This study aimed to explore the effects and mechanisms of total extracts from Anthriscus sylvestris on pulmonary hypertension in rats. Sixty male SD rats were divided into normal(NC) group, model(M) group, positive drug sildenafil(Y) group, low-dose A. sylvestris(ES-L) group, medium-dose A. sylvestris(ES-M) group, and high-dose A. sylvestris(ES-H) group. On day 1, rats were intraperitoneally injected with monocrotaline(60 mg·kg~(-1)) to induce pulmonary hypertension, and the rat model was established on day 28. From days 15 to 28, intragastric administration of the respective treatments was performed. After modeling and treatment, small animal echocardiography was used to detect the right heart function of the rats. Arterial blood gas was measured using a blood gas analyzer. Hematoxylin and eosin(HE) staining and Masson staining were performed to observe cardiopulmonary pathological damage. Flow cytometry was used to detect apoptosis in the lung and myocardial tissues and reactive oxygen species(ROS) levels. Western blot was applied to detect the expression levels of transforming growth factor-β1(TGF-β1), phosphorylated mothers against decapentaplegic homolog 3(p-Smad3), Smad3, tissue plasminogen activator(t-PA), and plasminogen activator inhibitor-1(PAI-1) in lung tissue. A blood routine analyzer was used to measure inflammatory immune cell levels in the blood. Enzyme-linked immunosorbent assay(ELISA) was used to detect the expression levels of P-selectin and thromboxane A2(TXA2) in plasma. The results showed that, compared with the NC group, right heart hypertrophy index, right ventricular free wall thickness, right heart internal diameter, partial carbon dioxide pressure(PaCO_2), apoptosis in cardiopulmonary tissue, and ROS levels were significantly increased in the M group. In contrast, the ratio of pulmonary blood flow acceleration time(PAT)/ejection time(PET), right cardiac output, change rate of right ventricular systolic area, systolic displacement of the tricuspid ring, oxygen partial pressure(PaO_2), and blood oxygen saturation(SaO_2) were significantly decreased in the M group. After administration of the total extract of A. sylvestris, right heart function and blood gas levels were significantly improved, while apoptosis in cardiopulmonary tissue and ROS levels significantly decreased. Further testing revealed that the total extract of A. sylvestris significantly decreased the levels of interleukin-1β(IL-1β), interleukin-6(IL-6), and PAI-1 proteins in lung tissue, while increasing the expression of t-PA. Additionally, the extract reduced the levels of inflammatory cells such as leukocytes, lymphocytes, granulocytes, and monocytes in the blood, as well as the levels of P-selectin and TXA2 in plasma. Metabolomics results showed that the total extract of A. sylvestris significantly affected metabolic pathways, including arginine biosynthesis, tyrosine metabolism, and taurine and hypotaurine metabolism. In conclusion, the total extract of A. sylvestris may exert an anti-pulmonary hypertension effect by inhibiting the TGF-β1/Smad3 signaling pathway, thereby alleviating immune-inflammatory responses and thrombosis.
Animals ; Male ; Smad3 Protein/metabolism* ; Transforming Growth Factor beta1/metabolism* ; Rats, Sprague-Dawley ; Rats ; Signal Transduction/drug effects* ; Hypertension, Pulmonary/genetics* ; Thrombosis/immunology* ; Drugs, Chinese Herbal/administration & dosage* ; Humans ; Apoptosis/drug effects*

Medical institutions, with their clinical practice foundation and abundant human use experience data, have become important carriers for the inheritance and innovation of traditional Chinese medicine(TCM) and the "cradles" of the preparation of new TCM. To effectively promote the transformation of new TCM originating from the TCM clinical practice in medical institutions and establish an effective evaluation index system for the transformation of new TCM conforming to the characteristics of TCM, consensus experts adopted the literature research, questionnaire survey, Delphi method, etc. By focusing on the policy and technical evaluation of new TCM originating from the TCM clinical practice in medical institutions, a comprehensive evaluation from the dimensions of drug safety, efficacy, feasibility, and characteristic advantages was conducted, thus forming a comprehensive evaluation system with four primary indicators and 37 secondary indicators. The expert consensus reached aims to encourage medical institutions at all levels to continuously improve the high-quality research and development and transformation of new TCM originating from the TCM clinical practice in medical institutions and targeted at clinical needs, so as to provide a decision-making basis for the preparation, selection, cultivation, and transformation of new TCM for medical institutions, improve the development efficiency of new TCM, and precisely respond to the public medication needs.
Medicine, Chinese Traditional/standards* ; Humans ; Consensus ; Drugs, Chinese Herbal/therapeutic use* ; Surveys and Questionnaires

