proteins induced by HG. Mechanical study demonstrated that HG reduced phosphorylation of EZH2 on Thr311 by inactivating AMP-activated protein kinase (AMPK), which transcriptionally inhibited peroxisome proliferator-activated receptor γ (PPAR-γ) expression to promote the fibroblasts activation and differentiation.
Conclusion
Our data revealed an AMPK/EZH2/PPAR-γ signal pathway is involved in HG-induced cardiac fibrosis.
4.Hydroxysafflor Yellow A Inhibits Pyroptosis and Protecting HUVECs from OGD/R via NLRP3/Caspase-1/GSDMD Pathway.
Fan GUO ; Xiao HAN ; Yue YOU ; Shu-Juan XU ; Ye-Hao ZHANG ; Yuan-Yuan CHEN ; Gao-Jie XIN ; Zi-Xin LIU ; Jun-Guo REN ; Ce CAO ; Ling-Mei LI ; Jian-Hua FU
Chinese journal of integrative medicine 2024;30(11):1027-1034
OBJECTIVE:
To observe the protective effect and mechanism of hydroxyl safflower yellow A (HSYA) from myocardial ischemia-reperfusion injury on human umbilical vein endothelial cells (HUVECs).
METHODS:
HUVECs were treated with oxygen-glucose deprivation reperfusion (OGD/R) to simulate the ischemia reperfusion model, and cell counting kit-8 was used to detect the protective effect of different concentrations (1.25-160 µ mol/L) of HSYA on HUVECs after OGD/R. HSYA 80 µ mol/L was used for follow-up experiments. The contents of inflammatory cytokines interleukin (IL)-18, IL-1 β, monocyte chemotactic protein 1 (MCP-1), tumor necrosis factor α (TNF-α) and IL-6 before and after administration were measured by enzyme-linked immunosorbent assay. The protein expressions of toll-like receptor, NOD-like receptor containing pyrin domain 3 (NLRP3), gasdermin D (GSDMD) and GSDMD-N-terminal domain (GSDMD-N) before and after administration were detected by Western blot. NLRP3 inflammasome inhibitor cytokine release inhibitory drug 3 sodium salt (CRID3 sodium salt, also known as MCC950) and agonist were added, and the changes of NLRP3, cysteine-aspartic acid protease 1 (Caspase-1), GSDMD and GSDMD-N protein expressions were detected by Western blot.
RESULTS:
HSYA inhibited OGD/R-induced inflammation and significantly decreased the contents of inflammatory cytokines IL-18, IL-1 β, MCP-1, TNF-α and IL-6 (P<0.01 or P<0.05). At the same time, by inhibiting NLRP3/Caspase-1/GSDMD pathway, HSYA can reduce the occurrence of pyroptosis after OGD/R and reduce the expression of NLRP3, Caspase-1, GSDMD and GSDMD-N proteins (P<0.01).
CONCLUSIONS
The protective effect of HSYA on HUVECs after OGD/R is related to down-regulating the expression of NLRP3 inflammasome and inhibiting pyroptosis.
