BACKGROUND:Nanocell vesicles possess functions such as re-epithelialization,antioxidation,anti-inflammation,and regulation of extracellular matrix remodeling.Meanwhile,apoptotic bodies have the immunomodulatory effects.Therefore,the combination of the two to form nanofusion vesicles can synergistically promote the healing of diabetic skin wounds.OBJECTIVE:To elucidate the impact of nanofusion vesicles on skin wound healing in a diabetic murine model.METHODS:(1)Material preparation and characterization:The primary bone marrow mesenchymal stem cells of C57BL/6J neonatal mice and the neutrophil apoptotic bodies of C57BL/6J mice were isolated and extracted.The nanofusion vesicles were prepared by micro-extrusion mechanism.(2)In vitro experiment:MTT assay was used to detect the proliferative effect of different concentrations of nanofusion vesicles on NIH-3T3 cells and human umbilical vein endothelial cells.Reactive oxygen species fluorescence probe was used to detect the antioxidant effect of nano-fusion vesicles on NIH-3T3 cells treated with hydrogen peroxide(H2O2).The inhibitory effect of nanofusion vesicles on RAW 264.7 macrophage inflammation induced by lipopolyside was detected by real-time quantitative RT-qPCR.(3)In vivo experiment:36 male C57BL/6J mice were employed to develop a murine model of diabetes mellitus.Following the successful induction of diabetes,two circular full-thickness wounds,each with a diameter of 6 mm,were created on either side of the diabetic mice's spine using a skin punch.The mice were divided into three groups by random number table method.The control group was injected with 0.1 mL of phosphate buffer solution.The nanovesicle group was injected with 0.1 mL nanovesicles(25 μg/mL).The nanofusion vesicle group was injected with 0.1 mL nanofusion(25 μg/mL)vesicles.After treatment for three consecutive days,the wound healing and histomorphological changes were observed.RESULTS AND CONCLUSION:(1)In vitro experiment:nanofusion vesicles,when administered at concentrations ranging from 0 to 100 μg/mL,exhibited no toxic effects and promoted the proliferation of NIH-3T3 and HUVEC cell lines.Notably,a concentration of 25 μg/mL nanofusion vesicle significantly enhanced the proliferation of NIH-3T3 cells.Furthermore,the survival rate of human umbilical vein endothelial cells was observed to increase in correlation with escalating concentrations of nanofusion vesicles.Nanofusion vesicles had a good antioxidant effect.In comparison to the H2O2 group,the fluorescence signal indicative of reactive oxygen species was progressively diminished in both the nanovesicle group and the nanofusion vesicle group.Furthermore,nanofusion vesicles possessed anti-inflammatory capabilities,effectively mitigating the inflammatory response in macrophages triggered by lipopolysaccharide stimulation.(2)In vivo experiment:Hematoxylin-eosin and Masson's trichrome staining revealed that in comparison to the control group,both the nanovesicle group and the nanofusion vesicle group exhibited a significant increase in granulation tissue formation and collagen fiber deposition within the wounds by day 6.Notably,the nanofusion vesicle group displayed the most pronounced effects.On day 12,the wound of nanofusion vesicle group was significantly reduced,and the healing rate was significantly faster than that of other groups(P＜0.01),and the effect of promoting wound healing was the most significant.Our findings demonstrated that nanofusion vesicles exhibited superior pro-cell proliferative,antioxidant,and anti-inflammatory properties,thereby exerting a beneficial effect on the promotion of skin wound healing in diabetic mouse models.

