Recent advances in large models demonstrate significant prospects for transforming the field of medical imaging. These models, including large language models, large visual models, and multimodal large models, offer unprecedented capabilities in processing and interpreting complex medical data across various imaging modalities. By leveraging self-supervised pretraining on vast unlabeled datasets, cross-modal representation learning, and domain-specific medical knowledge adaptation through fine-tuning, large models can achieve higher diagnostic accuracy and more efficient workflows for key clinical tasks. This review summarizes the concepts, methods, and progress of large models in medical imaging, highlighting their potential in precision medicine. The article first outlines the integration of multimodal data under large model technologies, approaches for training large models with medical datasets, and the need for robust evaluation metrics. It then explores how large models can revolutionize applications in critical tasks such as image segmentation, disease diagnosis, personalized treatment strategies, and real-time interactive systems, thus pushing the boundaries of traditional imaging analysis. Despite their potential, the practical implementation of large models in medical imaging faces notable challenges, including the scarcity of high-quality medical data, the need for optimized perception of imaging phenotypes, safety considerations, and seamless integration with existing clinical workflows and equipment. As research progresses, the development of more efficient, interpretable, and generalizable models will be critical to ensuring their reliable deployment across diverse clinical environments. This review aims to provide insights into the current state of the field and provide directions for future research to facilitate the broader adoption of large models in clinical practice.
Humans ; Diagnostic Imaging/methods* ; Precision Medicine/methods* ; Image Processing, Computer-Assisted/methods*

BACKGROUND: Spicy food consumption has been reported to be inversely associated with mortality from multiple diseases. However, the effect of spicy food intake on the incidence of vascular diseases in the Chinese population remains unclear. This study was conducted to explore this association. METHODS: This study was performed using the large-scale China Kadoorie Biobank (CKB) prospective cohort of 486,335 participants. The primary outcomes were vascular disease, ischemic heart disease (IHD), major coronary events (MCEs), cerebrovascular disease, stroke, and non-stroke cerebrovascular disease. A Cox proportional hazards regression model was used to assess the association between spicy food consumption and incident vascular diseases. Subgroup analysis was also performed to evaluate the heterogeneity of the association between spicy food consumption and the risk of vascular disease stratified by several basic characteristics. In addition, the joint effects of spicy food consumption and the healthy lifestyle score on the risk of vascular disease were also evaluated, and sensitivity analyses were performed to assess the reliability of the association results. RESULTS: During a median follow-up time of 12.1 years, a total of 136,125 patients with vascular disease, 46,689 patients with IHD, 10,097 patients with MCEs, 80,114 patients with cerebrovascular disease, 56,726 patients with stroke, and 40,098 patients with non-stroke cerebrovascular disease were identified. Participants who consumed spicy food 1-2 days/week (hazard ratio [HR] = 0.95, 95% confidence interval [95% CI] = [0.93, 0.97], P <0.001), 3-5 days/week (HR = 0.96, 95% CI = [0.94, 0.99], P = 0.003), and 6-7 days/week (HR = 0.97, 95% CI = [0.95, 0.99], P = 0.002) had a significantly lower risk of vascular disease than those who consumed spicy food less than once a week ( Ptrend <0.001), especially in those who were younger and living in rural areas. Notably, the disease-based subgroup analysis indicated that the inverse associations remained in IHD ( Ptrend = 0.011) and MCEs ( Ptrend = 0.002) risk. Intriguingly, there was an interaction effect between spicy food consumption and the healthy lifestyle score on the risk of IHD ( Pinteraction = 0.037). CONCLUSIONS Our findings support an inverse association between spicy food consumption and vascular disease in the Chinese population, which may provide additional dietary guidance for the prevention of vascular diseases.
Humans ; Male ; Female ; Prospective Studies ; Middle Aged ; Aged ; Vascular Diseases/etiology* ; Risk Factors ; China/epidemiology* ; Adult ; Proportional Hazards Models ; Cerebrovascular Disorders/epidemiology* ; East Asian People