The antidepressant activity and molecular mechanisms of Yueju Wan volatile oil were investigated. The Yueju Wan volatile oil was extracted by using supercritical CO_2. Gas chromatography-mass spectrometry(GC-MS) combined with network pharmacology identified 28 chemical constituents in Yueju Wan volatile oil, primarily terpenes and lactones. A total of 123 overlapping targets were associated with depression, including core targets of interleukin-1β(IL-1β), signal transducer and activator of transcription 3(STAT3), and caspase-3(CASP3). These targets were mainly involved in the prolactin, advanced glycation end products/receptor(AGE/RAGE), and phosphoinositide 3-kinase/protein kinase B(PI3K/Akt) signaling pathways. A reserpine-induced depression mouse model was established to evaluate the therapeutic effects and mechanisms of Yueju Wan volatile oil. The effects of Yueju Wan volatile oil on depression-like behavior in mice were evaluated by analyzing body mass, body temperature index, tail suspension immobility time, forced swimming immobility time, and sucrose preference. Hematoxylin-eosin(HE) staining revealed neuronal protection of Yueju Wan volatile oil in the brain of mice. Enzyme-linked immunosorbent assay(ELISA) and Western blot were employed to detect the protein expression of AGEs, IL-1β, phosphorylated PI3K(p-PI3K), Akt, phosphorylated Akt(p-Akt), nuclear factor κB(NF-κB), and brain-derived neurotrophic factor(BDNF). Behavioral evaluation showed that Yueju Wan volatile oil could effectively control the decline of body mass and body temperature of depressed mice, reduce tail suspension and swimming immobility time, and enhance their preference for sucrose. Histopathological examination showed that Yueju Wan volatile oil could alleviate the neuronal damage in CA1 and dentate gyrus(DG) of the hippocampus of mice. ELISA and Western blot results showed that Yueju Wan volatile oil could significantly increase the protein expression levels of PI3K, Akt, and BDNF and significantly decrease the protein expression levels of AGEs, IL-1β, p-PI3K, p-Akt, and NF-κB in the hippocampus of mice. Furthermore, the p-PI3K/PI3K and p-Akt/Akt ratios were significantly decreased at medium and high doses. These findings suggest that the aromatherapy of Yueju Wan volatile oil can significantly improve reserpine-induced depression-like behavior in mice, which may be related to reducing the expression of neuronal membrane protein AGEs, reducing the phosphorylation levels of PI3K and Akt, inhibiting NF-κB entry into the nucleus, and alleviating the release of pro-inflammatory factors and nerve injury.
Animals ; Antidepressive Agents/chemistry* ; Mice ; Proto-Oncogene Proteins c-akt/immunology* ; Phosphatidylinositol 3-Kinases/immunology* ; Oils, Volatile/chemistry* ; Male ; Drugs, Chinese Herbal/chemistry* ; Signal Transduction/drug effects* ; Depression/metabolism* ; Glycation End Products, Advanced/immunology* ; Humans