NLR Family, Pyrin Domain-Containing 3 Protein/metabolism*
;
Human Umbilical Vein Endothelial Cells/metabolism*
;
Humans
;
Chalcone/analogs & derivatives*
;
Quinones/pharmacology*
;
Pyroptosis/drug effects*
;
Caspase 1/metabolism*
;
Glucose
;
Phosphate-Binding Proteins/metabolism*
;
Signal Transduction/drug effects*
;
Intracellular Signaling Peptides and Proteins/metabolism*
;
Oxygen/metabolism*
;
Cytokines/metabolism*
;
Gasdermins
5. Treatment advice of small molecule antiviral drugs for elderly COVID-19
Min PAN ; Shuang CHANG ; Xiao-Xia FENG ; Guang-He FEI ; Jia-Bin LI ; Hua WANG ; Du-Juan XU ; Chang-Hui WANG ; Yan SUN ; Xiao-Yun FAN ; Tian-Jing ZHANG ; Wei WEI ; Ling-Ling ZHANG ; Jim LI ; Fei-Hu CHEN ; Xiao-Ming MENG ; Hong-Mei ZHAO ; Min DAI ; Yi XIANG ; Meng-Shu CAO ; Xiao-Yang CHEN ; Xian-Wei YE ; Xiao-Wen HU ; Ling JIANG ; Yong-Zhong WANG ; Hao LIU ; Hai-Tang XIE ; Ping FANG ; Zhen-Dong QIAN ; Chao TANG ; Gang YANG ; Xiao-Bao TENG ; Chao-Xia QIAN ; Guo-Zheng DING
Chinese Pharmacological Bulletin 2023;39(3):425-430
COVID-19 has been prevalent for three years. The virulence of SARS-CoV-2 is weaken as it mutates continuously. However, elderly patients, especially those with underlying diseases, are still at high risk of developing severe infections. With the continuous study of the molecular structure and pathogenic mechanism of SARS-CoV-2, antiviral drugs for COVID-19 have been successively marketed, and these anti-SARS-CoV-2 drugs can effectively reduce the severe rate and mortality of elderly patients. This article reviews the mechanism, clinical medication regimens, drug interactions and adverse reactions of five small molecule antiviral drugs currently approved for marketing in China, so as to provide advice for the clinical rational use of anti-SARS-CoV-2 in the elderly.
6.Clinical features and prognostic factors of elderly patients with mantle cell lymphoma.
Xiao Yu HAO ; Ping YANG ; Wei ZHANG ; Hui LIU ; Xiu Hua SUN ; Xiu Bin XIAO ; Jing Wen WANG ; Zhen Ling LI ; Li Hong LI ; Shu Ye WANG ; Juan HE ; Xiao Ling LI ; Hong Mei JING
Chinese Journal of Hematology 2023;44(6):495-500
Objective: To examine the clinical characteristics and prognostic factors of elderly patients with mantle cell lymphoma (MCL) and the impact of nutrition and underlying diseases on the prognosis of elderly patients with MCL. Methods: retrospectively analyzed 255 elderly patients with MCL from 11 medical centers, including Peking University Third Hospital between January 2000 and February 2021. We analyzed clinical data, such as age, gender, Mantle Cell Lymphoma International Prognostic Index score, and treatment options, and performed univariate and multivariate prognostic analysis. We performed a comprehensive geriatric assessment on elderly MCL patients with medical records that included retraceable underlying disease and albumin levels, and we investigated the impact of basic nutrition and underlying disorders on MCL prognosis in the elderly. Results: There were 255 senior individuals among the 795 MCL patients. Elderly MCL was more common in males (78.4%), with a median age of 69 yr (ages 65-88), and the majority (88.6%) were identified at a late stage. The 3-yr overall survival (OS) rate was 42.0%, with a 21.2% progression-free survival (PFS) rate. The overall response rate (ORR) was 77.3%, with a 33.3% total remission rate. Elderly patients were more likely than younger patients to have persistent underlying illnesses, such as hypertension. Multivariate analysis revealed that variables related with poor PFS included age of ≥80 (P=0.021), Ann Arbor stage Ⅲ-Ⅳ (P=0.003), high LDH level (P=0.003), involvement of bone marrow (P=0.014). Age of ≥80 (P=0.001) and a high LDH level (P=0.003) were risk factors for OS. The complete geriatric assessment revealed that renal deficiency was associated with poorer OS (P=0.047) . Conclusions: Elderly MCL patients had greater comorbidities. Age, LDH, renal function, bone marrow involvement, and Ann Arbor stage are all independent risk factors for MCL in the elderly.
