Objective This study reports on the obligatory parasitism of water mites Arrenurus sp. on Anopheles messeae at the Manzhouli Port, Inner Mongolia, China. Methods Duing July 2024, a survey on the mosquito diversity was conducted at the Manzhouli Port. Captured mosquitoes and their ectoparasites were identified to species level. Results A total of 1840 adult mosquitoes were collected, representing species from three genera: Culex(Cx. modestus, Cx. pipiens pallens), Aedes(Ae. dorsalis, Ae. flavidorsalis, Ae. flavescens), and Anopheles (An. messeae). Among all the mosqutioes specimens,3 out of 150 captured An. messeae were found to carry ectoparasitic mites, with number of 2,4,27 mites separately. Morphological and molecular identification reached the same result as water mites(Hydrachnidiae, Hydracrina). COI gene sequence showed 94% similarity with the closest species Arrenurus truncatellus. Conlusions Literature review suggests water mites are host-specific parasitism of mosquito species and herein with the first record of Arrenurus sp. parasiting on An. Messeae in the most high-latitude region globally.

ObjectiveTo investigate the mechanisms by which Shangxia Liangji pills improve cognitive function in Alzheimer's disease （AD） mice based on the phosphatidylinositol 3-kinase （PI3K）/protein kinase B （Akt） pathway， aiming to provide experimental evidence for its clinical use in AD treatment. MethodsFifty APP/PS1 double-transgenic mice were randomly divided into a model group， Shangxia Liangji pills low-dose group， medium-dose group， high-dose group， and donepezil hydrochloride group， with 10 mice in each group. Additionally， 10 C57BL/6 mice of the same genetic background were assigned to the normal group. Cognitive function was assessed using the Morris water maze and novel object recognition tests. Hippocampal pathological changes were observed using transmission electron microscopy and Nissl staining. Neuroinflammation in hippocampal tissue was detected by enzyme-linked immunosorbent assay （ELISA）. Protein expression levels of PI3K/Akt pathway-related proteins， postsynaptic density protein 95 （PSD95）， and amyloid precursor protein （APP） in hippocampal tissue were measured by Western blot. ResultsCompared with the normal group， the model group exhibited significantly increased total swimming distance and escape latency， significantly reduced number of platform crossings （P<0.01）， and a decreased recognition index （P<0.01）. Marked neuronal apoptosis was observed in the hippocampal region， with a marked reduction in the number of neurons in the CA3 region （P<0.01）. Levels of interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in hippocampal tissue were significantly elevated （P<0.01）. APP expression in hippocampal tissue was markedly upregulated （P<0.01）， while PSD95， p-PI3K/PI3K， and p-Akt/Akt protein expression were significantly downregulated （P<0.01）. Compared with the model group， the Shangxia Liangji pills high-dose group showed significantly reduced total swimming distance and escape latency， significantly increased number of platform crossings （P<0.01）， and an elevated recognition index （P<0.01）. Hippocampal neuronal apoptosis was alleviated， with a significant increase in the number of neurons in the CA3 region （P<0.01）. Levels of IL-6， IL-1β， and TNF-α were significantly decreased （P<0.01）. APP expression was downregulated （P<0.05）， while PSD95， p-PI3K/PI3K， and p-Akt/Akt protein expression were significantly upregulated （P<0.01）. ConclusionShangxia Liangji pills may improve cognitive function in AD mice by modulating the PI3K/Akt pathway， thereby reducing neuroinflammation and alleviating neuronal and synaptic injury.