Geniposidic acid(GA), a natural iridoid, exists in the roots, stems, leaves, flowers, bark, fruits, and seeds of medicinal plants of Rubiaceae, Eucommiaceae, and Plantaginaceae. Modern pharmacological studies have revealed that GA has multiple pharmacological activities, including organ-protective, anti-inflammatory, antioxidative, anti-osteoporosis, anti-neurodegenerative, and anti-cardiovascular effects. GA can enhance cell/organism defenses by upregulating key anti-inflammatory and antioxidant cytokines, while downregulating key node proteins in pro-inflammatory signaling pathways such as AhR and TLR4/MyD88, thereby exerting pharmacological effects such as organ protection. Pharmacokinetic investigations have suggested that after oral administration, GA can be distributed in multiple organs(kidney, liver, heart, spleen, lung, etc.). In addition, the pharmacokinetic behavior of GA could be significantly altered under disease conditions, as demonstrated by a marked increase in systematic exposure. This article comprehensively summarizes the reported pharmacological activities and mechanisms and systematically analyzes the pharmacokinetic characteristics and key parameters of GA, with the aim of providing a theoretical basis and scientific reference for the precise clinical application of GA-related Chinese patent medicines, as well as for the investigation and development of innovative drugs based on GA.
Humans ; Drugs, Chinese Herbal/chemistry* ; Animals ; Iridoid Glucosides/chemistry* ; Plants, Medicinal/chemistry* ; Anti-Inflammatory Agents/pharmacology*

OBJECTIVE: To explore the co-morbid influencing factors of postmenopausal osteoporosis(PMOP) and dyslipidemia, and to provide evidence-based basis for clinical co-morbidity management. METHODS: Based on the 2017 to 2018 Beijing community cross-sectional survey data, PMOP patients were included and divided into the dyslipidemia group and the uncomplicated dyslipidemia group according to whether they were comorbid with dyslipidemia. Demographic characteristics, living habits and disease history were collected through questionnaires, and bone mineral density and bone metabolism biomarkers (osteocalcin, blood calcium, serum typeⅠprocollagen N-terminal prepeptide, etc.) were detected on site. Co-morbidity risk factors were analyzed using binary logistic regression. RESULTS: Three hundred and twenty patients with PMOP were included, including the comorbid group (75 patients) and the uncomplicated group (245 patients). The results showed that history of cardiovascular disease [OR=1.801, 95%CI(1.003, 3.236), P=0.049], history of cerebrovascular disease [OR=2.923, 95%CI(1.460, 5.854), P=0.002], frying and cooking methods[OR=5.388, 95%CI(1.632, 17.793), P=0.006], OST results[OR=0.910, 95%CI(0.843, 0.983), P=0.016], and blood Ca results [OR=60.249, 95%CI(1.862, 1 949.926), P=0.021] were the influencing factors of PMOP complicated with dyslipidemia. CONCLUSION Focus should be placed on the influencing factors of PMOP and dyslipidemia co-morbidities, with emphasis on multidimensional assessment, combining lifestyle interventions with bone metabolism marker monitoring to optimize co-morbidity management.
Humans ; Dyslipidemias/epidemiology* ; Female ; Middle Aged ; Osteoporosis, Postmenopausal/metabolism* ; Aged ; Cross-Sectional Studies ; Risk Factors ; Bone Density

Male factors contribute to 50% of infertility cases, with 20%-30% of cases being solely attributed to male infertility. Helicase for meiosis 1 ( HFM1 ) plays a crucial role in ensuring proper crossover formation and synapsis of homologous chromosomes during meiosis, an essential process in gametogenesis. HFM1 gene mutations are associated with male infertility, particularly in cases of non-obstructive azoospermia and severe oligozoospermia. However, the effects of intracytoplasmic sperm injection (ICSI) in HFM1 -related infertility cases remain inadequately explored. This study identified novel biallelic HFM1 variants through whole-exome sequencing (WES) in a Chinese patient with severe oligozoospermia, which was confirmed by Sanger sequencing. The pathogenicity of these variants was assessed using real-time quantitative polymerase chain reaction (RT-qPCR) and immunoblotting, which revealed a significant reduction in HFM1 mRNA and protein levels in spermatozoa compared to those in a healthy control. Transmission electron microscopy revealed morphological abnormalities in sperm cells, including defects in the head and flagellum. Despite these abnormalities, ICSI treatment resulted in a favorable fertility outcome for the patient, indicating that assisted reproductive techniques (ART) can be effective in managing HFM1 -related male infertility. These findings offer valuable insights into the management of such cases.
Humans ; Male ; Sperm Injections, Intracytoplasmic ; Oligospermia/therapy* ; Adult ; Spermatozoa/ultrastructure* ; Exome Sequencing ; Mutation