BACKGROUND:Nanocell vesicles possess functions such as re-epithelialization,antioxidation,anti-inflammation,and regulation of extracellular matrix remodeling.Meanwhile,apoptotic bodies have the immunomodulatory effects.Therefore,the combination of the two to form nanofusion vesicles can synergistically promote the healing of diabetic skin wounds.OBJECTIVE:To elucidate the impact of nanofusion vesicles on skin wound healing in a diabetic murine model.METHODS:(1)Material preparation and characterization:The primary bone marrow mesenchymal stem cells of C57BL/6J neonatal mice and the neutrophil apoptotic bodies of C57BL/6J mice were isolated and extracted.The nanofusion vesicles were prepared by micro-extrusion mechanism.(2)In vitro experiment:MTT assay was used to detect the proliferative effect of different concentrations of nanofusion vesicles on NIH-3T3 cells and human umbilical vein endothelial cells.Reactive oxygen species fluorescence probe was used to detect the antioxidant effect of nano-fusion vesicles on NIH-3T3 cells treated with hydrogen peroxide(H2O2).The inhibitory effect of nanofusion vesicles on RAW 264.7 macrophage inflammation induced by lipopolyside was detected by real-time quantitative RT-qPCR.(3)In vivo experiment:36 male C57BL/6J mice were employed to develop a murine model of diabetes mellitus.Following the successful induction of diabetes,two circular full-thickness wounds,each with a diameter of 6 mm,were created on either side of the diabetic mice's spine using a skin punch.The mice were divided into three groups by random number table method.The control group was injected with 0.1 mL of phosphate buffer solution.The nanovesicle group was injected with 0.1 mL nanovesicles(25 μg/mL).The nanofusion vesicle group was injected with 0.1 mL nanofusion(25 μg/mL)vesicles.After treatment for three consecutive days,the wound healing and histomorphological changes were observed.RESULTS AND CONCLUSION:(1)In vitro experiment:nanofusion vesicles,when administered at concentrations ranging from 0 to 100 μg/mL,exhibited no toxic effects and promoted the proliferation of NIH-3T3 and HUVEC cell lines.Notably,a concentration of 25 μg/mL nanofusion vesicle significantly enhanced the proliferation of NIH-3T3 cells.Furthermore,the survival rate of human umbilical vein endothelial cells was observed to increase in correlation with escalating concentrations of nanofusion vesicles.Nanofusion vesicles had a good antioxidant effect.In comparison to the H2O2 group,the fluorescence signal indicative of reactive oxygen species was progressively diminished in both the nanovesicle group and the nanofusion vesicle group.Furthermore,nanofusion vesicles possessed anti-inflammatory capabilities,effectively mitigating the inflammatory response in macrophages triggered by lipopolysaccharide stimulation.(2)In vivo experiment:Hematoxylin-eosin and Masson's trichrome staining revealed that in comparison to the control group,both the nanovesicle group and the nanofusion vesicle group exhibited a significant increase in granulation tissue formation and collagen fiber deposition within the wounds by day 6.Notably,the nanofusion vesicle group displayed the most pronounced effects.On day 12,the wound of nanofusion vesicle group was significantly reduced,and the healing rate was significantly faster than that of other groups(P＜0.01),and the effect of promoting wound healing was the most significant.Our findings demonstrated that nanofusion vesicles exhibited superior pro-cell proliferative,antioxidant,and anti-inflammatory properties,thereby exerting a beneficial effect on the promotion of skin wound healing in diabetic mouse models.

This study explores whether the current external quality assessment (EQA) level and acceptable bias for basic semen analysis in China are clinically useful. We collected data of semen EQA from Andrology laboratories in the Hunan Province (China) in 2022 and searched for data in the published literature from January 2000 to December 2023 in China. On the basis of these data, we analyzed the coefficients of variation and acceptable biases of different quality control materials for basic semen analysis through robust statistics. We compared these findings with quality specifications based on biological variation from optimal, desirable, and minimum levels of bias to seek a unified and more suitable semen EQA bias evaluation standard for China's national conditions. Different sources of semen quality control material exhibited considerable variation in acceptable biases among laboratories, ranging from 8.2% to 56.9%. A total of 50.0% of the laboratories met the minimum quality specifications for progressive motility (PR), whereas 100.0% and 75.0% of laboratories met only the minimum quality specifications for sperm concentration and total motility (nonprogressive [NP] + PR), respectively. The Z value for sperm concentration and PR+NP was equivalent to the desirable performance specification, whereas the Z value for PR was equivalent only to the minimum performance specification. This study highlights the feasibility of operating external quality assessment schemes for basic semen analysis using quality specifications based on biological variation. These specifications should be unified among external quality control (EQC) centers based on biological variation.
Semen Analysis/standards* ; Humans ; China ; Male ; Quality Control ; Sperm Motility ; Sperm Count/standards*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To evaluate the efficacy of molecular targeted agents in children with progressive pediatric low-grade gliomas (pLGG). METHODS: A retrospective analysis was conducted on pLGG patients treated with oral targeted therapies at the Department of Pediatrics, Beijing Shijitan Hospital, Capital Medical University, from July 2021. Treatment responses and safety profiles were assessed. RESULTS: Among the 20 enrolled patients, the trametinib group (n=12, including 11 cases with BRAF fusions and 1 case with BRAF V600E mutation) demonstrated 4 partial responses (33%) and 2 minor responses (17%), with a median time to response of 3.0 months. In the vemurafenib group (n=6, all with BRAF V600E mutation), 5 patients achieved partial responses (83%), showing a median time to response of 1.0 month. Comparative analysis revealed no statistically significant difference in progression-free survival rates between the two treatment groups (P>0.05). The median duration of clinical benefit (defined as partial response + minor response + stable disease) was 11.0 months for vemurafenib and 18.0 months for trametinib. Two additional cases, one with ATM mutation treated with olaparib for 24 months and one with NF1 mutation receiving everolimus for 21 months, discontinued treatment due to sustained disease stability. No severe adverse events were observed in any treatment group. CONCLUSIONS Molecular targeted therapy demonstrates clinical efficacy with favorable tolerability in pLGG. Vemurafenib achieves high response rates and induces early tumor shrinkage in patients with BRAF V600E mutations, supporting its utility as a first-line therapy.
Humans ; Glioma/genetics* ; Male ; Female ; Child ; Child, Preschool ; Retrospective Studies ; Brain Neoplasms/genetics* ; Molecular Targeted Therapy/adverse effects* ; Adolescent ; Infant ; Proto-Oncogene Proteins B-raf/genetics* ; Pyrimidinones/therapeutic use* ; Mutation

