OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Objective To investigate the effects of Simo decoction on duodenal microinflammation and NOD-like receptor thermal protein domain associated protein 3(NLRP3)/cysteinyl aspartate-specific proteinase-1(Caspase-1)/gasdermin D(GSDMD)signaling pathway in rats with functional dyspepsia(FD).Methods The FD model was established by multifactorial method.SD rats were randomly divided into normal group,model group(FD model),positive control group(gavage administration of 0.305 mg·kg-1 mosapride injection)and experimental-H,-M,-L groups(gavage administration of 5.62,2.81,1.40 g·kg-1 Simo decoction).Small intestinal advancement rate and gastric emptying rate was determined;the levels of interleukin(IL)-1 β and IL-18 in serum were determined by enzyme linked immunosorbent assay(ELISA);the protein expression of NLRP3 and GSDMD in duodenal tissue was detected by Western blotting.Results The gastric emptying rates of normal,model,positive control and experimental-H,-M,-Lgroupswere(58.34±5.72)％,(29.16±8.37)％,(48.77±6.10)％,(48.35±6.04)％,(48.20±3.49)％and(39.24±4.20)％;the small intestinal propulsion rates were(82.01±7.55)％,(41.95±9.53)％,(64.61±10.18)％,(75.04±9.76)％,(60.58±7.13)％and(45.89±7.40)％;serum IL-1 β expression were(12.86±0.88),(43.73±4.60),(18.84±0.86),(24.61±1.57),(19.14±0.77)and(29.04±0.72)pg·mL-1;IL-18 expressions were(95.00±3.74),(170.60±8.78),(108.50±3.05),(118.90±3.45),(99.90±8.70)and(141.00±3.71)pg·mL-1;the relative expression levels of NLRP3 proteins were 0.32±0.02,0.84±0.05,0.42±0.03,0.48±0.02,0.61±0.04 and 0.62±0.05;the relative expression levels of GSDMD proteins were 0.34±0.05,0.93±0.06,0.35±0.03,0.52±0.02,0.53±0.06 and 0.55±0.05,respectively.Compared with the normal group,the above indexes in the model group have statistical significance;compared with the model group,the above indexes in the experimental-H group and the positive control group also have statistical significance(P＜0.01 or P＜0.05).Conclusion Simo decoction can effectively improve the general condition and duodenal microinflammation in FD rats,and the mechanism may be related to the inhibition of duodenal NLRP3/Caspase-1/GSDMD signaling pathway.

The statement of"qi transformation leading to the removal of pathogenic dampness"was recorded in Wen Bing Tiao Bian(Analysis on Epidemic Febrile Diseases)written by the Qing Dynasty physician WU Ju-Tong.Dampness in the triple energizer is caused by the dysfunction of qi transformation,and the treatment of dampness must be based on the activation of qi movement and focused on the promotion of qi movement and the restoration of the qi transformation in the triple energizer.For the treatment of dampness attack in the upper energizer,therapies of dispersing lung to smooth qi and resolving dampness to relieve the obstruction are recommended.For the treatment of dampness obstruction in the middle energizer,therapy of activating spleen qi by strengthening spleen and moving qi is stressed for helping the removal of dampness and for the eradication of the source of dampness.For the treatment of dampness stagnation in the lower energizer,therapy of draining dampness with sweet-light medicines and activating yang can be used according to the illness status.The three methods of treating dampness,namely dispersing the upper energizer,activating the middle energizer and draining the lower energizer,all embody the mechanism of"qi transformation leading to the removal of pathogenic dampness",and the therapies of dispersing lung with light medicines,inducing perspiration by opening striated layer,eliminating dampness with aromatics and draining dampness with sweet-light medicines should be used in accordance with the syndromes.The elucidation of the academic thoughts of"qi transformation leading to the removal of pathogenic dampness"can provide theoretical reference for the fundamental research of dampness syndrome and clinical application of therapies for resolving dampness in Chinese medicine.

