BACKGROUND:In previous studies,glass materials were infiltrated into 5Y-PSZ ultra-translucent zirconia by a double sintering method to prepare 5Y-PSZ-YGI graded glass infiltrated ultra-translucent zirconia materials that can maintain high transparency and high flexural strength.OBJECTIVE:To evaluate the in vitro biocompatibility of 5Y-PSZ-YGI graded glass infiltrated ultra-translucent zirconia materials.METHODS:(1)Glass materials were infiltrated into 5Y-PSZ ultra-translucent zirconia by double sintering to prepare 5Y-PSZ-YGI graded glass infiltrated ultra-translucent zirconia.5Y-PSZ-YGI graded glass infiltrated ultra-translucent zirconia(or 5Y-PSZ ultra-translucent zirconia,3Y-TZP transparent zirconia)was placed in DMEM culture medium containing 10％fetal bovine serum for 12,24 and 72 hours,and the surface area ratio of culture medium to sample was 3 mL/cm2,and the 12-,24-and 72-hour material extracts were obtained.(2)After culturing mouse fibroblast L929 for 24 hours,the original culture medium was discarded and divided into 7 groups for culture:the control group was replaced with DMEM culture medium containing 10％fetal bovine serum by volume,and the other 6 groups were replaced with 24-hour extract of 3Y-TZP transparent zirconia,24-hour extract of 5Y-PSZ ultra-translucent zirconia,24-hour extract of 5Y-PSZ-YGI graded glass infiltrated ultra-translucent zirconia,72-hour extract of 3Y-TZP transparent zirconia,72-hour extract of 5Y-PSZ ultra-translucent zirconia,and 72-hour extract of 5Y-PSZ-YGI graded glass infiltrated ultra-translucent zirconia.After 1,3,and 5 days of culture,cell growth was observed under a microscope,and the cell proliferation rate was obtained by CCK-8 assay to determine cytotoxicity.(3)Human anticoagulated blood was mixed with 5Y-PSZ-YGI graded glass infiltrated ultra-translucent zirconia,5Y-PSZ ultra-translucent zirconia,and 3Y-TZP transparent zirconia,and the hemolysis rate was detected after 0.5 hours.Human anticoagulated blood was mixed with 12-hour extract of 3Y-TZP transparent zirconia,12-hour extract of 5Y-PSZ ultra-translucent zirconia,and 12-hour extract of 5Y-PSZ-YGI graded glass infiltrated ultra-translucent zirconia,and the hemolysis rate was detected after 0.5 hours.RESULTS AND CONCLUSION:(1)Under the microscope,it could be seen that the number of cells in each group increased with the extension of culture time,and the cell morphology of each experimental group was basically the same as that of the control group.The cytotoxicity grade of the 24-hour extract of 3Y-TZP transparent zirconia group on the first day of culture was grade 0,and the cytotoxicity grade of the other experimental groups at each time period was grade 1.(2)Neither the material nor the material extract caused obvious hemolytic reaction,and the hemolytic rate was less than 5％.(3)The results showed that 5Y-PSZ-YGI graded glass infiltrated ultra-translucent zirconia had no significant effect on the growth and proliferation of mouse fibroblasts L929,and did not cause hemolytic reaction with human blood,and had good in vitro biocompatibility.

