1.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
2.Correlation of corneal α angle and κ angle with lens tilt angle using swept-source optical biometry
Zi-Suo LI ; Zi-Han HE ; Jie ZHOU ; Jian-Feng ZHAO ; Xiao-Ling LUO ; Ya-Li FENG ; Chen YANG ; Yu GENG
Medical Journal of Chinese People's Liberation Army 2025;50(9):1083-1088
Objective To investigate the correlation of corneal α angle and κ angle with lens tilt in normal human eyes using a new swept-source optical biometer.Methods A cross-sectional study was conducted,involving 303 healthy eyes(148 right eyes and 155 left eyes)of patients who visited the First Affiliated Hospital of Kunming Medical University from June to August 2024.ZW-30 swept-source optical biometer was used to collect the lens tilt angle,κ angle(distance from the corneal light reflex to the pupil center),and α angle(distance from corneal light reflex to the corneal geometric center,which is the midpoint of the horizontal white to white(WTW)diameter).The degrees(°)and directions of κ angle and α angle were calculated by the ratio of the above measurements to the anterior chamber depth(ACD)respectively.Spearman correlation analysis and linear regression analysis were employed to evaluate the correlations between the magnitude and direction of corneal α angle,κ angle and lens tilt angle.Results The magnitude and direction of corneal α angle,κ angle,and lens tilt angle in the right eye were as follows respectively:(0.54±0.19)mm(7.81°±3.88°),194.43°±39.75°;(0.27±0.23)mm(4.72°±3.90°),181.07°±79.59°;5.52°±1.67°,188.21°±25.73°.For the left eye,the corresponding values were:(0.47±0.27)mm(8.12°±5.26°),336.04°±46.64°;(0.26±0.27)mm(4.45°±4.80°),322.86°±107.79°;5.50°±1.61°,340.65°±32.84°.Spearman's correlation analysis showed that the correlation coefficients between corneal α angle and lens tilt angle in the right eye were 0.609(distance correlation)and 0.625(angle correlation),while those for κ angle were 0.559(distance correlation)and 0.578(angle correlation).In the left eye,the correlation coefficients between corneal α angle and lens tilt angle were 0.545(distance correlation)and 0.552(angle correlation),and those for κ angle were 0.377(distance correlation)and 0.395(angle correlation).In addition,the correlation coefficient between the direction of corneal α angle and the direction of lens tilt angle in the right eye was 0.343,and that for κ angle direction was 0.284;in the left eye,the correlation coefficients were 0.216(α angle direction)and 0.198(κ angle direction),all with statistical significance(P<0.05).Univariate linear regression analysis showed that lens tilt was positively correlated with both corneal α angle and Kappa angle(P<0.05).Conclusions Corneal α angle and κ angle are highly correlated with lens tilt angle in both eyes,and the correlation of corneal α angle is stronger than that of κ angle in both left and right eyes.The correlation expressed by degree(°)is better than that by distance(mm).It is recommended to refer to the corneal α angle and κ angle expressed in degrees during preoperative evaluation.
3.Study on the Treatment of Dampness Stagnated in the Triple Energizer Based on the Theory of"Qi Transformation Leading to the Removal of Pathogenic Dampness"
Xiao-Ying MO ; Wei-Jun RUAN ; Feng-Ling ZHENG ; Huan-Huan LUO
Journal of Guangzhou University of Traditional Chinese Medicine 2024;41(4):1048-1052
The statement of"qi transformation leading to the removal of pathogenic dampness"was recorded in Wen Bing Tiao Bian(Analysis on Epidemic Febrile Diseases)written by the Qing Dynasty physician WU Ju-Tong.Dampness in the triple energizer is caused by the dysfunction of qi transformation,and the treatment of dampness must be based on the activation of qi movement and focused on the promotion of qi movement and the restoration of the qi transformation in the triple energizer.For the treatment of dampness attack in the upper energizer,therapies of dispersing lung to smooth qi and resolving dampness to relieve the obstruction are recommended.For the treatment of dampness obstruction in the middle energizer,therapy of activating spleen qi by strengthening spleen and moving qi is stressed for helping the removal of dampness and for the eradication of the source of dampness.For the treatment of dampness stagnation in the lower energizer,therapy of draining dampness with sweet-light medicines and activating yang can be used according to the illness status.The three methods of treating dampness,namely dispersing the upper energizer,activating the middle energizer and draining the lower energizer,all embody the mechanism of"qi transformation leading to the removal of pathogenic dampness",and the therapies of dispersing lung with light medicines,inducing perspiration by opening striated layer,eliminating dampness with aromatics and draining dampness with sweet-light medicines should be used in accordance with the syndromes.The elucidation of the academic thoughts of"qi transformation leading to the removal of pathogenic dampness"can provide theoretical reference for the fundamental research of dampness syndrome and clinical application of therapies for resolving dampness in Chinese medicine.