BACKGROUND: It remains unclear whether sleep duration and physical activity (PA) trajectories in middle-aged and older adults are associated with different risks of cardiovascular diseases (CVDs). This study aimed to explore the trajectories of total sleep duration and PA among middle-aged and older Chinese adults and their impact on CVD risk. METHODS: This study was based on the China Health and Retirement Longitudinal Study. 12009 adults aged 45 years and older from five waves were included. CVD events were measured by self-reports of heart disease and stroke. We first used group-based trajectory modeling to identify total sleep duration and PA trajectories from 2011 to 2020, and then employed logistic regression models to analyze their risk for CVD. RESULTS: We identified three sleep duration and PA trajectories. The risk of heart disease increased by 33% (OR = 1.31, 95% CI: 1.12-1.53) for the short sleep duration trajectory (vs. moderate sleep duration trajectory), by 40% (OR = 1.40, 95% CI: 1.06-1.84) for the high decreasing PA trajectory, and by 20% (OR = 1.20, 95% CI: 1.01-1.42) for the low stable PA trajectory (vs. high stable PA trajectory), respectively. Similar results for stroke and CVD as the outcomes were also observed, but the higher risk of stroke in the high decreasing PA trajectory group was not statistically significant. The joint effects of sleep and PA showed lower risks of heart disease and stroke in trajectories with moderate or long sleep duration and high stable PA compared with short sleep duration and a low stable PA trajectory. CONCLUSIONS Short total sleep duration, high decreasing PA, and low stable PA trajectories could increase the risk of CVDs among middle-aged and older adults. Long-term moderate to long total sleep durations and high stable PA trajectories might be optimal for preventing CVDs.

Objective To explore the mechanism of action of jolkinolide B in the treatment of gastric cancer by network pharmacology combined with molecular docking technique.Methods The SwissTargetPrediction database was used to obtain the targets of the active compounds.Search Genecards,OMIM,Drugbank,TTD,and PharmGKB databases to obtain targets for gastric cancer.The intersection between the targets of jolkinolide B and those of gastric cancer was identified pinpoint potential targets for jolkinolide B in treating gastric cancer.The String database was utilized construct a protein-protein interaction(PPI)network.Bioconductor bioinformatics packages with R software was employed conduct Gene Ontology(GO)functional enrichment analysis and Kyoto Encyclopedia of Genes and Genomes(KEGG)pathway enrichment analysis on the shared targets.This process revealed significant regulatory pathways crucial for jolkinolide B's efficacy in treating gastric cancer.Cytoscape 3.7.1 software was utilized create the core network of"Potential Targets of Triptolide B in Gastric Cancer Treatment",and SYBYL-X2.1.1 software was employed conduct molecular docking validation of the selected main active ingredients and critical targets.Results Jolkinolide B may target multiple proteins,including MAPK1,glycogen synthase kinae-3β(GSK-3β),and JUN,impacting the proliferation,invasion,and metastasis of gastric cancer,ultimately inhibiting its growth.Conclusion We predicted the possible molecular mechanism of jolkinolide B in the treatment of gastric cancer to provide guide information for the subsequent experimental research and clinical application.