BACKGROUND:In previous studies,glass materials were infiltrated into 5Y-PSZ ultra-translucent zirconia by a double sintering method to prepare 5Y-PSZ-YGI graded glass infiltrated ultra-translucent zirconia materials that can maintain high transparency and high flexural strength.OBJECTIVE:To evaluate the in vitro biocompatibility of 5Y-PSZ-YGI graded glass infiltrated ultra-translucent zirconia materials.METHODS:(1)Glass materials were infiltrated into 5Y-PSZ ultra-translucent zirconia by double sintering to prepare 5Y-PSZ-YGI graded glass infiltrated ultra-translucent zirconia.5Y-PSZ-YGI graded glass infiltrated ultra-translucent zirconia(or 5Y-PSZ ultra-translucent zirconia,3Y-TZP transparent zirconia)was placed in DMEM culture medium containing 10％fetal bovine serum for 12,24 and 72 hours,and the surface area ratio of culture medium to sample was 3 mL/cm2,and the 12-,24-and 72-hour material extracts were obtained.(2)After culturing mouse fibroblast L929 for 24 hours,the original culture medium was discarded and divided into 7 groups for culture:the control group was replaced with DMEM culture medium containing 10％fetal bovine serum by volume,and the other 6 groups were replaced with 24-hour extract of 3Y-TZP transparent zirconia,24-hour extract of 5Y-PSZ ultra-translucent zirconia,24-hour extract of 5Y-PSZ-YGI graded glass infiltrated ultra-translucent zirconia,72-hour extract of 3Y-TZP transparent zirconia,72-hour extract of 5Y-PSZ ultra-translucent zirconia,and 72-hour extract of 5Y-PSZ-YGI graded glass infiltrated ultra-translucent zirconia.After 1,3,and 5 days of culture,cell growth was observed under a microscope,and the cell proliferation rate was obtained by CCK-8 assay to determine cytotoxicity.(3)Human anticoagulated blood was mixed with 5Y-PSZ-YGI graded glass infiltrated ultra-translucent zirconia,5Y-PSZ ultra-translucent zirconia,and 3Y-TZP transparent zirconia,and the hemolysis rate was detected after 0.5 hours.Human anticoagulated blood was mixed with 12-hour extract of 3Y-TZP transparent zirconia,12-hour extract of 5Y-PSZ ultra-translucent zirconia,and 12-hour extract of 5Y-PSZ-YGI graded glass infiltrated ultra-translucent zirconia,and the hemolysis rate was detected after 0.5 hours.RESULTS AND CONCLUSION:(1)Under the microscope,it could be seen that the number of cells in each group increased with the extension of culture time,and the cell morphology of each experimental group was basically the same as that of the control group.The cytotoxicity grade of the 24-hour extract of 3Y-TZP transparent zirconia group on the first day of culture was grade 0,and the cytotoxicity grade of the other experimental groups at each time period was grade 1.(2)Neither the material nor the material extract caused obvious hemolytic reaction,and the hemolytic rate was less than 5％.(3)The results showed that 5Y-PSZ-YGI graded glass infiltrated ultra-translucent zirconia had no significant effect on the growth and proliferation of mouse fibroblasts L929,and did not cause hemolytic reaction with human blood,and had good in vitro biocompatibility.

Traditional Chinese medicine(TCM) capable of clearing heat and removing toxin is most commonly used in clinical practice and has the effect of removing fire-heat and toxin. Studies have shown that most of the Ilex plants have the effect of clearing heat and removing toxin, among which the varieties of I. cornuta, I. pubescens, I. rotunda, I. latifolia, and I. chinensis are most widely used. These plants generally contain triterpenoids and their glycosides, alkaloids, flavonoids, phenylpropanoids, and other chemical components, especially pentacyclic triterpenoids. According to their skeletons, pentacyclic triterpenoids can be divided into the oleanane type, the ursane type, the lupinane type, etc. Among them, ursane-type components are the most abundant, and 136 species have been found so far. These components have been proved to have pharmacological effects such as anti-inflammatory, anti-tumor, hypolipidemic, anti-thrombosis, cardiomyocyte-protective, antibacterial, and hepatoprotective effects. Therefore, this paper systematically reviews the domestic and foreign literature on Ilex plants with a focus on the research progress on pentacyclic triterpenoids and their pharmacological activities, aiming to provide reference for the development of TCM resources with the effect of clearing heat and removing toxin.
Ilex/chemistry* ; Plants, Medicinal/chemistry* ; Pentacyclic Triterpenes/pharmacology* ; Medicine, Chinese Traditional ; Drugs, Chinese Herbal/pharmacology* ; Humans ; Animals

Neurodegenerative diseases (NDDs) are a group of heterogeneous neurological disorders that can cause progressive loss of neurons in the central nervous system or peripheral nervous system, resulting in a decline in motor function. Motion capture, as a high-precision and high-resolution technology for capturing human motion data, drives NDDs motor assessment to effectively extract kinematic features and thus assess the patient's motor ability or disease severity. This paper focuses on the recent research progress in motor assessment of NDDs driven by motion capture data. Based on a brief introduction of NDDs motor assessment datasets, we categorized the assessment methods into three types according to the way of feature extraction and processing: NDDs motor assessment methods based on statistical analysis, machine learning and deep learning. Then, we comparatively analyzed the technical points and characteristics of the three types of methods from the aspects of data composition, data preprocessing, assessment methods, assessment purposes and effects. Finally, we discussed and prospected the development trends of NDDs motor assessment.
Humans ; Neurodegenerative Diseases/diagnosis* ; Machine Learning ; Biomechanical Phenomena ; Deep Learning ; Motion ; Motion Capture

