T7 RNA polymerase (T7 RNAP) is one of the simplest known RNA polymerases. Its unique structural features make it a critical model for studying the mechanisms of RNA synthesis. This review systematically examines the static crystal structure of T7 RNAP, beginning with an in-depth examination of its characteristic “thumb”, “palm”, and “finger” domains, which form the classic “right-hand-like” architecture. By detailing these structural elements, this review establishes a foundation for understanding the overall organization of T7 RNAP. This review systematically maps the functional roles of secondary structural elements and their subdomains in transcriptional catalysis, progressively elucidating the fundamental relationships between structure and function. Further, the intrinsic flexibility of T7 RNAP and its applications in research are also discussed. Additionally, the review presents the structural diagrams of the enzyme at different stages of the transcription process, and through these diagrams, it provides a detailed description of the complete transcription process of T7 RNAP. By integrating structural dynamics and kinetics analyses, the review constructs a comprehensive framework that bridges static structure to dynamic processes. Despite its advantages, T7 RNAP has a notable limitation: it generates double-stranded RNA (dsRNA) as a byproduct. The presence of dsRNA not only compromises the purity of mRNA products but also elicits nonspecific immune responses, which pose significant challenges for biotechnological and therapeutic applications. The review provides a detailed exploration of the mechanisms underlying dsRNA formation during T7 RNAP catalysis, reviews current strategies to mitigate this issue, and highlights recent progress in the field. A key focus is the semi-rational design of T7 RNAP mutants engineered to minimize dsRNA generation and enhance catalytic performance. Beyond its role in transcription, T7 RNAP exhibits rapid development and extensive application in fields, including gene editing, biosensing, and mRNA vaccines. This review systematically examines the structure-function relationships of T7 RNAP, elucidates the mechanisms of dsRNA formation, and discusses engineering strategies to optimize its performance. It further explores the engineering optimization and functional expansion of T7 RNAP. Furthermore, this review also addresses the pressing issues that currently need resolution, discusses the major challenges in the practical application of T7 RNAP, and provides an outlook on potential future research directions. In summary, this review provides a comprehensive analysis of T7 RNAP, ranging from its structural architecture to cutting-edge applications. We systematically examine: (1) the characteristic right-hand domains (thumb, palm, fingers) that define its minimalistic structure; (2) the structure-function relationships underlying transcriptional catalysis; and (3) the dynamic transitions during the complete transcription cycle. While highlighting T7 RNAP’s versatility in gene editing, biosensing, and mRNA vaccine production, we critically address its major limitation—dsRNA byproduct formation—and evaluate engineering solutions including semi-rationally designed mutants. By synthesizing current knowledge and identifying key challenges, this work aims to provide novel insights for the development and application of T7 RNAP and to foster further thought and progress in related fields.

Objective: To investigate trends of incidence, mortality, and years of life lost (YLL) rate of lung cancer in cancer registration areas of Guizhou Province from 2017 to 2021, so as to provide references for formulating lung cancer prevention and control strategies and reducing the disease burden of lung cancer. Methods: The qualified lung cancer registration data from cancer registration areas of Guizhou Province from 2017 to 2021 were collected, the crude incidence and mortality of lung cancer were calculated by urban/rural areas, genders and ages. The standardized incidence and standardized mortality was calculated using the age structure of the standard population from the Fifth National Population Census in 2000. YLL was calculated using the standard life table from the Global Burden of Disease Study 2019. The disease burden of lung cancer was assessed using incidence, mortality, and YLL rate, and the trend in the disease burden of lung cancer from 2017 to 2021 was calculated using annual percent change (APC). Results : From 2017 to 2021, the crude incidence, standardized incidence, crude mortality, standardized mortality, YLL and YLL rate in Guizhou Province were 53.13/100 000, 37.58/100 000, 42.77/100 000, 29.44/100 000, 98.19 thousand person-years and 10.95‰, respectively. The standardized incidence and standardized mortality of lung cancer were higher in rural areas than in urban areas (39.45/100 000 vs. 34.23/100 000, 30.68/100 000 vs. 27.18/100 000). The standardized incidence and standardized mortality of lung cancer were higher in males than in females (49.34/100 000 vs. 26.47/100 000, 41.31/100 000 vs. 18.28/100 000). The crude incidence and crude mortality of lung cancer increased with age, peaking in the 80-<85 age group (360.84/100 000) and the ≥85 age group (414.85/100 000), respectively. From 2017 to 2021, the standardized incidence demonstrated downward trends in the total population, urban areas and males (APC=-6.590%, -5.829%, and -6.729%, all P<0.05). The standardized mortality demonstrated downward trends in urban areas and females (APC=-3.710% and -5.378%, both P<0.05). The YLL rate also showed downward trends in urban areas and females (APC=-3.957% and -3.631%, both P<0.05). Conclusions From 2017 to 2021, the overall disease burden of lung cancer in registration areas of Guizhou Province showed a decreasing trend. However, the disease burden remained relatively heavier in rural areas and males, with a relatively gradual change.

