1.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
2.Chinese experts' consensus on principles of preoperative hair removal
Yiping MAO ; Jun ZHENG ; Lei LI ; Deyan YANG ; Bing ZHANG ; Lei YANG ; Wang JIA ; Peng KANG ; Hui JIAO ; Yun YANG ; Qi QI ; Shiqing FENG ; Xiao LONG ; Yuewei ZHANG ; Xiaohui WANG ; Lize WANG ; Yuan WEI ; Jichao ZHOU ; Minghui MAO ; Pengju XIN ; Hongyu TAN ; Dahong ZHANG ; Lianxin LIU ; Lei TAO ; Xietong WANG ; Xiaoning YUAN ; Mang CAI ; Li MU ; Fang DU ; Rongzhu CHEN ; Fengmao ZHAO ; Jiuzuo HUANG ; Mingzi ZHANG ; Jie ZHANG ; Baoguo WANG ; Kun WANG ; Fang LUO ; Jinhua ZHANG ; Nong HE ; Ling LYU ; Zhiyong ZONG
Chinese Journal of Nosocomiology 2025;35(10):1441-1449
To formulate an expert consensus on the principles of preoperative hair removal and provide scientific guidance for standardized removal of hair before surgical procedures so as to reduce the incidence of surgical site infections.METHODS Led by the Hospital Management Institute of National Health Commission of the People's Republic of China,this consensus was reached with the joint efforts from the expects of relevant fields such as surgeries,interventional therapies,nursing,and infection prevention and control.The consensus facilitates the classification and evaluation of literatures by following the evidence grade formulated by Oxford Evidence-based Medicine Center and focuses on the association of preoperative hair removal with surgical site infection,it reaches the evidence grade of expert consensus and recommendation intensity by integrating with discussions on meetings and clinical experience of the expects from relevant fields.RESULTS A total of 6 items of consensus were reached by summarizing the latest evidence on the aspects including the indications for preoperative hair removal,tools,range,timing and places.CONCLUSION The consensus,to some extent,make supplements to and complete the exiting regulations and standards.It provides guidance for the medical institutions to carry out the preoperative hair removal.
3.The synergistic effect and mechanism verification of effective components of Biejia-Ezhu against triple-negative breast cancer based on network pharmacology and component compatibility theory
Dou-dou FENG ; Xiao-shan LUO ; Yan-yun MENG ; Jing-zhe ZHAO ; Jiu-long ZHU ; Ya-zhen HUANG ; Qing XIE ; Xiang-Li LING ; Su XIE
Chinese Pharmacological Bulletin 2025;41(5):950-959
Aim To explore the compatibility and po-tential mechanism of effective components of Biejia-Ezhu against triple negative breast cancer(TNBC)and verify it by experiments.Methods Effective compo-nents and targets of Biejia-Ezhu were obtained by TC-MSP and Swiss Target Prediction.Disease targets of TNBC were obtained from OMMI and GeneCards data-bases.The PPI network was constructed using STRING database.GO and KEGG path enrichment analysis was performed using DAVID database.Cytoscape3.9.1 software was used to construct the"drug-component-target-disease"network,screen key targets and compo-nents for molecular docking,and further verify the com-patibility of key components and targets in vitro.Re-sults ① A total of 71 effective components were iden-tified in the Biejia-Ezhu drug pair.There were 146 drug targets associated with the disease.A total of 113 signaling pathways were identified by KEGG analysis.The 71 potential active components of Biejia-Ezhu mainly acted on key targets such as mTORC1,ULK1,TNF,EGFR,ESR1,STAT3,HIF1A,and PTGS2.Mo-lecular docking results showed that glycine and curcu-min were the key active components of Biejia-Ezhu,and both had strong docking activity against key target proteins mTORC1 and ULK1.②The results of in vitro experiment showed that glycine combined with curcu-min significantly inhibited the proliferation and clonal formation ability of TNBC cells(P<0.05),up-regula-ted the expression of autophagy marker LC3 Ⅱ/Ⅰ,down-regulated the expression of EGFR,down-regula-ted the expression of pathway protein mTORC1,p-mTOR,p-ULK1,and promoted the expression of path-way protein ULK1(P<0.05).Conclusion The key component of Biejia-Ezhu against triple-negative breast cancer is glycine-curcumin,the mechanism of which may be related to the regulation of the mTORC1/ULK1 signaling pathway to promote autophagy.