This study was conducted retrospectively on a cohort of 68 patients with steroid 5 α-reductase 2 (SRD5A2) deficiency and 46,XY disorders of sex development (DSD). Whole-exon sequencing revealed 28 variants of SRD5A2 , and further analysis identified seven novel mutants. The preponderance of variants was observed in exon 1 and exon 4, specifically within the nicotinamide adenine dinucleotide phosphate (NADPH)-binding region. Among the entire cohort, 53 patients underwent initial surgery at Sichuan Provincial People's Hospital (Chengdu, China). The external genitalia scores (EGS) of these participants varied from 2.0 to 11.0, with a mean of 6.8 (standard deviation [s.d.]: 2.5). Thirty patients consented to hormone testing. Their average testosterone-to-dihydrotestosterone (T/DHT) ratio was 49.3 (s.d.: 23.4). Genetic testing identified four patients with EGS scores between 6 and 9 as having this syndrome; and their T/DHT ratios were below the diagnostic threshold. Furthermore, assessments conducted using the crystal structure of human SRD5A2 have provided insights into the potential pathogenic mechanisms of these novel variants. These mechanisms include interference with NADPH binding (c.356G>C, c.365A>G, c.492C>G, and c.662T>G) and destabilization of the protein structure (c.727C>T). The c.446-1G>T and c.380delG variants were verified to result in large alterations in the transcripts. Seven novel variations were identified, and the variant database for the SRD5A2 gene was expanded. These findings contribute to the progress of diagnostic and therapeutic approaches for individuals with SRD5A2 deficiency.
Humans ; 3-Oxo-5-alpha-Steroid 4-Dehydrogenase/genetics* ; Disorder of Sex Development, 46,XY/blood* ; Male ; Membrane Proteins/genetics* ; Child, Preschool ; Child ; Retrospective Studies ; Adolescent ; Female ; Mutation ; Testosterone/blood* ; Infant ; Dihydrotestosterone/blood*

This study explores whether the current external quality assessment (EQA) level and acceptable bias for basic semen analysis in China are clinically useful. We collected data of semen EQA from Andrology laboratories in the Hunan Province (China) in 2022 and searched for data in the published literature from January 2000 to December 2023 in China. On the basis of these data, we analyzed the coefficients of variation and acceptable biases of different quality control materials for basic semen analysis through robust statistics. We compared these findings with quality specifications based on biological variation from optimal, desirable, and minimum levels of bias to seek a unified and more suitable semen EQA bias evaluation standard for China's national conditions. Different sources of semen quality control material exhibited considerable variation in acceptable biases among laboratories, ranging from 8.2% to 56.9%. A total of 50.0% of the laboratories met the minimum quality specifications for progressive motility (PR), whereas 100.0% and 75.0% of laboratories met only the minimum quality specifications for sperm concentration and total motility (nonprogressive [NP] + PR), respectively. The Z value for sperm concentration and PR+NP was equivalent to the desirable performance specification, whereas the Z value for PR was equivalent only to the minimum performance specification. This study highlights the feasibility of operating external quality assessment schemes for basic semen analysis using quality specifications based on biological variation. These specifications should be unified among external quality control (EQC) centers based on biological variation.
Semen Analysis/standards* ; Humans ; China ; Male ; Quality Control ; Sperm Motility ; Sperm Count/standards*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To explore the functional roles and underlying mechanisms of neferine in the context of angiotensin II (Ang II)-induced hypertension and vascular dysfunction. METHODS: Male mice were infused with Ang II to induce hypertension and randomly divided into treatment groups receiving neferine or a control vehicle based on baseline blood pressure using a random number table method. The hypertensive mouse model was constructed by infusing Ang II via a micro-osmotic pump (500 ng/kg per minute), and neferine (0.1, 1, or 10 mg/kg), valsartan (10 mg/kg), or double distilled water was administered intragastrically once daily for 6 weeks. A non-invasive blood pressure system, ultrasound, and hematoxylin and eosin staining were performed to assess blood pressure and vascular changes. RNA sequencing and network pharmacology were employed to identify differentially expressed transcripts (DETs) and pathways. Vascular ring tension assay was used to test vascular function. A7R5 cells were incubated with neferine for 24 h and then treated with Ang II to record the real-time Ca²⁺ concentration by confocal microscope. Immunohistochemistry (IHC) and Western blot were used to evaluate vasorelaxation, calcium, and the extracellular signal-regulated kinase (ERK)1/2 pathway. RESULTS: Neferine treatment effectively mitigated the elevation in blood pressure, pulse wave velocity, aortic thickening in the abdominal aorta of Ang II-infused mice (P<0.05). RNA sequencing and network pharmacology analysis identified 355 DETs that were significantly reversed by neferine treatment, along with 25 potential target genes, which were further enriched in multiple pathways and biological processes, such as ERK1 and ERK2 cascade regulation, calcium pathway, and vascular smooth muscle contraction. Further investigation revealed that neferine treatment enhanced vasorelaxation and reduced Ca²⁺-dependent contraction of abdominal aortic rings, independent of endothelium function (P<0.05). The underlying mechanisms were mediated, at least in part, via suppression of receptor-operated channels, store-operated channels, or voltage-operated calcium channels. Neferine pre-treatment demonstrated a reduction in intracellular Ca²⁺ release in Ang II stimulated A7R5 cells. IHC staining and Western blot confirmed that neferine treatment effectively attenuated the upregulation of p-ERK1/2 both in vivo and in vitro, which was similar with treatment of ERK1/2 inhibitor PD98059 (P<0.05). CONCLUSIONS Neferine remarkably alleviates Ang II-induced elevation of blood pressure, vascular dysfunction, and pathological changes in the abdominal aorta. This beneficial effect is mediated by the modulation of multiple pathways, including calcium and ERK1/2 pathways.
Animals ; Angiotensin II ; Male ; Benzylisoquinolines/therapeutic use* ; Network Pharmacology ; Blood Pressure/drug effects* ; Sequence Analysis, RNA ; Mice ; Hypertension/chemically induced* ; Mice, Inbred C57BL ; Calcium/metabolism*