According to traditional Chinese medicine （TCM） theory， impaired spleen transportation function disrupts nutrient distribution， causing metabolic accumulation of lipids that transform into pathogenic phlegm-dampness. These pathological factors disseminate through the San Jiao and obstruct meridian pathways， ultimately forming the pathogenesis described as "all disorders involve phlegm". Phlegm and dampness share common pathogenic origins but manifest distinct clinical manifestations. Dampness， as the precursor， may congeal into phlegm， while existing phlegm accumulation can further exacerbate dampness stagnation， thereby establishing a self-perpetuating pathological cycle. Modern medical research has confirmed that the essence of "phlegm-dampness" syndrome is closely associated with energy metabolism disorders， serving as a common pathological basis for metabolic syndrome， type 2 diabetes mellitus， atherosclerosis， and other major chronic diseases. As a crucial vehicle for medical experimental research， disease-syndrome combination animal models serve as an indispensable means to advance the modernization of TCM. Currently， based on classical theories such as "rich and greasy foods produce phlegm" and "physical coldness combined with cold consumption causes external pathogens to invade the skin and hair， thereby generating internal dampness"， researchers primarily employ two paradigms to construct animal models of phlegm-turbidity， dampness obstruction， and phlegm-dampness syndromes： the first involves simulating TCM etiological factors （through methods like dietary irregularities， imblanace between work and rest， and combined internal-external dampness exposure）， while the second combines disease with syndrome differentiation （inducing pathological changes through physical， chemical， or biological interventions）. Through comprehensive evaluation incorporating macroscopic observation and microscopic index detection， model animals undergo systematic biological and pathological assessment， with further syndrome type verification achieved via the "prescription-based syndrome detection" approach. However， existing models still exhibit significant deficiencies in both the standardization of modeling methodologies and the systematization of evaluation criteria. This paper reviews the strategies for constructing "phlegm-dampness" syndrome animal models and their corresponding evaluation indices， focusing on the pathological correlations among different modeling approaches. The aim is to provide methodological guidance for research on TCM syndromes related to "phlegm-dampness" syndrome and to support the development of TCM therapies for resolving phlegm and eliminating dampness. This study not only contributes to advancing the standardization of TCM syndrome research but also provides crucial technical support for the modernization of TCM.

Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.

Objective To compare the effects of main artery clamping(MAC)and selective artery clamping(SAC)strategies on postoperative renal function in patients with chronic renal insufficiency undergoing robot-assisted partial nephrectomy.Methods A retrospective cohort study was conducted on 231 patients with preoperative chronic renal insufficiency[eGFR<90 mL/(min·1.73 m2)with renal injury markers or eGFR<60 mL/(min·1.73 m2)]who underwent robot-assisted partial nephrectomy in the Department of Urology of the First Affiliated Hospital of Army Medical University from February 2018 to February 2024.According to intraoperative renal artery clamping strategy,they were divided into a MAC group(n=129)and a SAC group(n=102).Preoperatively,individualized renal artery clamping strategies were developed using a machine learning-based multimodal holographic 3-D reconstruction technique.Serum creatinine(Scr)level was measured at 3 d and 3 months after surgery,and estimated glomerular filtration rate(eGFR)was calculated using the chronic kidney disease epidemiology collaboration equation(CKD-EPI)formula.Renal dynamic imaging with 99mTc-DTPA or 99mTc-MAG3 was used to assess the GFR of the affected kidney.Results At 3 d after surgery,the decrease in GFR of the affected kidney was significantly lower[(8.3±7.7)vs(16.0±10.2)mL/(min·1.73 m2),95%CI:-10.2～-5.2,P<0.001]in the SAC group than the MAC group.Scr increment analysis showed that the SAC group exhibited notably lower Scr increase[8.2(2.5,18.7)vs 15.5(5.8,28.3)μmol/L,95%CI:-12.3～-1.8,P=0.027],and milder eGFR decline[3.0(0.5,7.8)vs 7.5(2.0,14.3)mL/(min·1.73 m2),95%CI:-6.2～-0.8,P=0.015].And,in 3 months after surgery,the SAC group had lower Scr level[(89.2±23.1)vs(95.3±22.1)μmol/L,95%CI:-11.9～-0.3,P=0.042],and higher GFR of the affected kidney[(33.5±10.5)vs(26.1±10.9)mL/(min·1.73 m2),95%CI:4.6～10.2,P<0.001].Conclusion For patients with chronic renal insufficiency undergoing robot-assisted partial nephrectomy,SAC strategy is superior to MAC strategy in protecting postoperative renal function without increasing surgical risk.

Objective To compare the application effects of plankton multiplex polymerase chain reac-tion-capillary electrophoresis(PCR-CE),SYBR Green Ⅰ real-time quantitative PCR(qPCR)and microwave digestion-vacuum filtration-automated scanning electron microscopy(MD-VF-Auto SEM)in the diagnosis of drowning.Methods Lung,liver and kidney tissues from 212 drowned corpses and 30 non-drowned corpses were examined respectively by the three drowning-related plankton testing methods,and the detection rates of plankton in each tissue by three methods were compared.Results In drowned corpses,the total detection rates of PCR-CE,qPCR,and MD-VF-Auto SEM were 93.9%,96.2%,and 95.3%,respectively,with no statistically significant difference(P>0.05).The detection rate of lung tissue by MD-VF-Auto SEM(100%)was higher than those of PCR-CE and qPCR(P<0.05),and there was no significant difference in the detection rates of the three methods in liver or kidney tissues(P>0.05).In non-drowning corpses,a small number of diatoms(less than 10 cells/10 g)were detected by MD-VF-Auto SEM method,only in liver and kidney tissues,while the other two methods yielded negative results for all tissues.Conclusion All three methods have good efficacy in the examination of drowned corpses.The MD-VF-Auto SEM method directly observes diatom morpho-logical characteristics through scanning electron microscopy,and the qualitative and quantitative analy-ses are intuitive and accurate.It has great advantages in the examination of difficult degradation samples.The PCR-CE method and qPCR method have a low sample demand(0.5 g),are easy to operate and have short detection time(4-7 h).They are easy to be applied in the grassroots depart-ments and are suitable for the rapid determination of drowned corpses in routin cases.The combina-tion of the two DNA methods with the MD-VF-Auto SEM method can increase the detection rate of plankton,ensuring the reliability of examination results.This combined use is of significant importance in the application of drowning diagnosis.