4.Effects of galangin on proliferation,apoptosis and 5-FU resistance of colorectal cancer cells by regulating FOXO3-FOXM1 axis
Liu YANG ; Dan FENG ; Li YANG ; Ling TANG ; Fei LUO
Journal of Regional Anatomy and Operative Surgery 2025;34(1):5-10
Objective To investigate the effects of galangin on the proliferation,apoptosis,and 5-fluorouracil (5-FU) resistance of colorectal cancer (CRC) cells by regulating the FOXO3-FOXM1 axis. Methods CRC cells HCT8 and its drug-resistant cell lines HCT8/5-FU were cultured in vitro,and then treated with different concentrations (0,5,10,20,40 μmol/L) of galangin to screen experimental concentra-tions. HCT8 cells were divided into the ctrl group (without special treatment),NC group (transfected with empty plasmid),L-galangin group (treated with 10 μmol/L of galangin ),H-galangin group (treated with 20 μmol/L of galangin),and H-galangin+sh-FOXO3 group (trans-fected with FOXO3 shRNA plasmid after 20 μmol/L of galangin treatment). HCT8/5-FU cells were divided into the control group (without special treatment),5-FU+NC group (treated with empty plasmid after 5 μg/mL of 5-FU treatment),5-FU group (treated with 5 μg/mL of 5-FU),5-FU+L-galangin group (treated with 10 μmol/L of galangin after 5 μg/mL of 5-FU treatment),5-FU+H-galangin group (transfected with 20 μmol/L galangin after 5 μg/mL of 5-FU treatment),and 5-FU+H-galangin+sh-FOXO3 group (transfected with FOXO3 shRNA plasmid after 5 μg/mL of 5-FU and 20 μmol/L of galangin treatment). The cell proliferation ability was detected by CCK-8 assay;the cell clone formation ability was detected by clone formation assay;the cell apoptosis was detected by flow cytometry;the expression of related proteins were detected by Western blot.Results In HCT8 cells,compared with 0 μmol/L of galangin treatment,10,20,40 μmol/L of galangin treatment decreased the cell survival rate (P<0.05). In HCT8/5-FU cells,compared with 0 μmol/L galangin treatment,40 μmol/L of galangin treatment decreased the cell survival rate (P<0.05). After 10 and 20 μmol/L of galangin treatment,the apoptosis rate,and the expression of FOXO3 and Bax proteins were increased (P<0.05),while cell survival rate,clone formation number,and expression of FOXM1 and PCNA proteins decreased in HCT8 and HCT8/5-FU cells (P<0.05),and the MRP-1 protein expression in HCT8/5-FU cells decreased (P<0.05). Knocking down sh-FOXO3 could attenuate the effects of high dose of galangin on HCT8 and HCT8/5-FU cells (P<0.05). Conclusion Galangin may inhibit the proliferation,promote apoptosis,and reduce 5-FU resistance of CRC cells by regulating the FOXO3-FOXM1 axis.
5.Correlation of corneal α angle and κ angle with lens tilt angle using swept-source optical biometry
Zi-Suo LI ; Zi-Han HE ; Jie ZHOU ; Jian-Feng ZHAO ; Xiao-Ling LUO ; Ya-Li FENG ; Chen YANG ; Yu GENG
Medical Journal of Chinese People's Liberation Army 2025;50(9):1083-1088
Objective To investigate the correlation of corneal α angle and κ angle with lens tilt in normal human eyes using a new swept-source optical biometer.Methods A cross-sectional study was conducted,involving 303 healthy eyes(148 right eyes and 155 left eyes)of patients who visited the First Affiliated Hospital of Kunming Medical University from June to August 2024.ZW-30 swept-source optical biometer was used to collect the lens tilt angle,κ angle(distance from the corneal light reflex to the pupil center),and α angle(distance from corneal light reflex to the corneal geometric center,which is the midpoint of the horizontal white to white(WTW)diameter).The degrees(°)and directions of κ angle and α angle were calculated by the ratio of the above measurements to the anterior chamber depth(ACD)respectively.Spearman correlation analysis and linear regression analysis were employed to evaluate the correlations between the magnitude and direction of corneal α angle,κ angle