BACKGROUND: Spicy food consumption has been reported to be inversely associated with mortality from multiple diseases. However, the effect of spicy food intake on the incidence of vascular diseases in the Chinese population remains unclear. This study was conducted to explore this association. METHODS: This study was performed using the large-scale China Kadoorie Biobank (CKB) prospective cohort of 486,335 participants. The primary outcomes were vascular disease, ischemic heart disease (IHD), major coronary events (MCEs), cerebrovascular disease, stroke, and non-stroke cerebrovascular disease. A Cox proportional hazards regression model was used to assess the association between spicy food consumption and incident vascular diseases. Subgroup analysis was also performed to evaluate the heterogeneity of the association between spicy food consumption and the risk of vascular disease stratified by several basic characteristics. In addition, the joint effects of spicy food consumption and the healthy lifestyle score on the risk of vascular disease were also evaluated, and sensitivity analyses were performed to assess the reliability of the association results. RESULTS: During a median follow-up time of 12.1 years, a total of 136,125 patients with vascular disease, 46,689 patients with IHD, 10,097 patients with MCEs, 80,114 patients with cerebrovascular disease, 56,726 patients with stroke, and 40,098 patients with non-stroke cerebrovascular disease were identified. Participants who consumed spicy food 1-2 days/week (hazard ratio [HR] = 0.95, 95% confidence interval [95% CI] = [0.93, 0.97], P <0.001), 3-5 days/week (HR = 0.96, 95% CI = [0.94, 0.99], P = 0.003), and 6-7 days/week (HR = 0.97, 95% CI = [0.95, 0.99], P = 0.002) had a significantly lower risk of vascular disease than those who consumed spicy food less than once a week ( Ptrend <0.001), especially in those who were younger and living in rural areas. Notably, the disease-based subgroup analysis indicated that the inverse associations remained in IHD ( Ptrend = 0.011) and MCEs ( Ptrend = 0.002) risk. Intriguingly, there was an interaction effect between spicy food consumption and the healthy lifestyle score on the risk of IHD ( Pinteraction = 0.037). CONCLUSIONS Our findings support an inverse association between spicy food consumption and vascular disease in the Chinese population, which may provide additional dietary guidance for the prevention of vascular diseases.
Humans ; Male ; Female ; Prospective Studies ; Middle Aged ; Aged ; Vascular Diseases/etiology* ; Risk Factors ; China/epidemiology* ; Adult ; Proportional Hazards Models ; Cerebrovascular Disorders/epidemiology* ; East Asian People

Traditional Chinese medicine(TCM) capable of clearing heat and removing toxin is most commonly used in clinical practice and has the effect of removing fire-heat and toxin. Studies have shown that most of the Ilex plants have the effect of clearing heat and removing toxin, among which the varieties of I. cornuta, I. pubescens, I. rotunda, I. latifolia, and I. chinensis are most widely used. These plants generally contain triterpenoids and their glycosides, alkaloids, flavonoids, phenylpropanoids, and other chemical components, especially pentacyclic triterpenoids. According to their skeletons, pentacyclic triterpenoids can be divided into the oleanane type, the ursane type, the lupinane type, etc. Among them, ursane-type components are the most abundant, and 136 species have been found so far. These components have been proved to have pharmacological effects such as anti-inflammatory, anti-tumor, hypolipidemic, anti-thrombosis, cardiomyocyte-protective, antibacterial, and hepatoprotective effects. Therefore, this paper systematically reviews the domestic and foreign literature on Ilex plants with a focus on the research progress on pentacyclic triterpenoids and their pharmacological activities, aiming to provide reference for the development of TCM resources with the effect of clearing heat and removing toxin.
Ilex/chemistry* ; Plants, Medicinal/chemistry* ; Pentacyclic Triterpenes/pharmacology* ; Medicine, Chinese Traditional ; Drugs, Chinese Herbal/pharmacology* ; Humans ; Animals