Objective:To explore the clinical application value of artificial intelligence（AI）-assisted training in enhancing the accuracy of nuchal translucency（NT）identification，standardization of measurement，and diagnostic efficacy for abnormalities among ultrasound residents.Methods:A retrospective collection of 300 standard fetal NT ultrasound images was conducted at the Center for Medical Ultrasound，Suzhou Hospital Affiliated of Nanjing Medical University from January 2018 to June 2024. The AI model performed NT measurements and diagnoses once. Four sonographers of different seniority levels（including two resident physicians）independently conducted NT measurements and diagnoses twice. Prior to the experiment，the middle-age and resident sonographers had uniformly completed traditional theory training. Following the first independent measurements，the two resident sonographers received additional AI-assisted training，after which all 4 sonographers performed the second independent measurements. A fetal medicine expert evaluated blindly all the results and compared the differences in NT recognition accuracy，measurement standard rate and diagnosis accuracy between the middle-age sonographer（traditional training only）and two resident sonographers（traditional + AI-assisted training）.Results:For the middle-aged sonographer who only received traditional lecture-based training，the accuracy of NT recognition，standardization rate of measurement，or diagnostic accuracy were not significantly improved befroe and after the training，and the diffrence was not statistically significant（ χ2=0.189，1.887，0.326；all P>0.05）. In contrast，the second-year resident（Resident 2）and first-year resident（Resident 1），who received both traditional lecture-based training and AI training，demonstrated some improvements in the accuracy of NT measurement site recognition，though the differences were not statistically significant（ χ2=1.301，2.418；all P>0.05）. However，both residents did significant improvements in the standardization rate of NT measurement（ χ2=25.768，17.035；all P<0.05）. In terms of diagnostic accuracy，Resident 1 did significant improvement（ χ2=10.180， P<0.05），while Resident 2 also did some improvement，though the difference was not statistically significant（ χ2=2.573， P>0.05）. Conclusions:The AI-assisted training system enhances the ability of ultrasound resident sonographers to recognize，measure，and diagnose NT，providing a novel and efficient training model for standardized residency training in ultrasound specialties.

OBJECTIVE To observe the in vitro induced drug resistance mechanisms of polymyxin B-resistant Acin-etobacter baumannii and explore the in vitro antimicrobial activity of polymyxin B combined with melatonin.METHODS Totally 10 strains of polymyxin B-sensitive A.baumannii were clinically isolated from the Affiliated Li Huili Hospital of Ningbo university between Jan.2021 to Dec.2021 and were induced to the polymyxin B-resistant strains by means of in vitro induction method.The drug resistance mechanisms of the polymyxin B-resistant A.baumannii strains were explored by polymerase chain reaction(PCR)combined with sequencing analysis.The minimum inhibitory concentrations(MICs)of the single and joint use of polymyxin B and melatonin were detected by using broth microdilution checkerboard.The antibacterial effect of polymyxin combined with melatonin was e-valuated by calculating fractional inhibitory concentration index(FICI).The strains that showed the remarkable synergistic effect for the antimicrobial activity were chosen to determine the time-kill curves.RESULTS Among the polymyxin B-induced drug-resistant A.baumannii strains,there were gene mutations at various loci of polymyxin resistance genes pmrB,lpxA and lpxD.The MIC of polymyxin B against A.baumannii strains declined after the combined use of polymyxin B and melatonin.The combined use of the two drugs that showed synergistic effect for antimicrobial activity accounted for 80.00％(8/10),the additive effect 20.00％(2/10).The time-kill curve showed that the combined use of polymyxin B and melatonin showed remarkable antibacterial effect at the 24th hour.CONCLUSIONS The drug resistance gene mutations that are mediated by chromosomes are the major drug resist-ance mechanisms of the A.baumannii strains to polymyxin B.The combined use of polymyxin B and melatonin may reverse the drug resistance of the A.baumannii to polymyxin B.

Objective:To investigate the diagnostic value of fetal cardiac ultrasound view visualization in the first trimester for congenital heart disease（CHD）.Methods:A retrospective analysis was performed on 13 323 singleton fetuses who underwent first-trimester（11-13 +6 weeks）ultrasound screening at the Ultrasound Medicine Center，the Affiliated Suzhou Hospital of Nanjing Medical University from January 2018 to June 2024. Cardiac views including the four-chamber view（4CV），left ventricular outflow tract view（LVOT），and Results:The study group showed significantly higher rates of "poorly visualized" 4CV，LVOT，and 3VT than the control group（2.70% vs. 0.14%， P=0.005；36.49% vs. 4.76%， P<0.001；36.49% vs.2.46%， P<0.001）. The efficacies of combination 1（any view abnormal）and combination 2（any view "poorly visualized" or "abnormal"）were comparable，with AUCs of 0.86 and 0.85（ P=0.424）. The AUCs of combination 3（3VT "poorly visualized" or any view "abnormal"）and combination 4（4CV "poorly visualized" or any view "abnormal"）were 0.88 and 0.86（ P=0.424），all significantly higher than combination 5（LVOT "poorly visualized" or any view "abnormal"，AUC=0.84，all P<0.05）. Conclusions:"Poorly visualized" cardiac views in the first trimester demonstrate good diagnostic efficacy for CHD，particularly when 3VT or 4CV are affected，warranting heightened clinical vigilance for fetal cardiac anomalies.

Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.