Mycophenolic acid (MPA), the active moiety of both mycophenolate mofetil (MMF) and enteric-coated mycophenolate sodium (EC-MPS), serves as a primary immunosuppressant for maintaining solid organ transplants. Therapeutic drug monitoring (TDM) enhances treatment outcomes through tailored approaches. This study aimed to develop an evidence-based guideline for MPA TDM, facilitating its rational application in clinical settings. The guideline plan was drawn from the Institute of Medicine and World Health Organization (WHO) guidelines. Using the Delphi method, clinical questions and outcome indicators were generated. Systematic reviews, Grading of Recommendations Assessment, Development, and Evaluation (GRADE) evidence quality evaluations, expert opinions, and patient values guided evidence-based suggestions for the guideline. External reviews further refined the recommendations. The guideline for the TDM of MPA (IPGRP-2020CN099) consists of four sections and 16 recommendations encompassing target populations, monitoring strategies, dosage regimens, and influencing factors. High-risk populations, timing of TDM, area under the curve (AUC) versus trough concentration (C₀), target concentration ranges, monitoring frequency, and analytical methods are addressed. Formulation-specific recommendations, initial dosage regimens, populations with unique considerations, pharmacokinetic-informed dosing, body weight factors, pharmacogenetics, and drug‍-‍drug interactions are covered. The evidence-based guideline offers a comprehensive recommendation for solid organ transplant recipients undergoing MPA therapy, promoting standardization of MPA TDM, and enhancing treatment efficacy and safety.
Mycophenolic Acid/administration & dosage* ; Drug Monitoring/methods* ; Humans ; Organ Transplantation ; Immunosuppressive Agents/administration & dosage* ; Delphi Technique

Ischemic stroke (IS) is a globally life-threatening disease. Presently, few therapeutic medicines are available for treating IS, and rt-PA is the only drug approved by the US Food and Drug Administration (FDA) in the US. In fact, many agents showing excellent neuroprotection but no blood flow-improving activity in animals have not achieved ideal clinical efficacy, while thrombolytic drugs only improving blood flow without neuroprotection have limited their wider application. To address these challenges and meet the huge unmet clinical need, we have designed and identified a novel compound AAPB with dual effects of neuroprotection and cerebral blood flow improvement. AAPB significantly reduced cerebral infarction and neural function deficit in tMCAO rats, pMCAO rats, and IS rhesus monkeys, as well as displayed exceptional safety profiles and excellent pharmacokinetic properties in rats and dogs. AAPB has now entered phase I of clinical trials fighting IS in China.