4.Discussion on the Pathogenesis of Heavy Dampness Leading to Watery Diarrhea and the Modern Mechanism of Therapeutic Principle of Warming and Activating Spleen Yang
Kai ZHUANG ; Feng-Ling ZHENG ; Huan-Huan LUO
Journal of Guangzhou University of Traditional Chinese Medicine 2024;41(6):1621-1627
The statement of heavy dampness leading to watery diarrhea was recorded in Huang Di Nei Jing(The Yellow Emperor's Inner Classic),which is not only an interpretation of the pathogenesis of diarrhea,but also one of the important principles to guide the clinical treatment of diarrhea in traditional Chinese medicine.The watery diarrhea can be caused by the invasion of external dampness,or results from the retention and accumulation of internal dampness.The combination of internal dampness and external dampness causes internal injury of spleen yang,and then the spleen yang is inactivated,which eventually results in diarrhea.Based on the pathogenesis of spleen yang inactivation and water-dampness retention and accumulation in heavy dampness leading to watery diarrhea,the therapeutic principle of warming and activating spleen yang should be performed.Modern Chinese medicine clinical practice and related mechanism research showed that the therapy of warming and activating spleen yang was closely related to the mitochondrial function in modern western medicine.The mechanism Linggui Zhugan Decoction and Fuzi Lizhong Decoction in relieving watery diarrhea by warming and activating spleen yang is related to the improvement of the energy metabolism disorder in the mitochondrion;the mechanism of Shengyang Yiwei Decoction and Shengyang Chushi Decoction in relieving watery diarrhea by raising yang and eliminating dampness is related to the improvement of mitochondrial damage in the inflammatory state;the mechanism of Xiao Jianzhong Decoction and Lizhong Decoction in relieving watery diarrhea by activating spleen is related to the improvement of mitochondrial oxidative damage.The exploration of the pathogenesis of heavy dampness leading to watery diarrhea and the modern mechanism of therapy of warming and activating spleen yang will provide reference for the study of the etiology and pathogenesis of pathogenic dampness and the dampness syndrome,and can provide reference for the prevention and treatment of diarrhea patients in the humid climate environment such as in Lingnan area and the middle and lower reaches of the Yangtze River and under the combined influence of improper dietary structure in modern society.