Male
;
Adult
;
Humans
;
Aged
;
Lymphoma, Mantle-Cell/drug therapy*
;
Prognosis
;
Retrospective Studies
;
Bone Marrow/pathology*
;
Risk Factors
7. The Long Chain Acyl-coenzyme A Synthetase Family and Malignant Tumors
Xiu-Juan ZHANG ; Ling LI ; Qi-Nong YE
Chinese Journal of Biochemistry and Molecular Biology 2022;38(7):875-884
Disorders of the fatty acid metabolism can lead to cancer. The long chain acyl-coenzyme A synthetase (ACSL) family is important in fatty acid metabolism and is responsible for activating long chain fatty acids. In cancer cells, the regulatory effect of ACSLs is often disrupted, and the distribution, type, and quantity of fatty acids are altered. These alterations can lead to cancer development and other metabolic diseases. ACSLs include five subtypes in mammals, namely ACSL1, 3, 4, 5, and 6. ACSL1 is important in the synthesis and distribution of triglycerides. ACSL3 contributes to the formation of lipid droplets, which are important for maintaining lipid homeostasis. The expression of ACSL4 is related to steroid hormones and plays an important role in ferroptosis. ACSL5 can catalyze the metabolism of exogenous fatty acids but not the metabolism of de novo fatty acids. ACSL6 is important in fatty acid metabolism in the brain, spermatogenesis, and ovary. The regulatory factors of ACSLs include transcription factors, coactivators, hormone receptors, protein kinases, and small non-coding RNAs. These factors regulate mitochondria-mediated energy metabolism, endoplasmic reticulum stress, and the tumor inflammatory microenvironment through fatty acid metabolism. In addition, ACSLs serve as independent prognostic factors, biomarkers for clinical diagnosis, and therapeutic targets for various cancers. In recent years, accumulating evidence has demonstrated the important roles of ACSLs in the occurrence and development of cancer. This article focuses on the ACSL family, the relationship between ACSL and malignant tumors, and tumor therapies based on lipid metabolism by ACSLs. The information provides a theoretical basis for the further study of the ACSL family as molecular candidates for the targeted therapy of tumors.
8.Material basis and molecular mechanism of Angelicae Sinensis Radix in activating blood:based on computer-aided drug design.
Jia LIN ; Juan YAO ; Min ZHANG ; Chao-Xin LI ; Ya-Ling LI ; Lu QIU ; Ye-Hu HOU ; Yong-Qi LIU ; Xiao-Jie JIN
China Journal of Chinese Materia Medica 2022;47(7):1942-1954
Angelicae Sinensis Radix excels in activating blood, but the scientific mechanism has not been systematically analyzed, thus limiting the development of the medicinal. This study employed the computer-aided drug design methods, such as structural similarity-based target reverse prediction, complex network analysis, molecular docking, binding free energy calculation, cluster analysis, and ADMET(absorption, distribution, metabolism, excretion, toxicity) calculation, and enzyme activity assay in vitro, to explore the components and mechanism of Angelicae Sinensis Radix in activating blood. Target reverse prediction and complex network analysis yielded 40 potential anticoagulant targets of the medicinal. Gene Ontology(GO) term enrichment and Kyoto Encyclopedia of Genes and Genomes(KEGG) pathway enrichment analysis indicated that the targets mainly acted on the complement and coagulation cascade signaling pathway to exert the anticoagulant function. Among them, the key enzymes thrombin(THR) and coagulation factor Xa(FXa) in coagulation cascade and thrombosis were the drug targets for thromboembolic diseases. At the same time, molecular docking and cluster analysis showed that the medicinal had high selectivity for FXa. According to binding free energy score, 8 potential active components were selected for enzyme activity assay in vitro. The results demonstrated that 8 components inhibited THR and FXa, and the inhibition was stronger on FXa than on THR. The pharmacophore model of 8 active compounds was constructed, which suggested that the components had the common pharmacophore AAHH. The ADMET calculation result indicated that they had good pharmacokinetic properties and were safe. Based on target reverse prediction, complex network analysis, molecular docking and binding free energy calculation, anticoagulant activity in vitro, spatial binding conformation of molecules and targets, pharmacophore model construction, and ADMET calculation, this study preliminarily clarified the material basis and molecular mechanism of Angelicae Sinensis Radix in activating blood from the perspective of big data, and calculated the pharmacology and toxicology parameters of the active components. Our study, for the first time, revealed that the medicinal had obvious selectivity and pertinence for different coagulation proteins, reflecting the unique effect of different Chinese medicinals and the biological basis. Therefore, this study can provide clues for precision application of Angelicae Sinensis Radix and the development of the blood-activating components with modern technology.