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To study the epidemiological characteristics of respiratory syncytial virus (RSV) infection in hospitalized children with community-acquired pneumonia (CAP) in Hebei Province. METHODS: Hospitalized children with CAP who tested positive for RSV and were admitted to Hebei Children's Hospital from various cities and counties across Hebei Province between January 2019 and December 2023 were included in the study. Clinical data were collected and analyzed to assess epidemiological characteristics. RESULTS: The clinical data of 43 978 children with CAP were collected, with an overall RSV detection rate of 25.98%. The detection rate was higher during the implementation of non-pharmaceutical interventions (NPIs) (30.60%) than in the non-NPIs period. Winter and spring were the primary epidemic seasons for RSV each year except in 2022. The detection rate in males (26.62%) was higher than in females (25.06%) (P<0.001). The highest detection rate (59.18%) was found in infants aged 29 days to <1 year. Single RSV infection was more common, with rhinovirus being the most frequent co-infection. CONCLUSIONS The overall RSV detection rate in Hebei Province is influenced by NPIs, being higher during their implementation. RSV predominantly circulates in winter and spring. The detection rate of RSV is higher in males and infants. RSV infection is primarily single, most often co-occurring with rhinovirus.
Humans ; Respiratory Syncytial Virus Infections/epidemiology* ; Female ; Male ; Infant ; Child, Preschool ; Seasons ; China/epidemiology* ; Infant, Newborn ; Community-Acquired Infections/epidemiology* ; Child

[This corrects the article DOI: 10.11909/j.issn.1671-5411.2017.08.005.].

OBJECTIVE: To evaluate the efficacy and safety of Shexiang Tongxin Dropping Pill (STDP) in treating stable angina patients with phlegm-heat and blood-stasis syndrome by exercise duration and metabolic equivalents. METHODS: This multicenter, randomized, double-blind, placebo-controlled clinical trial enrolled stable angina patients with phlegm-heat and blood-stasis syndrome from 22 hospitals. They were randomized 1:1 to STDP (35 mg/pill, 6 pills per day) or placebo for 56 days. The primary outcome was the exercise duration and metabolic equivalents (METs) assessed by the standard Bruce exercise treadmill test after 56 days of treatment. The secondary outcomes included the total angina symptom score, Chinese medicine (CM) symptom scores, Seattle Angina Questionnaire (SAQ) scores, changes in ST-T on electrocardiogram and adverse events (AEs). RESULTS: This trial enrolled 309 patients, including 155 and 154 in the STDP and placebo groups, respectively. STDP significantly prolonged exercise duration with an increase of 51.0 s, compared to a decrease of 12.0 s with placebo (change rate: -11.1% vs. 3.2%, P<0.01). The increase in METs was significantly greater in the STDP group than in the placebo group (change: -0.4 vs. 0.0, change rate: -5.0% vs. 0.0%, P<0.01). The improvement of total angina symptom scores (25.0% vs. 0.0%), CM symptom scores (38.7% vs. 11.8%), reduction of nitroglycerin consumption (100.0% vs. 11.3%), and all domains of SAQ, were significantly greater with STDP than placebo (all P<0.01). The changes in Q-T intervals at 28 and 56 days from baseline were similar between the two groups (both P>0.05). Twenty-five participants (16.3%) with STDP and 16 (10.5%) with placebo experienced AEs (P=0.131), with no serious AEs observed. CONCLUSION STDP could improve exercise tolerance in patients with stable angina and phlegm-heat and blood stasis syndrome, with a favorable safety profile. (Registration No. ChiCTR-IPR-15006020).
Humans ; Double-Blind Method ; Drugs, Chinese Herbal/adverse effects* ; Male ; Female ; Middle Aged ; Angina, Stable/physiopathology* ; Aged ; Syndrome ; Treatment Outcome ; Placebos ; Tablets