5.Effect of Simo decoction on the regulation of NLRP3/Caspase-1/GSDMD signal pathway on duodenal microinflammation in rats with functional dyspepsia
Qin LIU ; Xiao-Yuan LIN ; Ling-Feng YANG ; Qian LUO ; Yun-Zong HAN ; Si-Qing CHEN ; Hai-Yue ZHANG ; Shu ZHOU ; Sai-Nan ZHOU
The Chinese Journal of Clinical Pharmacology 2024;40(1):67-71
Objective To investigate the effects of Simo decoction on duodenal microinflammation and NOD-like receptor thermal protein domain associated protein 3(NLRP3)/cysteinyl aspartate-specific proteinase-1(Caspase-1)/gasdermin D(GSDMD)signaling pathway in rats with functional dyspepsia(FD).Methods The FD model was established by multifactorial method.SD rats were randomly divided into normal group,model group(FD model),positive control group(gavage administration of 0.305 mg·kg-1 mosapride injection)and experimental-H,-M,-L groups(gavage administration of 5.62,2.81,1.40 g·kg-1 Simo decoction).Small intestinal advancement rate and gastric emptying rate was determined;the levels of interleukin(IL)-1 β and IL-18 in serum were determined by enzyme linked immunosorbent assay(ELISA);the protein expression of NLRP3 and GSDMD in duodenal tissue was detected by Western blotting.Results The gastric emptying rates of normal,model,positive control and experimental-H,-M,-Lgroupswere(58.34±5.72)%,(29.16±8.37)%,(48.77±6.10)%,(48.35±6.04)%,(48.20±3.49)%and(39.24±4.20)%;the small intestinal propulsion rates were(82.01±7.55)%,(41.95±9.53)%,(64.61±10.18)%,(75.04±9.76)%,(60.58±7.13)%and(45.89±7.40)%;serum IL-1 β expression were(12.86±0.88),(43.73±4.60),(18.84±0.86),(24.61±1.57),(19.14±0.77)and(29.04±0.72)pg·mL-1;IL-18 expressions were(95.00±3.74),(170.60±8.78),(108.50±3.05),(118.90±3.45),(99.90±8.70)and(141.00±3.71)pg·mL-1;the relative expression levels of NLRP3 proteins were 0.32±0.02,0.84±0.05,0.42±0.03,0.48±0.02,0.61±0.04 and 0.62±0.05;the relative expression levels of GSDMD proteins were 0.34±0.05,0.93±0.06,0.35±0.03,0.52±0.02,0.53±0.06 and 0.55±0.05,respectively.Compared with the normal group,the above indexes in the model group have statistical significance;compared with the model group,the above indexes in the experimental-H group and the positive control group also have statistical significance(P<0.01 or P<0.05).Conclusion Simo decoction can effectively improve the general condition and duodenal microinflammation in FD rats,and the mechanism may be related to the inhibition of duodenal NLRP3/Caspase-1/GSDMD signaling pathway.
6.Analysis of anxious and depressive emotions and its influencing factors of patients underwent cervical cancer surgery based on CC-PRO137 scale
Yue YIN ; Shen LUO ; Ling QIU ; Hui WANG ; Yang LIU ; Hao FENG ; Bei-Li WANG ; Hua JIANG ; Xin WU
Fudan University Journal of Medical Sciences 2024;51(5):643-649
Objective To investigate anxious and depressive emotions in patients underwent cervical cancer surgery and to analyze its influencing factors.Methods A total of 304 patients who underwent primary cervical cancer surgery in Obstetrics and Gynecology Hospital,Fudan University from Oct 2018 to Jun 2021,were recruited to evaluate the clinical effect based on cervical cancer-patient reported outcome 137 scale(CC-PRO137 scale).This study focused on dimensions of depressive and anxious emotions within this scale and explored their influencing factors.Results The average scores of their depressive and anxious emotions within half a year after surgery were 4.141±0.798 and 4.020±0.616,respectively;and the average scores of depressive and anxious emotions more than one year after surgery were 4.250±0.802 and 4.097±0.613,respectively.By using statistical methods including analysis of variance and t test,it was found that there were statistically significant differences in the scores of depression and anxiety among cervical cancer patients under different postoperative adjuvant treatments and at different postoperative time points(P<0.05).However,there were no statistically significant differences in the scores of depression and anxiety among patients with different ages,surgical methods,and clinical stages of cervical cancer(P>0.05).Conclusion Patients underwent cervical cancer surgery may suffer varying degree of depressive and anxious emotions,and the main influencing factors are different adjuvant treatments and the length of time for postsurgical recovery.Medical practitioners should strengthen comfort and care for patients with cervical cancer,especially those who receive chemotherapy and radiotherapy treatments and are in the primary stage after the surgery.Formulating positive intervention measures can effectively reduce the psychological pain of patients and safeguard their physical and mental health.