Objective To investigate the expressions of annexin A2 and glycogen synthesis kinase-3β(GSK-3β)in cutaneous squamous cell carcinoma(CSCC)tissues,and to analyze their correlation with CSCC as well as their clinical pathological diagnostic value.Methods The pathological tissues of 68 patients with CSCC and 40 patients with keratoacanthoma(KA)who underwent surgical treatment in the Department of Dermatology of the Second Hospital of Nanning from October 2020 to May 2024 were collected,and the surrounding normal skin tissues of 32 patients with benign skin diseases were used as controls.The expressions of annexin A2,GSK-3β and β-catenin were detected by immunohistochemistry and Western blotting.Spearman was used to evaluate the correlation between the expressions of annexin A2 and GSK-3β and the pathological characteristics in CSCC.The receiver operating characteristic(ROC)curve was drawn to analyze the clinical diagnostic value of annexin A2 and GSK-3β in CSCC.Results Compared with the normal skin tissues,the expressions of annexin A2 and β-catenin in CSCC increased,and GSK-3β decreased(P＜0.05);Compared with the KA tissues,the expression of annexin A2 in CSCC tissues increased(P＜0.05).The expression of annexin A2 was negatively correlated with that of GSK-3β in CSCC(r=-0.3901,P＜0.01).GSK-3β expression was related to tissue differentiation,with lower expression in poorly differentiated patients'cancer tissues(P＜0.05).The sensitivity of annexin A2 and GSK-3β for diagnosis of CSCC was 85.3%and 41.2%,respectively,with specificities of 46.9%and 84.4%respectively.The sensitivity of annexin A2 for distinguishing between CSCC and KA was 85.3%,with a specificity of 40.0%.Conclusion Annexin A2 and GSK-3β may be used as potential biomarkers for the early diagnosis or differential diagnosis of CSCC,and play important roles in the development of CSCC.Their mechanism may be related to the activation of Wnt/β-catenin signaling pathway.

This article reports a first case of combined infection with severe fever with thrombocytopenia syndrome(SFTS)and scrub typhus in Dalian City.The patient was admitted to the hospital due to recurrent fever for 7 days and loss of consciousness for 1 day.Pathogen metagenomic sequencing(mNGS),SFTSV quantitative PCR,and enzyme-linked immunosorbent assay(ELISA)IgM tests were performed,showing positive results for Orientia tsutsugamushi and SFTSV nucleic acids.Based on clinical manifestations and epidemiological history,the patient was diagnosed with combined infections.

Background: The genetic basis for hyperglycaemia in pregnancy remain unclear. This study aimed to uncover the genetic determinants of gestational diabetes mellitus (GDM) and investigate their applications. Methods: We performed a meta-analysis of genome-wide association studies (GWAS) for GDM in Chinese women (464 cases and 1,217 controls), followed by de novo replications in an independent Chinese cohort (564 cases and 572 controls) and in silico replication in European (12,332 cases and 131,109 controls) and multi-ethnic populations (5,485 cases and 347,856 controls). A polygenic risk score (PRS) was derived based on the identified variants. Results: Using the genome-wide scan and candidate gene approaches, we identified four susceptibility loci for GDM. These included three previously reported loci for GDM and type 2 diabetes mellitus (T2DM) at MTNR1B (rs7945617, odds ratio [OR], 1.64; 95% confidence interval [CI],1.38 to 1.96]), CDKAL1 (rs7754840, OR, 1.33; 95% CI, 1.13 to 1.58), and INS-IGF2-KCNQ1 (rs2237897, OR, 1.48; 95% CI, 1.23 to 1.79), as well as a novel genome-wide significant locus near TBR1-SLC4A10 (rs117781972, OR, 2.05; 95% CI, 1.61 to 2.62; Pmeta=7.6×10-9), which has not been previously reported in GWAS for T2DM or glycaemic traits. Moreover, we found that women with a high PRS (top quintile) had over threefold (95% CI, 2.30 to 4.09; Pmeta=3.1×10-14) and 71% (95% CI, 1.08 to 2.71; P=0.0220) higher risk for GDM and abnormal glucose tolerance post-pregnancy, respectively, compared to other individuals. Conclusion Our results indicate that the genetic architecture of glucose metabolism exhibits both similarities and differences between the pregnant and non-pregnant states. Integrating genetic information can facilitate identification of pregnant women at a higher risk of developing GDM or later diabetes.