Objective To investigate anxious and depressive emotions in patients underwent cervical cancer surgery and to analyze its influencing factors.Methods A total of 304 patients who underwent primary cervical cancer surgery in Obstetrics and Gynecology Hospital,Fudan University from Oct 2018 to Jun 2021,were recruited to evaluate the clinical effect based on cervical cancer-patient reported outcome 137 scale(CC-PRO137 scale).This study focused on dimensions of depressive and anxious emotions within this scale and explored their influencing factors.Results The average scores of their depressive and anxious emotions within half a year after surgery were 4.141±0.798 and 4.020±0.616,respectively;and the average scores of depressive and anxious emotions more than one year after surgery were 4.250±0.802 and 4.097±0.613,respectively.By using statistical methods including analysis of variance and t test,it was found that there were statistically significant differences in the scores of depression and anxiety among cervical cancer patients under different postoperative adjuvant treatments and at different postoperative time points(P<0.05).However,there were no statistically significant differences in the scores of depression and anxiety among patients with different ages,surgical methods,and clinical stages of cervical cancer(P>0.05).Conclusion Patients underwent cervical cancer surgery may suffer varying degree of depressive and anxious emotions,and the main influencing factors are different adjuvant treatments and the length of time for postsurgical recovery.Medical practitioners should strengthen comfort and care for patients with cervical cancer,especially those who receive chemotherapy and radiotherapy treatments and are in the primary stage after the surgery.Formulating positive intervention measures can effectively reduce the psychological pain of patients and safeguard their physical and mental health.

Objective To investigate the associations of reproductive health indicators with lung function and chronic obstructive pulmonary disease(COPD)among women aged 40 years and above.Methods From Jul to Sep,2021,female subjects aged 40 years and above were randomly selected from the Shanghai Suburban Adult Cohort and Biobank for COPD screening.A questionnaire was used to obtain information on demographic characteristics and reproductive health indicators.Linear regression was used to analyze the effects of reproductive health indicators on forced vital capacity(FVC)and forced expiratory volume in the first second(FEV1).Logistic regression was also used to analyze the effects of reproductive health factors on FVC as a percentage of the predicted value(FVC%Pred)and FEV1%Pred as well as on COPD.Results A total of 1876 women aged 40 years and above were enrolled with mean age of(62.1±8.2)years old,among them,78.1%were menopausal,and 40.9%had been pregnant≥3 times.Multivariate analysis showed that FVC and FEV1 decreased in postmenopausal women,but menopause was not associated with a decrease in their percentage of predicted values.Pregnancies≥3 times was a risk factor for COPD(for 3 times,OR=4.92,95%CI:1.48-19.95,P<0.05;for≥4 times,OR=9.06,95%CI:2.32-41.57,P<0.01),while pregnancies of 2 times did not increase the risk of COPD.Conclusion In women aged 40 years and above,menopause is associated with poorer FVC and FEV1,and excessive pregnancy(≥3 times)is a risk factor for COPD.

The statement of heavy dampness leading to watery diarrhea was recorded in Huang Di Nei Jing(The Yellow Emperor's Inner Classic),which is not only an interpretation of the pathogenesis of diarrhea,but also one of the important principles to guide the clinical treatment of diarrhea in traditional Chinese medicine.The watery diarrhea can be caused by the invasion of external dampness,or results from the retention and accumulation of internal dampness.The combination of internal dampness and external dampness causes internal injury of spleen yang,and then the spleen yang is inactivated,which eventually results in diarrhea.Based on the pathogenesis of spleen yang inactivation and water-dampness retention and accumulation in heavy dampness leading to watery diarrhea,the therapeutic principle of warming and activating spleen yang should be performed.Modern Chinese medicine clinical practice and related mechanism research showed that the therapy of warming and activating spleen yang was closely related to the mitochondrial function in modern western medicine.The mechanism Linggui Zhugan Decoction and Fuzi Lizhong Decoction in relieving watery diarrhea by warming and activating spleen yang is related to the improvement of the energy metabolism disorder in the mitochondrion;the mechanism of Shengyang Yiwei Decoction and Shengyang Chushi Decoction in relieving watery diarrhea by raising yang and eliminating dampness is related to the improvement of mitochondrial damage in the inflammatory state;the mechanism of Xiao Jianzhong Decoction and Lizhong Decoction in relieving watery diarrhea by activating spleen is related to the improvement of mitochondrial oxidative damage.The exploration of the pathogenesis of heavy dampness leading to watery diarrhea and the modern mechanism of therapy of warming and activating spleen yang will provide reference for the study of the etiology and pathogenesis of pathogenic dampness and the dampness syndrome,and can provide reference for the prevention and treatment of diarrhea patients in the humid climate environment such as in Lingnan area and the middle and lower reaches of the Yangtze River and under the combined influence of improper dietary structure in modern society.