and lens tilt angle.Results The magnitude and direction of corneal α angle,κ angle,and lens tilt angle in the right eye were as follows respectively:(0.54±0.19)mm(7.81°±3.88°),194.43°±39.75°;(0.27±0.23)mm(4.72°±3.90°),181.07°±79.59°;5.52°±1.67°,188.21°±25.73°.For the left eye,the corresponding values were:(0.47±0.27)mm(8.12°±5.26°),336.04°±46.64°;(0.26±0.27)mm(4.45°±4.80°),322.86°±107.79°;5.50°±1.61°,340.65°±32.84°.Spearman's correlation analysis showed that the correlation coefficients between corneal α angle and lens tilt angle in the right eye were 0.609(distance correlation)and 0.625(angle correlation),while those for κ angle were 0.559(distance correlation)and 0.578(angle correlation).In the left eye,the correlation coefficients between corneal α angle and lens tilt angle were 0.545(distance correlation)and 0.552(angle correlation),and those for κ angle were 0.377(distance correlation)and 0.395(angle correlation).In addition,the correlation coefficient between the direction of corneal α angle and the direction of lens tilt angle in the right eye was 0.343,and that for κ angle direction was 0.284;in the left eye,the correlation coefficients were 0.216(α angle direction)and 0.198(κ angle direction),all with statistical significance(P<0.05).Univariate linear regression analysis showed that lens tilt was positively correlated with both corneal α angle and Kappa angle(P<0.05).Conclusions Corneal α angle and κ angle are highly correlated with lens tilt angle in both eyes,and the correlation of corneal α angle is stronger than that of κ angle in both left and right eyes.The correlation expressed by degree(°)is better than that by distance(mm).It is recommended to refer to the corneal α angle and κ angle expressed in degrees during preoperative evaluation.
6.Inhibitory effects of Shuyu Pills combined with everolimus on TGF-β1-induced epithelial-mesenchymal transition in triple-negative breast cancer cells
Xiao-shan LUO ; Su XIE ; Dou-dou FENG ; Yan-yun MENG ; Jing-zhe ZHAO ; Qing XIE ; Xiang-li LING
Chinese Traditional Patent Medicine 2025;47(7):2190-2197
AIM To investigate the effects of Shuyu Pills combined with evolimus on the epithelial mesenchymal transformation of triple negative breast cancer cells 4T1 and MDA-MB-231 induced by TGF-β1.METHODS The 4T1 and MDA-MB-231 cells were divided into the blank group and the induction group to induce the epithelial mesenchymal transformation with TGF-β1 cytokine treatment,followed by the assignment into the model group,the Shuyu Pills group,the everolimus group and the Shuyu Pills combined with everolimus group.CCK8 method,plate cloning method,cell scratch test and Transewll test were used to detect the proliferation,cloning formation,migration and invasion ability of the cells whose expressions of E-cadherin,N-cadherin,Vimentin,MMP9,MMP2 and pathway proteins PTEN,PI3K,Akt and mTOR were detected by Western blot.RESULTS Compared with the blank group,the induction group displayed a cell morphological change from epithelioid to stromal,decreased expression of E-cadherin protein(P<0.01);and increased protein expressions of N-cadherin and Vimentin(P<0.05).Compared with the model group,each group intervened with the medicine displayed decreased proliferation,clone formation,migration and invasion ability of both kinds of cells(P<0.01);increased protein expressions of PTEN and E-cadherin(P<0.05,P<0.01);and decreased protein expressions of PI3K,Akt,mTOR,N-cadherin,Vimentin,MMP9 and MMP2(P<0.05,P<0.01);and more significantly in the Shuyu Pills combined with evolimus group(P<0.05,P<0.01).CONCLUSION With a more ideal effect than the single uses in inhibiting the TGF-β1-induced epithelial mesenchymal transformation of triple-negative breast cancer cells,the combination use of Shuyu Pills and everolimus may work through the regulation of PI3K/Akt/mTOR signaling pathway.