7.Associations of reproductive health indicators with lung function and COPD among female community residents aged 40 years and above in Songjiang District,Shanghai
Xin YIN ; Yi-Ling WU ; Shan-Shan HOU ; Jing LI ; Wei LUO ; Min-Jun YU ; Jin-Xin ZANG ; Wei WANG ; Xu-Yan SU ; Qi ZHAO ; Yin-Feng ZHU ; Gen-Ming ZHAO ; Yong-Gen JIANG ; Qing-Wu JIANG ; Na WANG
Fudan University Journal of Medical Sciences 2024;51(6):882-889
Objective To investigate the associations of reproductive health indicators with lung function and chronic obstructive pulmonary disease(COPD)among women aged 40 years and above.Methods From Jul to Sep,2021,female subjects aged 40 years and above were randomly selected from the Shanghai Suburban Adult Cohort and Biobank for COPD screening.A questionnaire was used to obtain information on demographic characteristics and reproductive health indicators.Linear regression was used to analyze the effects of reproductive health indicators on forced vital capacity(FVC)and forced expiratory volume in the first second(FEV1).Logistic regression was also used to analyze the effects of reproductive health factors on FVC as a percentage of the predicted value(FVC%Pred)and FEV1%Pred as well as on COPD.Results A total of 1876 women aged 40 years and above were enrolled with mean age of(62.1±8.2)years old,among them,78.1%were menopausal,and 40.9%had been pregnant≥3 times.Multivariate analysis showed that FVC and FEV1 decreased in postmenopausal women,but menopause was not associated with a decrease in their percentage of predicted values.Pregnancies≥3 times was a risk factor for COPD(for 3 times,OR=4.92,95%CI:1.48-19.95,P<0.05;for≥4 times,OR=9.06,95%CI:2.32-41.57,P<0.01),while pregnancies of 2 times did not increase the risk of COPD.Conclusion In women aged 40 years and above,menopause is associated with poorer FVC and FEV1,and excessive pregnancy(≥3 times)is a risk factor for COPD.
8.Analysis of monitoring results of iodine deficiency disorders in Nanning City in 2020
Mifang LUO ; Xinjie ZHAN ; Feng LING ; Zhiqiang QU ; Xue LI ; Shulin WEI ; Shuqin DIAO
Chinese Journal of Endemiology 2023;42(12):963-968
Objective:To analyze the monitoring results of iodine deficiency disorders in Nanning City in 2020, learn about the consumption of iodized salt among residents and the iodine nutrition status of key populations, and provide scientific basis for formulating or adjusting targeted prevention and control measures of iodine deficiency disorders.Methods:According to the Guangxi Iodine Deficiency Disorders Monitoring Plan, monitoring was carried out in all of 12 districts (counties) in Nanning City. One township (street) was selected from each of the five directions of east, west, south, north, and central. Forty non-boarding children aged 8 to 10 and 20 pregnant women were selected as monitoring subjects in each township (street). Edible salt samples were collected from children and pregnant women to detect salt iodine content, random mid-course urine samples from children and morning urine samples from pregnant women were collected to detect urinary iodine content; in addition, thyroid examination of children was conducted in Qingxiu District, Liangqing District, Long an County and Shanglin County.Results:In 2020, a total of 2 434 children aged 8 to 10 and 1 207 pregnant women were surveyed in Nanning City. The coverage rate of iodized salt, the qualified rate of iodized salt and the qualified iodine salt consumption rate were 99.67%(3 629/3 641), 97.99%(3 556/3 629) and 97.67%(3 556/3 641), respectively. The median urinary iodine of children was 182.0 μg/L, and the median values ranged from 146.5 to 234.8 μg/L in different districts (counties), there were significant differences in median urinary iodine between urban and non-urban areas, different gender and age groups ( U = 2.38, 2.41, P = 0.017, 0.016; H = 16.42, P < 0.001). The goiter rate of children was 0.99%(8/807), and the rate ranged from 0 to 2.00% (4/200) in the 4 districts (counties) examined, there were significant differences in thyroid volume between urban and non-urban areas and different ages ( U = - 3.52, P < 0.001; H = 47.67, P < 0.001). The median urinary iodine of pregnant women was 191.0 μg/L. The median urinary iodine of different districts (counties) ranged from 141.0 to 241.5 μg/L, and the difference was statistically significant at different gestational stages ( H = 24.37, P < 0.001). Conclusion:In 2020, the coverage rate of iodized salt, the qualified rate of iodized salt and the qualified iodine salt consumption rate by residents in Nanning City are high, and the iodine nutrition of both children and pregnant women are at an appropriate level.