ObjectiveTo understand the measles, rubella, and mumps antibody seroprevalence among the children aged 18 years and younger in Karamay City, and to evaluate the effectiveness of vaccination. MethodsA stratified whole cluster random sampling method was used to investigate the antibody seroprevalence of measles, rubella, and mumps among the healthy children aged 18 years and younger in Karamay City, and to further analyze the positive antibody rates and the geometric mean concentration (GMC) of antibodies. ResultsA total of 620 people were investigated, and the positive rates of IgG to measles, rubella, and mumps were 72.74%,62.26%, and 86.45%, respectively, with a GMC of308.94 mIU·mL^-1, 21.81 mIU·mL^-1, and 249.10 U·mL^-1. There were statistically significant differences in the positive rates of antibodies to measles, rubella, and mumps among different age groups (χ²_measles=76.707, P<0.001; χ²_rubella=60.804, P<0.001; χ²_mumps=35.407, P<0.001). The differences in positive rates were statistically significant among individuals with different intervals from the time of their last dose vaccination (χ²_measles=60.533, P<0.001; χ²_rubella=46.331, P<0.001; χ²_mumps=22.825, P<0.001). ConclusionThe antibody levels of measles, rubella and mumps among the people aged 18 years and younger in Karamay City are found to be low. Two doses of measles-mumps-rubella (MMR) vaccine should be given to children born before 2020, and if necessary, supplementary immunization with MMR vaccine should be carried out before they are enrolled in nursery and kindergarten. Additionally, regular population-based antibody surveillance should be conducted to promptly identify the people with weak immunity, which is conducive to effectively reducing and controlling the epidemic situation of measles, rubella and mumps in schools.

Eight butyl-phthalides, senkyunolide K(1), senkyunolide N(2), butylphthalide(3), senkyunolide I(4), senkyunolide H(5),(Z)-butylidenephthalide(6),(Z)-ligustilide(7), and 3-butylidene-7-hydroxyphthalide(8) were isolated from the aerial part of Ligusticum sinense by column chromatography on silica gel column, ODS, Sephadex LH-20 and semi-preparative HPLC. Their structures were elucidated on the basis of spectroscopic and chemical data, especially NMR and MS. Compound 1 was a new butyl-phthalide and compounds 2-8 were isolated from the aerial part of L. sinense for the first time. Furthermore, the inhibitory activities of compounds 1-8 against the nitric oxide(NO) production induced by lipopolysaccharide(LPS) in mouse RAW264.7 macrophages in vitro were evaluated. The results showed that compounds 1-8 exerted inhibitory activities on NO production with IC_(50) of 19.34-42.16 μmol·L~(-1).
Animals ; Mice ; Nitric Oxide/biosynthesis* ; Ligusticum/chemistry* ; Benzofurans/isolation & purification* ; Drugs, Chinese Herbal/isolation & purification* ; Macrophages/immunology* ; RAW 264.7 Cells ; Molecular Structure

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To investigate the effectiveness of Xuanshen Yishen Decoction (XYD) in the treatment of hypertension. METHODS: Hospital electronic medical records from 2019-2023 were utilized to emulate a randomized pragmatic clinical trial. Hypertensive participants were eligible if they were aged ⩾40 years with baseline systolic blood pressure (BP) ⩾140 mm Hg. Patients treated with XYD plus antihypertensive regimen were assigned to the treatment group, whereas those who followed only antihypertensive regimen were assigned to the control group. The primary outcome assessed was the attainment rate of intensive BP control at discharge, with the secondary outcome focusing on the 6-month all-cause readmission rate. RESULTS: The study included 3,302 patients, comprising 2,943 individuals in the control group and 359 in the treatment group. Compared with the control group, a higher proportion in the treatment group achieved the target BP for intensive BP control [8.09% vs. 17.5%; odds ratio (OR)=2.29, 95% confidence interval (CI)=1.68 to 3.13; P<0.001], particularly in individuals with high homocysteine levels (OR=3.13; 95% CI=1.72 to 5.71; P<0.001; P for interaction=0.041). Furthermore, the 6-month all-cause readmission rate in the treatment group was lower than in the control group (hazard ratio=0.58; 95% CI=0.36 to 0.91; P=0.019), and the robustness of the results was confirmed by sensitivity analyse. CONCLUSIONS XYD could be a complementary therapy for intensive BP control. Our study offers real-world evidence and guides the choice of complementary and alternative therapies. (Registration No. ChiCTR2400086589).
Adult ; Aged ; Female ; Humans ; Male ; Middle Aged ; Antihypertensive Agents/pharmacology* ; Blood Pressure/drug effects* ; Drugs, Chinese Herbal/pharmacology* ; Hypertension/physiopathology* ; Patient Readmission ; Treatment Outcome