7.The synergistic effect and mechanism verification of effective components of Biejia-Ezhu against triple-negative breast cancer based on network pharmacology and component compatibility theory
Dou-dou FENG ; Xiao-shan LUO ; Yan-yun MENG ; Jing-zhe ZHAO ; Jiu-long ZHU ; Ya-zhen HUANG ; Qing XIE ; Xiang-Li LING ; Su XIE
Chinese Pharmacological Bulletin 2025;41(5):950-959
Aim To explore the compatibility and po-tential mechanism of effective components of Biejia-Ezhu against triple negative breast cancer(TNBC)and verify it by experiments.Methods Effective compo-nents and targets of Biejia-Ezhu were obtained by TC-MSP and Swiss Target Prediction.Disease targets of TNBC were obtained from OMMI and GeneCards data-bases.The PPI network was constructed using STRING database.GO and KEGG path enrichment analysis was performed using DAVID database.Cytoscape3.9.1 software was used to construct the"drug-component-target-disease"network,screen key targets and compo-nents for molecular docking,and further verify the com-patibility of key components and targets in vitro.Re-sults ① A total of 71 effective components were iden-tified in the Biejia-Ezhu drug pair.There were 146 drug targets associated with the disease.A total of 113 signaling pathways were identified by KEGG analysis.The 71 potential active components of Biejia-Ezhu mainly acted on key targets such as mTORC1,ULK1,TNF,EGFR,ESR1,STAT3,HIF1A,and PTGS2.Mo-lecular docking results showed that glycine and curcu-min were the key active components of Biejia-Ezhu,and both had strong docking activity against key target proteins mTORC1 and ULK1.②The results of in vitro experiment showed that glycine combined with curcu-min significantly inhibited the proliferation and clonal formation ability of TNBC cells(P<0.05),up-regula-ted the expression of autophagy marker LC3 Ⅱ/Ⅰ,down-regulated the expression of EGFR,down-regula-ted the expression of pathway protein mTORC1,p-mTOR,p-ULK1,and promoted the expression of path-way protein ULK1(P<0.05).Conclusion The key component of Biejia-Ezhu against triple-negative breast cancer is glycine-curcumin,the mechanism of which may be related to the regulation of the mTORC1/ULK1 signaling pathway to promote autophagy.
8.Chinese experts' consensus on principles of preoperative hair removal
Yiping MAO ; Jun ZHENG ; Lei LI ; Deyan YANG ; Bing ZHANG ; Lei YANG ; Wang JIA ; Peng KANG ; Hui JIAO ; Yun YANG ; Qi QI ; Shiqing FENG ; Xiao LONG ; Yuewei ZHANG ; Xiaohui WANG ; Lize WANG ; Yuan WEI ; Jichao ZHOU ; Minghui MAO ; Pengju XIN ; Hongyu TAN ; Dahong ZHANG ; Lianxin LIU ; Lei TAO ; Xietong WANG ; Xiaoning YUAN ; Mang CAI ; Li MU ; Fang DU ; Rongzhu CHEN ; Fengmao ZHAO ; Jiuzuo HUANG ; Mingzi ZHANG ; Jie ZHANG ; Baoguo WANG ; Kun WANG ; Fang LUO ; Jinhua ZHANG ; Nong HE ; Ling LYU ; Zhiyong ZONG
Chinese Journal of Nosocomiology 2025;35(10):1441-1449
To formulate an expert consensus on the principles of preoperative hair removal and provide scientific guidance for standardized removal of hair before surgical procedures so as to reduce the incidence of surgical site infections.METHODS Led by the Hospital Management Institute of National Health Commission of the People's Republic of China,this consensus was reached with the joint efforts from the expects of relevant fields such as surgeries,interventional therapies,nursing,and infection prevention and control.The consensus facilitates the classification and evaluation of literatures by following the evidence grade formulated by Oxford Evidence-based Medicine Center and focuses on the association of preoperative hair removal with surgical site infection,it reaches the evidence grade of expert consensus and recommendation intensity by integrating with discussions on meetings and clinical experience of the expects from relevant fields.RESULTS A total of 6 items of consensus were reached by summarizing the latest evidence on the aspects including the indications for preoperative hair removal,tools,range,timing and places.CONCLUSION The consensus,to some extent,make supplements to and complete the exiting regulations and standards.It provides guidance for the medical institutions to carry out the preoperative hair removal.