Neurodegenerative diseases (NDDs) are a group of heterogeneous neurological disorders that can cause progressive loss of neurons in the central nervous system or peripheral nervous system, resulting in a decline in motor function. Motion capture, as a high-precision and high-resolution technology for capturing human motion data, drives NDDs motor assessment to effectively extract kinematic features and thus assess the patient's motor ability or disease severity. This paper focuses on the recent research progress in motor assessment of NDDs driven by motion capture data. Based on a brief introduction of NDDs motor assessment datasets, we categorized the assessment methods into three types according to the way of feature extraction and processing: NDDs motor assessment methods based on statistical analysis, machine learning and deep learning. Then, we comparatively analyzed the technical points and characteristics of the three types of methods from the aspects of data composition, data preprocessing, assessment methods, assessment purposes and effects. Finally, we discussed and prospected the development trends of NDDs motor assessment.
Humans ; Neurodegenerative Diseases/diagnosis* ; Machine Learning ; Biomechanical Phenomena ; Deep Learning ; Motion ; Motion Capture

This study was conducted retrospectively on a cohort of 68 patients with steroid 5 α-reductase 2 (SRD5A2) deficiency and 46,XY disorders of sex development (DSD). Whole-exon sequencing revealed 28 variants of SRD5A2 , and further analysis identified seven novel mutants. The preponderance of variants was observed in exon 1 and exon 4, specifically within the nicotinamide adenine dinucleotide phosphate (NADPH)-binding region. Among the entire cohort, 53 patients underwent initial surgery at Sichuan Provincial People's Hospital (Chengdu, China). The external genitalia scores (EGS) of these participants varied from 2.0 to 11.0, with a mean of 6.8 (standard deviation [s.d.]: 2.5). Thirty patients consented to hormone testing. Their average testosterone-to-dihydrotestosterone (T/DHT) ratio was 49.3 (s.d.: 23.4). Genetic testing identified four patients with EGS scores between 6 and 9 as having this syndrome; and their T/DHT ratios were below the diagnostic threshold. Furthermore, assessments conducted using the crystal structure of human SRD5A2 have provided insights into the potential pathogenic mechanisms of these novel variants. These mechanisms include interference with NADPH binding (c.356G>C, c.365A>G, c.492C>G, and c.662T>G) and destabilization of the protein structure (c.727C>T). The c.446-1G>T and c.380delG variants were verified to result in large alterations in the transcripts. Seven novel variations were identified, and the variant database for the SRD5A2 gene was expanded. These findings contribute to the progress of diagnostic and therapeutic approaches for individuals with SRD5A2 deficiency.
Humans ; 3-Oxo-5-alpha-Steroid 4-Dehydrogenase/genetics* ; Disorder of Sex Development, 46,XY/blood* ; Male ; Membrane Proteins/genetics* ; Child, Preschool ; Child ; Retrospective Studies ; Adolescent ; Female ; Mutation ; Testosterone/blood* ; Infant ; Dihydrotestosterone/blood*

This study explores whether the current external quality assessment (EQA) level and acceptable bias for basic semen analysis in China are clinically useful. We collected data of semen EQA from Andrology laboratories in the Hunan Province (China) in 2022 and searched for data in the published literature from January 2000 to December 2023 in China. On the basis of these data, we analyzed the coefficients of variation and acceptable biases of different quality control materials for basic semen analysis through robust statistics. We compared these findings with quality specifications based on biological variation from optimal, desirable, and minimum levels of bias to seek a unified and more suitable semen EQA bias evaluation standard for China's national conditions. Different sources of semen quality control material exhibited considerable variation in acceptable biases among laboratories, ranging from 8.2% to 56.9%. A total of 50.0% of the laboratories met the minimum quality specifications for progressive motility (PR), whereas 100.0% and 75.0% of laboratories met only the minimum quality specifications for sperm concentration and total motility (nonprogressive [NP] + PR), respectively. The Z value for sperm concentration and PR+NP was equivalent to the desirable performance specification, whereas the Z value for PR was equivalent only to the minimum performance specification. This study highlights the feasibility of operating external quality assessment schemes for basic semen analysis using quality specifications based on biological variation. These specifications should be unified among external quality control (EQC) centers based on biological variation.
Semen Analysis/standards* ; Humans ; China ; Male ; Quality Control ; Sperm Motility ; Sperm Count/standards*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To compare and analyze the changes of aggregation rate and routine parameters of platelets stored in temperature cycle, cold storage at 4 ℃ and oscillating storage at 22 ℃, so as to provide more experimental data for platelet preservation methods. METHODS: Blood samples were collected at 5 time points on the 1^st, 2^nd, 3^rd, 4^th and 6^th day after platelet cycling preservation at temperature, cold storage at 4 ℃, and oscillating storage at 22 ℃. Platelet maximum aggregation rate (MAR) and routine parameters including platelet count (PLT), mean platelet volume (MPV), platelet distribution width (PDW) and platelet-larger cell ratio (P-LCR) were detected. RESULTS: The platelet MAR of three groups showed a significant decrease trend with the preservation time, the fastest decrease was in the 22 ℃ group, the slowest was in the 4 ℃ group, and the temperature cycle group was between the two groups. On the 3^rd day of preservation, the platelet MAR in 4 ℃ group was still in the normal range (MAR>60%), while in temperature cycle group was about 50%, and in 22 ℃ group was the lowest. On the 4^th day of preservation, platelet MAR in all the three groups was lower than 50%, and that in temperature cycle group was significantly lower than in 4 ℃ group but higher than in 22 ℃ group (both P < 0.05). On the 6^th day of preservation, platelet MAR in the temperature cycle group was significantly lower than that in the 4 ℃ group ( P <0.05), but there was no statistically significant difference compared to 22 ℃ group (P >0.05). PLT values in the three groups were all significantly decreased with the preservation time extension, and were significantly lower than those in the early stage of preservation within 6 days (all P < 0.05). PDW in temperature cycle group had no significant change within 6 days of preservation, but MPV and P-LCR were significantly increased. MPV, PDW and P-LCR all decreased significantly in 4 ℃ group within 6 days of preservation but increased in 22 ℃ group. Under the same storage days, PLT value of temperature cycle group had no significant difference with that of 4 ℃ group and 22 ℃ group, while MPV, PDW and P-LCR values were significantly higher than 4 ℃ group but lower than 22 ℃ group (all P < 0.05). CONCLUSION The aggregation function and routine parameters changes of temperature circulating preserved platelets are between 4 and 22 ℃.
Humans ; Platelet Aggregation ; Blood Preservation/methods* ; Temperature ; Blood Platelets ; Platelet Count ; Mean Platelet Volume ; Cryopreservation/methods* ; Cold Temperature