Anticoagulants/pharmacology*
;
Blood Coagulation
;
Drug Design
;
Drugs, Chinese Herbal/pharmacology*
;
Molecular Docking Simulation
9.Clinical treatment outcomes and their changes in extremely preterm twins: a multicenter retrospective study in Guangdong Province, China.
Bi-Jun SHI ; Ying LI ; Fan WU ; Zhou-Shan FENG ; Qi-Liang CUI ; Chuan-Zhong YANG ; Xiao-Tong YE ; Yi-Heng DAI ; Wei-Yi LIANG ; Xiu-Zhen YE ; Jing MO ; Lu DING ; Ben-Qing WU ; Hong-Xiang CHEN ; Chi-Wang LI ; Zhe ZHANG ; Xiao RONG ; Wei SHEN ; Wei-Min HUANG ; Bing-Yan YANG ; Jun-Feng LYU ; Hui-Wen HUANG ; Le-Ying HUO ; Hong-Ping RAO ; Wen-Kang YAN ; Xue-Jun REN ; Yong YANG ; Fang-Fang WANG ; Dong LIU ; Shi-Guang DIAO ; Xiao-Yan LIU ; Qiong MENG ; Yu WANG ; Bin WANG ; Li-Juan ZHANG ; Yu-Ge HUANG ; Dang AO ; Wei-Zhong LI ; Jie-Ling CHEN ; Yan-Ling CHEN ; Wei LI ; Zhi-Feng CHEN ; Yue-Qin DING ; Xiao-Yu LI ; Yue-Fang HUANG ; Ni-Yang LIN ; Yang-Fan CAI ; Sha-Sha HAN ; Ya JIN ; Guo-Sheng LIU ; Zhong-He WAN ; Yi BAN ; Bo BAI ; Guang-Hong LI ; Yue-Xiu YAN
Chinese Journal of Contemporary Pediatrics 2022;24(1):33-40
OBJECTIVES:
To investigate the clinical treatment outcomes and the changes of the outcomes over time in extremely preterm twins in Guangdong Province, China.
METHODS:
A retrospective analysis was performed for 269 pairs of extremely preterm twins with a gestational age of <28 weeks who were admitted to the department of neonatology in 26 grade A tertiary hospitals in Guangdong Province from January 2008 to December 2017. According to the admission time, they were divided into two groups: 2008-2012 and 2013-2017. Besides, each pair of twins was divided into the heavier infant and the lighter infant subgroups according to birth weight. The perinatal data of mothers and hospitalization data of neonates were collected. The survival rate of twins and the incidence rate of complications were compared between the 2008-2012 and 2013-2017 groups.
RESULTS:
Compared with the 2008-2012 group, the 2013-2017 group (both the heavier infant and lighter infant subgroups) had lower incidence rates of severe asphyxia and smaller head circumference at birth (P<0.05). The mortality rates of both of the twins, the heavier infant of the twins, and the lighter infant of the twins were lower in the 2013-2017 group compared with the 2008-2012 group (P<0.05). Compared with the 2008-2012 group, the 2013-2017 group (both the heavier infant and lighter infant subgroups) had lower incidence rates of pulmonary hemorrhage, patent ductus arteriosus (PDA), periventricular-intraventricular hemorrhage (P-IVH), and neonatal respiratory distress syndrome (NRDS) and a higher incidence rate of bronchopulmonary dysplasia (P<0.05).