9.Effects of galangin on proliferation,apoptosis and 5-FU resistance of colorectal cancer cells by regulating FOXO3-FOXM1 axis
Liu YANG ; Dan FENG ; Li YANG ; Ling TANG ; Fei LUO
Journal of Regional Anatomy and Operative Surgery 2025;34(1):5-10
Objective To investigate the effects of galangin on the proliferation,apoptosis,and 5-fluorouracil (5-FU) resistance of colorectal cancer (CRC) cells by regulating the FOXO3-FOXM1 axis. Methods CRC cells HCT8 and its drug-resistant cell lines HCT8/5-FU were cultured in vitro,and then treated with different concentrations (0,5,10,20,40 μmol/L) of galangin to screen experimental concentra-tions. HCT8 cells were divided into the ctrl group (without special treatment),NC group (transfected with empty plasmid),L-galangin group (treated with 10 μmol/L of galangin ),H-galangin group (treated with 20 μmol/L of galangin),and H-galangin+sh-FOXO3 group (trans-fected with FOXO3 shRNA plasmid after 20 μmol/L of galangin treatment). HCT8/5-FU cells were divided into the control group (without special treatment),5-FU+NC group (treated with empty plasmid after 5 μg/mL of 5-FU treatment),5-FU group (treated with 5 μg/mL of 5-FU),5-FU+L-galangin group (treated with 10 μmol/L of galangin after 5 μg/mL of 5-FU treatment),5-FU+H-galangin group (transfected with 20 μmol/L galangin after 5 μg/mL of 5-FU treatment),and 5-FU+H-galangin+sh-FOXO3 group (transfected with FOXO3 shRNA plasmid after 5 μg/mL of 5-FU and 20 μmol/L of galangin treatment). The cell proliferation ability was detected by CCK-8 assay;the cell clone formation ability was detected by clone formation assay;the cell apoptosis was detected by flow cytometry;the expression of related proteins were detected by Western blot.Results In HCT8 cells,compared with 0 μmol/L of galangin treatment,10,20,40 μmol/L of galangin treatment decreased the cell survival rate (P<0.05). In HCT8/5-FU cells,compared with 0 μmol/L galangin treatment,40 μmol/L of galangin treatment decreased the cell survival rate (P<0.05). After 10 and 20 μmol/L of galangin treatment,the apoptosis rate,and the expression of FOXO3 and Bax proteins were increased (P<0.05),while cell survival rate,clone formation number,and expression of FOXM1 and PCNA proteins decreased in HCT8 and HCT8/5-FU cells (P<0.05),and the MRP-1 protein expression in HCT8/5-FU cells decreased (P<0.05). Knocking down sh-FOXO3 could attenuate the effects of high dose of galangin on HCT8 and HCT8/5-FU cells (P<0.05). Conclusion Galangin may inhibit the proliferation,promote apoptosis,and reduce 5-FU resistance of CRC cells by regulating the FOXO3-FOXM1 axis.
10.Inhibitory effects of Shuyu Pills combined with everolimus on TGF-β1-induced epithelial-mesenchymal transition in triple-negative breast cancer cells
Xiao-shan LUO ; Su XIE ; Dou-dou FENG ; Yan-yun MENG ; Jing-zhe ZHAO ; Qing XIE ; Xiang-li LING
Chinese Traditional Patent Medicine 2025;47(7):2190-2197
AIM To investigate the effects of Shuyu Pills combined with evolimus on the epithelial mesenchymal transformation of triple negative breast cancer cells 4T1 and MDA-MB-231 induced by TGF-β1.METHODS The 4T1 and MDA-MB-231 cells were divided into the blank group and the induction group to induce the epithelial mesenchymal transformation with TGF-β1 cytokine treatment,followed by the assignment into the model group,the Shuyu Pills group,the everolimus group and the Shuyu Pills combined with everolimus group.CCK8 method,plate cloning method,cell scratch test and Transewll test were used to detect the proliferation,cloning formation,migration and invasion ability of the cells whose expressions of E-cadherin,N-cadherin,Vimentin,MMP9,MMP2 and pathway proteins PTEN,PI3K,Akt and mTOR were detected by Western blot.RESULTS Compared with the blank group,the induction group displayed a cell morphological change from epithelioid to stromal,decreased expression of E-cadherin protein(P<0.01);and increased protein expressions of N-cadherin and Vimentin(P<0.05).Compared with the model group,each group intervened with the medicine displayed decreased proliferation,clone formation,migration and invasion ability of both kinds of cells(P<0.01);increased protein expressions of PTEN and E-cadherin(P<0.05,P<0.01);and decreased protein expressions of PI3K,Akt,mTOR,N-cadherin,Vimentin,MMP9 and MMP2(P<0.05,P<0.01);and more significantly in the Shuyu Pills combined with evolimus group(P<0.05,P<0.01).CONCLUSION With a more ideal effect than the single uses in inhibiting the TGF-β1-induced epithelial mesenchymal transformation of triple-negative breast cancer cells,the combination use of Shuyu Pills and everolimus may work through the regulation of PI3K/Akt/mTOR signaling pathway.

Result Analysis
Print
Save
E-mail