Over the past half-century,the climate change,along with population growth,worsens the intensity and frequency of sand storms in China,and the environmental and health problems have become increasingly prominent.Sand and dust particles not only possess their own toxicity but also carry numerous pathogenic microorganisms and heavy metals.This can lead to high concentrations of local dust pollution,causing significant harm to the air environment and the health of residents in downwind areas during long-distance transportation sand and dust.Based on a comprehensive literature review on the health effects of dust storms,this paper aims to summarize the impact of various pathogenic factors presenting in dust storms on human health and the underlying mechanisms to provide a scientific foundation for the development of more effective control measures.In the future,amidst the backdrop of climate change,it is crucial to prioritize the research and analysis of dust source regions and dust control strategies in northern China.Additionally,there is a need to enhance the technology for simulating sand and dust environments in experiments,and to adopt a multidisciplinary approach to investigate the medical and toxicological aspects of sand and dust weather.

Objective:To analyze the monitoring results of iodine deficiency disorders in Nanning City in 2020, learn about the consumption of iodized salt among residents and the iodine nutrition status of key populations, and provide scientific basis for formulating or adjusting targeted prevention and control measures of iodine deficiency disorders.Methods:According to the Guangxi Iodine Deficiency Disorders Monitoring Plan, monitoring was carried out in all of 12 districts (counties) in Nanning City. One township (street) was selected from each of the five directions of east, west, south, north, and central. Forty non-boarding children aged 8 to 10 and 20 pregnant women were selected as monitoring subjects in each township (street). Edible salt samples were collected from children and pregnant women to detect salt iodine content, random mid-course urine samples from children and morning urine samples from pregnant women were collected to detect urinary iodine content; in addition, thyroid examination of children was conducted in Qingxiu District, Liangqing District, Long an County and Shanglin County.Results:In 2020, a total of 2 434 children aged 8 to 10 and 1 207 pregnant women were surveyed in Nanning City. The coverage rate of iodized salt, the qualified rate of iodized salt and the qualified iodine salt consumption rate were 99.67%(3 629/3 641), 97.99%(3 556/3 629) and 97.67%(3 556/3 641), respectively. The median urinary iodine of children was 182.0 μg/L, and the median values ranged from 146.5 to 234.8 μg/L in different districts (counties), there were significant differences in median urinary iodine between urban and non-urban areas, different gender and age groups ( U = 2.38, 2.41, P = 0.017, 0.016; H = 16.42, P < 0.001). The goiter rate of children was 0.99%(8/807), and the rate ranged from 0 to 2.00% (4/200) in the 4 districts (counties) examined, there were significant differences in thyroid volume between urban and non-urban areas and different ages ( U = - 3.52, P < 0.001; H = 47.67, P < 0.001). The median urinary iodine of pregnant women was 191.0 μg/L. The median urinary iodine of different districts (counties) ranged from 141.0 to 241.5 μg/L, and the difference was statistically significant at different gestational stages ( H = 24.37, P < 0.001). Conclusion:In 2020, the coverage rate of iodized salt, the qualified rate of iodized salt and the qualified iodine salt consumption rate by residents in Nanning City are high, and the iodine nutrition of both children and pregnant women are at an appropriate level.