Psychotropic medication plays a crucial role in the field of mental illness,and the issues of drug efficacy and safety due to individual differences cannot be ignored.Genetic factors,especially the genetic poly-morphisms related to drug-metabolizing enzymes,drug action targets,and risk,have a significant impact on drug responses.Pharmacogenomics,by detecting genetic polymorphisms,can reveal a patient's inherited tend-encies towards drug efficacy,pharmacokinetic characteristics,and potential toxicity,thereby predicting the therapeutic effects and adverse reactions of drug treatment,and providing guidance for personalized therapy.Therefore,individualized medication based on pharmacogenomics helps to improve cure rates,reduce relapse rates,and decrease medical costs,which is of great significance to clinical medication in mental illness.

Background: and Purpose Symptomatic intracranial hemorrhage (sICH) following endovascular thrombectomy (EVT) is a severe complication associated with adverse functional outcomes and increased mortality rates. Currently, a reliable predictive model for sICH risk after EVT is lacking. Methods: This study used data from patients aged ≥20 years who underwent EVT for anterior circulation stroke from the nationwide Taiwan Registry of Endovascular Thrombectomy for Acute Ischemic Stroke (TREAT-AIS). A predictive model including factors associated with an increased risk of sICH after EVT was developed to differentiate between patients with and without sICH. This model was compared existing predictive models using nationwide registry data to evaluate its relative performance. Results: Of the 2,507 identified patients, 158 developed sICH after EVT. Factors such as diastolic blood pressure, Alberta Stroke Program Early CT Score, platelet count, glucose level, collateral score, and successful reperfusion were associated with the risk of sICH after EVT. The TREAT-AIS score demonstrated acceptable predictive accuracy (area under the curve [AUC]=0.694), with higher scores being associated with an increased risk of sICH (odds ratio=2.01 per score increase, 95% confidence interval=1.64–2.45, P<0.001). The discriminatory capacity of the score was similar in patients with symptom onset beyond 6 hours (AUC=0.705). Compared to existing models, the TREAT-AIS score consistently exhibited superior predictive accuracy, although this difference was marginal. Conclusions The TREAT-AIS score outperformed existing models, and demonstrated an acceptable discriminatory capacity for distinguishing patients according to sICH risk levels. However, the differences between models were only marginal. Further research incorporating periprocedural and postprocedural factors is required to improve the predictive accuracy.

Male factors contribute to 50% of infertility cases, with 20%-30% of cases being solely attributed to male infertility. Helicase for meiosis 1 ( HFM1 ) plays a crucial role in ensuring proper crossover formation and synapsis of homologous chromosomes during meiosis, an essential process in gametogenesis. HFM1 gene mutations are associated with male infertility, particularly in cases of non-obstructive azoospermia and severe oligozoospermia. However, the effects of intracytoplasmic sperm injection (ICSI) in HFM1 -related infertility cases remain inadequately explored. This study identified novel biallelic HFM1 variants through whole-exome sequencing (WES) in a Chinese patient with severe oligozoospermia, which was confirmed by Sanger sequencing. The pathogenicity of these variants was assessed using real-time quantitative polymerase chain reaction (RT-qPCR) and immunoblotting, which revealed a significant reduction in HFM1 mRNA and protein levels in spermatozoa compared to those in a healthy control. Transmission electron microscopy revealed morphological abnormalities in sperm cells, including defects in the head and flagellum. Despite these abnormalities, ICSI treatment resulted in a favorable fertility outcome for the patient, indicating that assisted reproductive techniques (ART) can be effective in managing HFM1 -related male infertility. These findings offer valuable insights into the management of such cases.
Humans ; Male ; Sperm Injections, Intracytoplasmic ; Oligospermia/therapy* ; Adult ; Spermatozoa/ultrastructure* ; Exome Sequencing ; Mutation

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test