CONCLUSIONS
There is a significant increase in the survival rate over time in extremely preterm twins with a gestational age of <28 weeks in the 26 grade A tertiary hospitals in Guangdong Province. The incidences of severe asphyxia, pulmonary hemorrhage, PDA, P-IVH, and NRDS decrease in both the heavier and lighter infants of the twins, but the incidence of bronchopulmonary dysplasia increases. With the improvement of diagnosis and treatment, the multidisciplinary collaboration between different fields of fetal medicine including prenatal diagnosis, obstetrics, and neonatology is needed in the future to jointly develop management strategies for twin pregnancy.
Bronchopulmonary Dysplasia/epidemiology*
;
Female
;
Gestational Age
;
Humans
;
Infant
;
Infant, Extremely Premature
;
Infant, Newborn
;
Pregnancy
;
Respiratory Distress Syndrome, Newborn/epidemiology*
;
Retrospective Studies
;
Treatment Outcome
10.Effect of Jingangwan on p38 MAPK,JNK,and IL-1 Content in Osteoporosis Model Rats
Lin-ling SHEN ; Kuan RONG ; Zi-feng YE ; Juan AN ; Hao-ming KUANG ; Jian-jun KUANG
Chinese Journal of Experimental Traditional Medical Formulae 2022;28(9):29-35
ObjectiveTo investigate the effect of Jingangwan on the expression of osteoclast, c-Jun N-terminal kinase(JNK), p38 mitogen-activated protein kinase(p38 MAPK), and interleukin-1(IL-1) in the osteoporosis model rats, explore the mechanism of Jingangwan in the treatment of osteoporosis, and determine the optimal dosing concentration of Jingangwan. MethodFifty-six rats of SPF grade were randomized into a blank group,a sham operation group,a model group, model group,high-, medium-, and low-dose Jingangwan groups (0.72, 0.36, 0.18 g·kg-1·d-1, ig),and an estradiol valerate group (0.009 g·kg-1·d-1, ig), with eight rats in each group. The rats in the model group, the blank group, and the sham operation group received 3 mL of normal saline, respectively. Samples were collected 12 weeks after drug administration. The number of osteoclasts was observed by tartrate-resistant acid phosphatase (TRAP) staining. Serum levels of JNK, p38 MAPK, and IL-1 were detected by enzyme-linked immunosorbent assay (ELISA). The mRNA expression levels of p38 MAPK and JNK were detected by real-time quantitative polymerase chain reaction (Real-time PCR). ResultThe TRAP staining results showed that compared with the model group, the estradiol valerate group and the Jingangwan groups could inhibit the formation of osteoclasts to different degrees. As revealed by ELISA results, compared with the model group and the sham operation group, the model group showed increased serum levels of p38 MAPK, JNK, and IL-1 (P<0.01), while compared with the model group, all the groups with drug intervention showed decreased levels of p38 MAPK, JNK, and IL-1 (P<0.01). The serum levels of JNK and IL-1 in the high-dose Jingangwan group were lower than those in the estradiol valerate group (P<0.05). Real-time PCR results showed that compared with the blank group, the model group showed increased relative mRNA expression of p38 MAPK and JNK in the thighbone (P<0.01), while compared with the model group, all the groups with drug intervention showed decreased relative mRNA expression of p38 MAPK and JNK in the thighbone (P<0.01). ConclusionJingangwan can inhibit the formation of osteoblasts,reduce the diameter of the bone marrow cavity,improve bone quality,suppress the production of inflammatory factors,affect the metabolism of the MAPK signaling pathway,and blunt p38 MAPK and JNK activities to inhibit the differentiation and proliferation of osteoblasts and regulate bone metabolism, thereby preventing osteoporosis. Therefore,Jingangwan may be of application value in maintaining bone health and treating osteoporosis.

Result Analysis
Print
Save
E-mail