Objective: To understand the current status of diagnosis and treatment of chronic lymphocytic leukemia (CLL) /small lymphocytic lymphoma (SLL) among hematologists, oncologists, and lymphoma physicians from hospitals of different levels in China. Methods: This multicenter questionnaire survey was conducted from March 2021 to July 2021 and included 1,000 eligible physicians. A combination of face-to-face interviews and online questionnaire surveys was used. A standardized questionnaire regarding the composition of patients treated for CLL/SLL, disease diagnosis and prognosis evaluation, concomitant diseases, organ function evaluation, treatment selection, and Bruton tyrosine kinase (BTK) inhibitor was used. Results: ①The interviewed physicians stated that the proportion of male patients treated for CLL/SLL is higher than that of females, and the age is mainly concentrated in 61-70 years old. ②Most of the interviewed physicians conducted tests, such as bone marrow biopsies and immunohistochemistry, for patient diagnosis, in addition to the blood test. ③Only 13.7% of the interviewed physicians fully grasped the initial treatment indications recommended by the existing guidelines. ④In terms of cognition of high-risk prognostic factors, physicians' knowledge of unmutated immunoglobulin heavy-chain variable and 11q- is far inferior to that of TP53 mutation and complex karyotype, which are two high-risk prognostic factors, and only 17.1% of the interviewed physicians fully mastered CLL International Prognostic Index scoring system. ⑤Among the first-line treatment strategy, BTK inhibitors are used for different types of patients, and physicians have formed a certain understanding that BTK inhibitors should be preferentially used in patients with high-risk factors and elderly patients, but the actual use of BTK inhibitors in different types of patients is not high (31.6%-46.0%). ⑥BTK inhibitors at a reduced dose in actual clinical treatment were used by 69.0% of the physicians, and 66.8% of the physicians had interrupted the BTK inhibitor for >12 days in actual clinical treatment. The use of BTK inhibitors is reduced or interrupted mainly because of adverse reactions, such as atrial fibrillation, severe bone marrow suppression, hemorrhage, and pulmonary infection, as well as patients' payment capacity and effective disease progression control. ⑦Some differences were found in the perceptions and behaviors of hematologists and oncologists regarding the prognostic assessment of CLL/SLL, the choice of treatment options, the clinical use of BTK inhibitors, etc. Conclusion: At present, a gap remains between the diagnosis and treatment of CLL/SLL among Chinese physicians compared with the recommendations in the guidelines regarding the diagnostic criteria, treatment indications, prognosis assessment, accompanying disease assessment, treatment strategy selection, and rational BTK inhibitor use, especially the proportion of dose reduction or BTK inhibitor discontinuation due to high adverse events.
Female ; Humans ; Male ; Aged ; Middle Aged ; Leukemia, Lymphocytic, Chronic, B-Cell/drug therapy* ; Prognosis ; Lymphoma, B-Cell ; Immunohistochemistry ; Immunoglobulin Heavy Chains/therapeutic use*

Abstract: Objective　To investigate a poisoning incident caused by eating eight treasure congee, and establish liquid chromatography (LC)-mass spectrometry (MS)/MS screening method of 28 alkaloids to provide references for disposal of similar poisoning incidents. Methods　LC-MS/MS was used for screening 28 alkaloids in the urine, eight treasure congee and food raw material, and the detected alkaloids were quantified. Samples were extracted with 0.4% formic acid aqueous solution and separated by a Acquity UPLC BEH C18 column (1.7 μm, 100 × 2.1 mm). Acetonitrile-0.2% formic acid aqueous solution was used as the mobile phase and gradient elution was adopted. The ionization mode was electrospray positive ionization mode, and the detection method was multi-reaction monitoring (MRM). Analytes were quantified with the external standard method. Results　In the concentration range of 0-100 ng/mL, the linear correlation coefficient r were greater than 0.999 for 28 alkaloids. The recovery of 28 alkaloids in urine sample ranged from 63.0% to 105.0%, and the relative standard deviations (RSDs) were between 5.8% and 8.6%. The recovery of 28 alkaloids in eight treasure congee sample ranged from 72.0% to 109.0%, and the RSDs were between 6.3% and 9.7%. The recovery of 28 alkaloids in semen sesami nigrum sample ranged from 60.0% to 95.0%, and the RSDs were between 4.8% and 8.2%. Hyoscyamine (2 380.0 ng/mL), scopliamine (3.6 ng/mL) and rac-anisodamine (4.7 ng/mL) were detected in the patient's urine. Hyoscyamine (63.3 μg/g), scopliamine (5.7 μg/g) and rac-anisodamine (2.1 μg/g) were detected in eight treasure congee. Hyoscyamine (901.0 μg/g), scopliamine (80.0 μg/g) and rac-anisodamine (30.1 μg/g) were detected in the seed of Datura stramonium L. The ratio of scopliamine and hyoscyamine in the seed of D. stramonium was 1∶11, which complies with the characteristics of D. stramonium L. In urine sample, the proportion of scopliamine and rac-anisodamine was 0.15% and 0.20%, and hyoscyamine accounted for 99.65%. Conclusion　Seed morphology, the content range and proportion of three alkaloids are all in accord with the characteristics of D. stramonium. Combined with the clinical symptoms of atropine poisoning, it can be deduced that this incident is a family food poisoning caused by accidental consumption of seed of D. stramonium L. The method can provide technical support for the clinical diagnosis and treatment of alkaloid poisoning patients, and also provide a basis for emergency detection and disposal of alkaloid poisoning events.