9.Dihydromyricetin improves Parkinson's disease-like lesions in T2DM rats by activating AMPK/ULK1 pathway.
Qi LI ; Nian CHEN ; Jin-Ding LUO ; Hui-Lin WU ; Zi-Han WANG ; Meng-Wei LI ; Shui-Dong FENG ; Hong-Yan LING
Acta Physiologica Sinica 2023;75(1):59-68
The purpose of this study was to explore the effect and mechanism of dihydromyricetin (DHM) on Parkinson's disease (PD)-like lesions in type 2 diabetes mellitus (T2DM) rats. The T2DM model was established by feeding Sprague Dawley (SD) rats with high-fat diet and intraperitoneal injection of streptozocin (STZ). The rats were intragastrically administered with DHM (125 or 250 mg/kg per day) for 24 weeks. The motor ability of the rats was measured by balance beam experiment, the changes of dopaminergic (DA) neurons and the expression of autophagy initiation related protein ULK1 in the midbrains of the rats were detected by immunohistochemistry, and the protein expression levels of α-synuclein (α-syn), tyrosine hydroxylase (TH), as well as AMPK activation level, in the midbrains of the rats were detected by Western blot. The results showed that, compared with normal control, the rats with long-term T2DM exhibited motor dysfunction, increased α-syn aggregation, down-regulated TH protein expression, decreased number of DA neurons, declined activation level of AMPK, and significantly down-regulated ULK1 expression in the midbrain. DHM (250 mg/kg per day) treatment for 24 weeks significantly improved the above PD-like lesions, increased AMPK activity, and up-regulated ULK1 protein expression in T2DM rats. These results suggest that DHM may improve PD-like lesions in T2DM rats by activating AMPK/ULK1 pathway.
Rats
;
Animals
;
Parkinson Disease
;
Rats, Sprague-Dawley
;
AMP-Activated Protein Kinases
;
Diabetes Mellitus, Type 2
;
Autophagy-Related Protein-1 Homolog
10.Birth weight of infants born to pregnant women living with human immunodeficiency virus and its associated factors
Jinli LIU ; Songjie WU ; Shi ZOU ; Ling FENG ; Yajun YAN ; Yuting TAN ; Fangzhao MING ; Mingqi LUO ; Ke LIANG
Chinese Journal of Infectious Diseases 2023;41(6):401-406
Objective:To investigate the birth weight (BW) of infants born to pregnant women living with human immunodeficiency virus (HIV) and its associated factors, and to provide more evidence for the prevention of mother-to-child transmission (PMTCT) in China.Methods:This study was a retrospective cohort study. Between January 2004 and December 2021, pregnant women living with HIV and their infants in Hubei Province were recruited and followed up, and clinical data were collected through hospital medical records and HIV/acquired immunodeficiency syndrome comprehensive response information management system. The multivariable linear regression was performed on the collected data to investigate associated influencing factors of BW.Results:In total, 531 pregnant women living with HIV (581 pregnancies) and 581 infants were enrolled. Of the 581 infants, 36 were HIV-positive, with a PMTCT rate of 6.2%. The mean BW of the infants was (3 075.0±470.2) gram. Protease inhibitor (PI) based-anti-retroviral therapy (ART) ( β=-0.1, 95% confidence interval ( CI)-188.2 to -37.1, P=0.004), ART in the first trimester( β=-0.1, 95% CI -201.9 to -65.5, P<0.001), infant HIV infection ( β=-0.1, 95% CI -310.4 to -68.2, P=0.002), hepatitis C virus infection ( β=0.1, 95% CI 71.2 to 410.4, P=0.005) and gestational age ( β=0.6, 95% CI 155.9 to 191.5, P<0.001) were associated with decreased BW. Conclusions:While improving the effectiveness of PMTCT for HIV, more attention should be paid to pregnant women who received ART in the first trimester and PI-based ART for preventing lower BW and improving maternal and infantile health.

Result Analysis
Print
Save
E-mail