OBJECTIVE: To explore the functional roles and underlying mechanisms of neferine in the context of angiotensin II (Ang II)-induced hypertension and vascular dysfunction. METHODS: Male mice were infused with Ang II to induce hypertension and randomly divided into treatment groups receiving neferine or a control vehicle based on baseline blood pressure using a random number table method. The hypertensive mouse model was constructed by infusing Ang II via a micro-osmotic pump (500 ng/kg per minute), and neferine (0.1, 1, or 10 mg/kg), valsartan (10 mg/kg), or double distilled water was administered intragastrically once daily for 6 weeks. A non-invasive blood pressure system, ultrasound, and hematoxylin and eosin staining were performed to assess blood pressure and vascular changes. RNA sequencing and network pharmacology were employed to identify differentially expressed transcripts (DETs) and pathways. Vascular ring tension assay was used to test vascular function. A7R5 cells were incubated with neferine for 24 h and then treated with Ang II to record the real-time Ca²⁺ concentration by confocal microscope. Immunohistochemistry (IHC) and Western blot were used to evaluate vasorelaxation, calcium, and the extracellular signal-regulated kinase (ERK)1/2 pathway. RESULTS: Neferine treatment effectively mitigated the elevation in blood pressure, pulse wave velocity, aortic thickening in the abdominal aorta of Ang II-infused mice (P<0.05). RNA sequencing and network pharmacology analysis identified 355 DETs that were significantly reversed by neferine treatment, along with 25 potential target genes, which were further enriched in multiple pathways and biological processes, such as ERK1 and ERK2 cascade regulation, calcium pathway, and vascular smooth muscle contraction. Further investigation revealed that neferine treatment enhanced vasorelaxation and reduced Ca²⁺-dependent contraction of abdominal aortic rings, independent of endothelium function (P<0.05). The underlying mechanisms were mediated, at least in part, via suppression of receptor-operated channels, store-operated channels, or voltage-operated calcium channels. Neferine pre-treatment demonstrated a reduction in intracellular Ca²⁺ release in Ang II stimulated A7R5 cells. IHC staining and Western blot confirmed that neferine treatment effectively attenuated the upregulation of p-ERK1/2 both in vivo and in vitro, which was similar with treatment of ERK1/2 inhibitor PD98059 (P<0.05). CONCLUSIONS Neferine remarkably alleviates Ang II-induced elevation of blood pressure, vascular dysfunction, and pathological changes in the abdominal aorta. This beneficial effect is mediated by the modulation of multiple pathways, including calcium and ERK1/2 pathways.
Animals ; Angiotensin II ; Male ; Benzylisoquinolines/therapeutic use* ; Network Pharmacology ; Blood Pressure/drug effects* ; Sequence Analysis, RNA ; Mice ; Hypertension/chemically induced* ; Mice, Inbred C57BL ; Calcium/metabolism*